OMIA:002902-9913 : Osteochondrodysplastic and cardiomyopathic syndrome in Bos taurus (taurine cattle)

Categories: Skeleton phene (incl. short stature & teeth) , Cardiovascular system phene

Links to possible relevant human trait(s) and/or gene(s) in OMIM: 615235 (trait) , 600133 (gene) , 616146 (gene) , 616145 (trait)

Single-gene trait/disorder: unknown

Disease-related: yes

Key variant is published: no

Molecular basis: Jacinto et al. (2024): "Genetic analysis [of affected Chianina cattle] identified a missense variant in TGDS [ARS-UCD1.2:Chr12:69092831A>T; NM_001101159.1: c.160T>A; NP_001094629.1: p.Tyr54Asn] and a splice-site variant in LAMA4 [ARS-UCD1.2:Chr9:38176716GAGAAAGTGAGAGAGGGAAACAGAGGGGAGAGAGAA>G; XM_024996678.1:c.153_153 + 34delAGTGAGAGAGGGAAACAGAGGGGAGAGAGAAAGAA], both of which were homozygous in the 2 cases. Parents were heterozygous and allele frequency in the Chianina population for the TGDS variant was 5% and for the LAMA4 variant was 2%." The authors conclude:  "Reporting of additional similarly affected calves would help in understanding the underlying possible genetic causes and better clarify the mode of inheritance and role of the identified variants."

Clinical features: Jacinto et al. (2024) report two "Chianina half-sibling calves from consanguineous mating with congenital skeletal malformations and cardiac abnormalities ... . ... The cases presented with retarded growth, poor nutritional status associated with muscular atrophy and angular deformities of the hindlimbs. Radiologic examination identified generalized osteopenia and shortening of the limb long bones."

Pathology: Jacinto et al. (2024): "Necropsy [of affected Chianina cattle] showed osteochondrodysplastic limbs and dilatation of the heart right ventricle. On histological examination, the physeal cartilages were characterized by multifocal mild to moderate loss of the normal columnar arrangement of chondrocytes. Osteopenia also was observed."

Breed: Chianina (Cattle) (VBO_0000178).
Breeds in which the phene or likely causal variants have been documented. If a likely causal variant has been documented, see variant-specific breed information in the variant table. (Breed information may be incomplete).

Contact us

If you notice anything missing or in need of change, please contact us at: [email protected].

Cite this entry

Nicholas, F. W., Tammen, I., & Sydney Informatics Hub. (2024). OMIA:002902-9913: Online Mendelian Inheritance in Animals (OMIA) [dataset]. https://omia.org/. https://doi.org/10.25910/2AMR-PV70

Reference

2024 Jacinto, J.G.P., Ogundipe, T.G., Benazzi, C., Häfliger, I.M., Muscatello, L.V., Bolcato, M., Rinnovati, R., Gentile, A., Drögemüller, C. :
Familial osteochondrodysplastic and cardiomyopathic syndrome in Chianina cattle. J Vet Intern Med 38:3346-3357, 2024. Pubmed reference: 39460958. DOI: 10.1111/jvim.17221.

Edit History


  • Created by Imke Tammen on 12 Nov 2024
  • Changed by Imke Tammen on 12 Nov 2024