OMIA:002837-9646 : Coat colour, brown and white, BACE2-related in Ailuropoda melanoleuca (giant panda)

Categories: Pigmentation phene

Links to possible relevant human trait(s) and/or gene(s) in OMIM: 605668 (gene)

Single-gene trait/disorder: yes

Mode of inheritance: Autosomal recessive

Disease-related: no

Key variant known: yes

Year key variant first reported: 2024

Species summary: Brown-and-white giant pandas are distinct coat color mutants first reported in 1985 in the Qinling Mountains, Shaanxi, China (Guan et al., 2024).

Molecular basis: Guan et al. (2024) "identified the genetic basis for [the white and brown] coat color variation using a combination of field ecological data, population genomic data, and a CRISPR-Cas9 knockout mouse model. [The aurhors] de novo assembled a long-read-based giant panda genome and resequenced the genomes of 35 giant pandas, including two brown pandas and two family trios associated with a brown panda. [The authors] identified a homozygous 25-bp deletion in the first exon of Bace2, a gene encoding amyloid precursor protein cleaving enzyme, as the most likely genetic basis for brown-and-white coat color. This deletion was further validated using PCR and Sanger sequencing of another 192 black giant pandas and CRISPR-Cas9 edited knockout mice. [The] investigation revealed that this mutation reduced the number and size of melanosomes of the hairs in knockout mice and possibly in the brown panda, further leading to the hypopigmentation."

Associated gene:

Symbol Description Species Chr Location OMIA gene details page Other Links
BACE2 beta-secretase 2 Ailuropoda melanoleuca 1 NC_048218.1 (4466610..4384292) BACE2 Ensembl, NCBI gene

Variants

By default, variants are sorted chronologically by year of publication, to provide a historical perspective. Readers can re-sort on any column by clicking on the column header. Click it again to sort in a descending order. To create a multiple-field sort, hold down Shift while clicking on the second, third etc relevant column headers.

WARNING! Inclusion of a variant in this table does not automatically mean that it should be used for DNA testing. Anyone contemplating the use of any of these variants for DNA testing should examine critically the relevant evidence (especially in breeds other than the breed in which the variant was first described). If it is decided to proceed, the location and orientation of the variant sequence should be checked very carefully.

Since October 2021, OMIA includes a semiautomated lift-over pipeline to facilitate updates of genomic positions to a recent reference genome position. These changes to genomic positions are not always reflected in the ‘acknowledgements’ or ‘verbal description’ fields in this table.

OMIA Variant ID Breed(s) Variant Phenotype Gene Allele Variant Type Variant Effect Source of Genetic Variant AVCG Pathogenicity Classification* Reference Sequence Chr. g. or m. c. or n. p. Verbal Description EVA ID Year Published PubMed ID(s) Acknowledgements
1676 Coat colour, brown white BACE2 deletion, gross (>20) Naturally occurring variant Not currently evaluated 1 c.176_200del Published as c.176_200delTCGCCCTGGAGCCCGCCGGCGGCGC; g.4545815_4545839del 2024 38437540

* Variant pathogenicity for single-gene diseases as evaluated according to the Animal Variant Classification Guidelines (AVCG) by the Variant Pathogenicity Working Group of the International Society of Animal Genetics (ISAG) Animal Genetic Testing Standardization (AGTS) Standing Committee: P = pathogenic, LP = likely pathogenic, VUS = variant of unknown significance, LB = likely benign, B = benign. For more information (including details on the classification of each variant) see LINKS.

Contact us

If you notice anything missing or in need of change, please contact us at: [email protected].

Cite this entry

Nicholas, F. W., Tammen, I., & Sydney Informatics Hub. (2024). OMIA:002837-9646: Online Mendelian Inheritance in Animals (OMIA) [dataset]. https://omia.org/. https://doi.org/10.25910/2AMR-PV70

References

Note: the references are listed in reverse chronological order (from the most recent year to the earliest year), and alphabetically by first author within a year.

2024 Guan, D., Sun, S., Song, L., Zhao, P., Nie, Y., Huang, X., Zhou, W., Yan, L., Lei, Y., Hu, Y., Wei, F. :
Taking a color photo: A homozygous 25-bp deletion in Bace2 may cause brown-and-white coat color in giant pandas. Proc Natl Acad Sci U S A 121:e2317430121, 2024. Pubmed reference: 38437540. DOI: 10.1073/pnas.2317430121.
2010 Nicholls, H. :
Mystery of the giant brown panda deepens. Nature , 2010. DOI: 10.1038/news.2010.19.

Edit History


  • Created by Imke Tammen on 08 Apr 2024
  • Changed by Imke Tammen on 08 Apr 2024