OMIA:002547-9913 : Haplotype with homozygous deficiency HH25, RIOX1-related in Bos taurus (taurine cattle) |
Categories: Mortality / aging (incl. embryonic lethal)
Links to possible relevant human trait(s) and/or gene(s) in OMIM: 611919 (gene)
Single-gene trait/disorder: yes
Mode of inheritance: Autosomal recessive
Disease-related: yes
Key variant known: yes
Year key variant first reported: 2022
Inheritance: Häfliger et al. (2022) reported a 75% deficiency of homozygotes for this haplotype in Swiss Holsteins.
Markers: Based on strong evidence from Swiss Holsteins, Häfliger et al. (2022) reported RIOX1; c.396_425delGGC GCA GAC CCC GGC GGC ACG CTT GGT GGA as a likely causal variant for haplotype H25.
Breed:
Holstein-Friesian, Switzerland (Cattle) (VBO_0003139).
Breeds in which the phene or likely causal variants have been documented. If a likely causal variant has been documented, see variant-specific breed information in the variant table. (Breed information may be incomplete).
Associated gene:
| Symbol | Description | Species | Chr | Location | OMIA gene details page | Other Links |
|---|---|---|---|---|---|---|
| RIOX1 | Bos taurus | 10 | NC_037337.1 (84937977..84940480) | RIOX1 | Ensembl, NCBI gene |
Variants
By default, variants are sorted chronologically by year of publication, to provide a historical perspective.
Readers can re-sort on any column by clicking on the column header. Click it again to sort in a descending
order. To create a multiple-field sort, hold down Shift while clicking on the second, third etc relevant column
headers.
WARNING! Inclusion of a variant in this table does not automatically mean that it should be used for DNA testing. Anyone contemplating the use of any of these variants for DNA testing should examine critically the relevant evidence (especially in breeds other than the breed in which the variant was first described). If it is decided to proceed, the location and orientation of the variant sequence should be checked very carefully.
Since October 2021, OMIA includes a semiautomated lift-over pipeline to facilitate updates of genomic positions to a recent reference genome position. These changes to genomic positions are not always reflected in the ‘acknowledgements’ or ‘verbal description’ fields in this table.
| OMIA Variant ID | Breed(s) | Variant Phenotype | Gene | Allele | Variant Type | Variant Effect | Source of Genetic Variant | Pathogenicity Classification* | Reference Sequence | Chr. | g. or m. | c. or n. | p. | Verbal Description | EVA ID | Year Published | PubMed ID(s) | Acknowledgements |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1442 | Holstein-Friesian, Switzerland (Cattle) | Haplotype HH25 deficiency | RIOX1 | deletion, gross (>20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 10 | g.84938408_84938437del | c.396_425del | p.(A133_E142del) | NM_001099702.1; NP_001093172.1; published as c.396_425delGGCGCAGACCCCGGCGGCACGCTTGGTGGA | 2022 | 35361830 |
* Variant pathogenicity for single gene diseases as evaluated by an expert panel of the International Society of Animal Genetics (ISAG) Animal Genetic Testing Standardization Standing Committee
Contact us
If you notice anything missing or in need of change, please contact us at: [email protected].
Cite this entry
Nicholas, F. W., Tammen, I., & Sydney Informatics Hub. (2022). OMIA:002547-9913: Online Mendelian Inheritance in Animals (OMIA) [dataset]. https://omia.org/. https://doi.org/10.25910/2AMR-PV70
Reference
| 2022 | Häfliger, I.M., Spengeler, M., Seefried, F.R., Drögemüller, C. : |
| Four novel candidate causal variants for deficient homozygous haplotypes in Holstein cattle. Sci Rep 12:5435, 2022. Pubmed reference: 35361830. DOI: 10.1038/s41598-022-09403-6. |
Edit History
- Created by Frank Nicholas on 04 Apr 2022
- Changed by Frank Nicholas on 04 Apr 2022