Search Results

Advanced search

Link to this search: https://omia.org/results/?search_type=advanced&gb_species_id=9913&result_type=variant&singlelocus=yes&characterised=yes

299 variant records found

[show instead phene records]

By default, variants are sorted chronologically by year of publication, to provide a historical perspective. Readers can re-sort on any column by clicking on the column header. Click it again to sort in a descending order. To create a multiple-field sort, hold down Shift while clicking on the second, third etc relevant column headers.

WARNING! Inclusion of a variant in this table does not automatically mean that it should be used for DNA testing. Anyone contemplating the use of any of these variants for DNA testing should examine critically the relevant evidence (especially in breeds other than the breed in which the variant was first described). If it is decided to proceed, the location and orientation of the variant sequence should be checked very carefully.

Since October 2021, OMIA includes a semiautomated lift-over pipeline to facilitate updates of genomic positions to a recent reference genome position. These changes to genomic positions are not always reflected in the ‘acknowledgements’ or ‘verbal description’ fields in this table.

OMIA Variant ID OMIA Phene-Species ID(s) Species Name Breed(s) Variant Phenotype Gene Allele Variant Type Variant Effect Source of Genetic Variant AVCG Pathogenicity Classification* Reference Sequence Chr. g. or m. c. or n. p. Verbal Description EVA ID Year Published PubMed ID(s) Acknowledgements
1126 OMIA:002238-9913 taurine cattle Shorthorn (Cattle) Ichthyosis, ABCA12-related ABCA12 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 2 g.103016791A>G c.6776T>C p.(L2259P) NM_001191294.2:c.6776T>C; NP_001178223.2:p.(Leu2259Pro) rs5334475100 2019 31568573
1220 OMIA:002238-9913 taurine cattle Polled Hereford (Cattle) Ichthyosis, ABCA12-related ABCA12 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 2 g.103043495_103043496insG c.5689_5690insC p.(S1784Ifs*33) BTA 2:103043495–103043496insG; ENSBTAT00000004518.6:c.5689‐5690insC; ENSBTAP00000004518.6:p.(Ser1784Ilefs*33) (Eager et al., 2020) rs3423092881 2020 32567073
195 OMIA:002238-9913 taurine cattle Chianina (Cattle) Ichthyosis, ABCA12-related ABCA12 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.103030489T>C NM_001191294.2:c.5804A>G NP_001178223.2:p.(H1935R) previously listed in OMIA as ARS-UCD1.2:g.103025585T>C,  g. coordinates have been corrected after review of original paper and incorrectly assigned EVA rs ID has been removed [29/08/2024] 2008 18344998
1477 OMIA:002561-9913 taurine cattle Deutsche Holstein Schwarzbunt, Germany (Cattle) Infertility ABHD16B substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 13 NC_037340.1:g.53957903G>A NM_001038541.2:c.652C>T NP_001033630.1:p.(Q218*) ENSBTAT00000045249.4; ENSBTAP00000055253.1 rs468948776 2020 31963602
429 OMIA:001271-9913 taurine cattle Dexter (Cattle) Bulldog calf ACAN BD2 substitution regulatory Naturally occurring variant Not currently evaluated ARS-UCD1.2 21 g.20377856C>T c.-198C>T rs3423095877 2007 17952705 Variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
590 OMIA:001271-9913 taurine cattle Dexter (Cattle) Highland (Cattle) Bulldog calf ACAN BD1 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 21 g.20422104_20422105insGGCA c.2266_2267insGGCA Variant initially identified in Dexter cattle and later reported in additional breeds: PMID:26885599 2007 17952705 Variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1419 OMIA:002226-9913 taurine cattle Brown Swiss (Cattle) Haplotype with homozygous deficiency BH34 ACSL5 BH34 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 26 NC_037353.1:g.32940521C>G NM_001075650.1:c.528C>G NP_001069118.1:p.(N176K) NM_001075650.1 rs5357452907 2021 34915862
486 OMIA:000328-9913 taurine cattle Belgian Blue (Cattle) Ehlers-Danlos syndrome, type VII (Dermatosparaxis) ADAMTS2 delins, small (<=20) Naturally occurring variant Not currently evaluated ARS-UCD1.2 7 g.2017035_2017051delinsAGC c.464_480delinsAGC 1999 10417273 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
1163 OMIA:001562-9913 taurine cattle Cikasto govedo, Slovenia (Cattle) Pulmonary hypoplasia and anasarca syndrome ADAMTS3 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 6 NC_037333.1:g.87462016G>A NM_001192797.1:c.1222C>T NP_001179726.1:p.(H408T) NM_001192797.1: c.1222C>T; NP_001179726.1: p.(His408Tyr) (Häfliger et al., 2020) rs5334475098 2020 32069517
935 OMIA:001511-9913 taurine cattle Angus (Cattle) Contractual arachnodactyly (Fawn calf syndrome) ADAMTSL3 deletion, gross (>20) Naturally occurring variant Not currently evaluated 21 "a large (~58 kilobase pair) deletion affecting the ADAMTSL3 gene" 2014 Reference not in PubMed; see OMIA 001511-9913 for reference details
1435 OMIA:002535-9913 taurine cattle Original Swiss Brown (Cattle) Congenital cataract ADAMTSL4 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 3 NC_037330.1:g.20146737C>T NM_001101061.1:c.2327G>A NP_001094531.1:p.(R776H) NM_001101061.1; NP_001094531.1 rs5353205567 2022 35233794
934 OMIA:002135-9913 taurine cattle Angus (Cattle) Arthrogryposis multiplex congenita, AGRN-related AGRN deletion, gross (>20) Naturally occurring variant Not currently evaluated 16 A 23,363 bp deletion "encompasses the entirety of the ISG15 ubiquitin-like modifier (ISG15) gene . . . one or both of the 5' regulatory region of the hairy and enhancer split 4 (HES4) and of the agrin (AGRN) gene and of the first two exons of the AGRN gene" (Beever and Marron, 2011) 2011 Reference not in PubMed; see OMIA 002135-9913 for reference details
1629 OMIA:002788-9913 taurine cattle Holstein Friesian (Cattle) Subfertility, AK9-related AK9 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.2 9 g.40620329A>G rs457222030 2021 34028060
764 OMIA:001009-9913 taurine cattle Shorthorn (Cattle) Tibial hemimelia ALX4 deletion, gross (>20) Naturally occurring variant Not currently evaluated 15 Deletion of 45,694 bp including exon 1 of ALX4 2012 Reference not in PubMed; see OMIA 001009-9913 for reference details
763 OMIA:001009-9913 taurine cattle Galloway (Cattle) Tibial hemimelia ALX4 ALX4dup-GAU / ALX4dup-LfL duplication frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 15 NC_037342.1:g.74384919_74384938dup NM_001030304.1:c.713_732dup NP_001025475.1:p.(Q245fs) Initially reported as g.75154399_75154418dup in UMD3.1 and g.74384916_74384935dup in ARS-UCD1.2.. Updated  to current coordinates after publication of a correction by the authors (PMID: 39298916) [23/09/2024]. The variant is now identical to a variant reported by Buitkamp et al. (2023, PMID:36585373), which was previously listed as omia.variant:1516. Both variants are now merged into one entry and omia.variant:1516 is redundant. 2015 26076463 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. The same ARS-UCD1.2 location in the reverse order was included in the paper by Buitkamp et al. (2022). The allele name ALX4dup-GAU was also given by Buitkamp et al. (2022).
927 OMIA:002083-9913 taurine cattle Japanese Black, Japan (Cattle) Abortion (embryonic lethality), ANXA10-related ANXA10 repeat variation Naturally occurring variant Not currently evaluated 8 "a "34-kb deleted-type" CNV "associated with embryonic mortality at 30-60 days after artificial insemination. The CNV harbors exon 2 to 6 of ANNEXIN A10 (ANXA10). . . . Western blot analysis showed that the CNV results in a null allele of ANXA10." 2016 27881083
286 OMIA:000001-9913 taurine cattle Blanco Orejinegro, Colombia (Cattle) Holstein Friesian (Cattle) Abortion due to a nonsense mutation in APAF1 on haplotype HH1 APAF1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 g.62810245C>T XM_015471110.2:c.1735C>T XP_015326596.1:p.(Q579*) Variant initially reported in Holstein Friesian cattle and later reported in additional breeds: PMID:34779908. Previously listed in OMIA as: p.(Q581*), c.1741C>T, updated to recent transcript information [03/09/2024] rs448942533 2016 27289157 Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
731 OMIA:001965-9913 taurine cattle Holstein Friesian (Cattle) Simmental (Cattle) Swiss Fleckvieh (Cattle) Holstein cholesterol deficiency APOB insertion, gross (>20) frameshift Naturally occurring variant Not currently evaluated 11 "1.3kb insertion of a transposable LTR element (ERV2-1) in the coding sequence of the APOB gene, which leads to truncated transcripts and aberrant splicing [p.Gly135ValfsX10)]" 2016 26763170 Additional breed inforamtion based on PMID: 40312951
780 OMIA:001334-9913 taurine cattle Swedish Red (Cattle) Sperm, short tail ARMC3 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 13 g.24024660del c.1442del p.(A451fs*26) rs797454424 2016 26923438 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
712 OMIA:000201-9913 taurine cattle Normande (Cattle) Brindle ASIP Abr insertion, gross (>20) Naturally occurring variant Not currently evaluated 13 "insertion of a full-length Bos taurus LINE element" 2006 16827753
289 OMIA:000194-9913 taurine cattle Blanco Orejinegro, Colombia (Cattle) Brown Swiss (Cattle) Holstein Friesian (Cattle) Citrullinaemia ASS1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 11 NC_037338.1:g.100781668C>T NM_173892.4:c.256C>T NP_776317.1:p.(R86*) Variant initially identified in Holstein Friesian and later reported in additional breeds: PMID:30014197, PMID:34779908. rs5334475062 1989 2813370 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
188 OMIA:001450-9913 OMIA:001464-9913 taurine cattle Belgian Blue (Cattle) Maas-Rijn-Ijssel (Cattle) Congenital muscular dystonia 1 ATP2A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 25 NC_037352.1:g.25933247G>A NM_001075767.1:c.1675C>T NP_001069235.1:p.(R559C) Variant is reported to cause congenital muscular dystonia 1 in Belgian Blue cattle (OMIA 001450-9913) and congenital pseudomyotonia in a Dutch improved red and white cross-bred calf (OMIA:001464_9913). rs5334475104 2008 18344998 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). 
219 OMIA:001464-9913 taurine cattle Romagnola (Cattle) Pseudomyotonia, congenital ATP2A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 25 NC_037352.1:g.25939141C>A NM_001075767.1:c.857G>T NP_001069235.1:p.(G286V) This variant was identified as part of a haplotype with the G211V variant in Romagnola cattle. Akyürek et al. (2022; PMID: 36293223) suggest that the G286V variant is likely to be benign and that the G211V is likely to be causal. rs3423529256 2012 23046865 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
218 OMIA:001464-9913 taurine cattle Romagnola (Cattle) Pseudomyotonia, congenital ATP2A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 25 NC_037352.1:g.25939366C>A NM_001075767.1:c.632G>T NP_001069235.1:p.(G211V) rs5334474971 2012 23046865 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
205 OMIA:001464-9913 taurine cattle Chianina (Cattle) Marchigiana (Cattle) Romagnola (Cattle) Pseudomyotonia, congenital ATP2A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 25 NC_037352.1:g.25940510C>T NM_001075767.1:c.491G>A NP_001069235.1:p.(R164H) Variant initially identified in Chianina cattle and later reported in additional breeds: PMID: 35717834 rs3423529241 2008 18786632 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
298 OMIA:000627-9913 taurine cattle Polled Hereford (Cattle) Maple syrup urine disease BCKDHA substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.2 18 g.50551011C>T c.148C>T p.(Q50*) cDNA position based on ENSBTAT00000021342.6 rs5334475064 1990 2303405
200 OMIA:000627-9913 taurine cattle Shorthorn (Cattle) Maple syrup urine disease BCKDHA substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 18 g.50560242C>T c.1380C>T p.(P372L) rs3423447991 1999 10425233 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
305 OMIA:001079-9913 taurine cattle Holstein Friesian (Cattle) Yellow fat BCO2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 15 NC_037342.1:g.22552375G>A NM_001101987.2:c.306G>A NP_001095457.2:p.(W102*) UMD3.1 position is g.22877552G>A; cDNA position is based on XM_024975217.1 rs109226280 2009 19398771 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1766 OMIA:002913-9913 taurine cattle Holstein Friesian (Cattle) Cardiac malformation, BRI3BP-related BRI3BP substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 17 NC_037344.1:g.50813902C>T NM_001099087.1:c.478G>A NP_001092557.1:p.(V160I) likely de novo variant 2025 39593234
981 OMIA:001991-9913 taurine cattle Nordic Red (Cattle) Stillbirth BTBD9 deletion, gross (>20) Naturally occurring variant Not currently evaluated 23 "∼525 KB deletion on Chr23:12,291,761-12,817,087 (overlapping BTBD9, GLO1 and DNAH8)" 2016 27091210
1660 OMIA:002819-9913 taurine cattle Holstein Friesian (Cattle) Muscle weakness CACNA1S substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 16 NC_037343.1:g.79613592C>T XM_024976574.1:c.3853G>A XP_024832342.1:p.G1285S ENSBTAT00000065901.3; ENSBTAP00000054797.3 rs3423414874 2024 38246543
1852 OMIA:003025-9913 taurine cattle Angus (Cattle) Cerebellar abiotrophy CACNA2D2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 22 NC_037349.1:g.49970603T>C XM_024983269.1:c.1183T>C XP_024839037.1:p.(C395R) 2026 41873845
1087 OMIA:002201-9913 taurine cattle Normande (Cattle) Abortion due to haplotype NH7 CAD substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 11 g.72409143T>C p.(Y452C) published as CAD g.72399397T>C; p.Tyr452Cys rs5334475092 2019 31056337 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1032 OMIA:002167-9913 taurine cattle Nordic Red (Cattle) Asthenospermia CCDC189 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.2 25 g.26880841C>T Touru et al. (2019): "a variant disrupting a canonical 5’ splice donor site (GCA_000003055.3:Chr25:g.27138357C>T) in CCDC189 (transcript - ID:ENSBTAT00000045037) encoding the coiled-coil domain containing protein 189." rs5334474909 2019 30975085
1528 OMIA:002626-9913 taurine cattle Japanese Black, Japan (Cattle) Haplotype with homozygous deficiency JBH17, CDC45-related CDC45 substitution splicing Naturally occurring variant Not currently evaluated UMD_3.1.1 17 g.74743512G>T located in a splicing donor site at a distance of 5 bp, affecting pre-mRNA splicing 2021 33758295
991 OMIA:001830-9913 taurine cattle Holstein (black and white) (Cattle) Abortion due to haplotype HH7 CENPU deletion, small (<=20) splicing Naturally occurring variant Not currently evaluated ARS-UCD1.2 27 g.15123637_15123640del Hozé et al. (2019): "Considering that CENPU is transcribed in the antisense orientation, this mutation is predicted to result in deletion of the nucleotides located at position +3 to + 6 bp after the splicing donor site of exon 11. Using cross-species nucleotide alignment, we observed that the nucleotide at position +3 is entirely conserved among vertebrates . . . , which suggests that it plays an important role in regulation of CENPU splicing. If modified after exon 11, the abnormal splicing of CENPU could cause mRNA decay or the production of a protein modified after residue 319 out of 409 AA. Based on these factors, we assumed that mutation g.14168130_14168133delTACT on chromosome 27 alters the splicing of CENPU and is embryonic lethal." 2020 31733857
964 OMIA:001502-9913 taurine cattle Montbéliarde (Cattle) Caprine-like Generalized Hypoplasia Syndrome CEP250 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.2 13 g.64710424C>T c.493C>T p.(Q165*) rs5334474991 2015 25902731 Coordinates obtained from and/or confirmed by EBI's VEP
838 OMIA:002125-9913 taurine cattle Montbéliarde (Cattle) Neurocristopathy CHD7 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 14 g.26402250_26402254del p.(K594Afs*29) 2017 28904385
554 OMIA:002022-9913 taurine cattle Red Dane (Cattle) Arthrogryposis multiplex congenita, CHRNB1-related CHRNB1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.27122027del NM_174516.2:c.55del NP_776941.1:p.(A19Pfs47*) Published as Chr19:27757270CG > C; CHRNB1 c.55delG; (p.Ala19Profs47*) rs5334474854 2016 27364156 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
210 OMIA:001887-9913 taurine cattle Belgian Blue (Cattle) Osteopetrosis with gingival hamartomas CLCN7 haplotype missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 25 g.[1139611G>T; 1139613A>G] c.[2248T>C;2250C>A] p.(Y750Q) 2014 24159188 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
648 OMIA:001135-9913 taurine cattle Japanese Black, Japan (Cattle) Renal dysplasia CLDN16 Type 1 deletion, gross (>20) Naturally occurring variant Not currently evaluated 1 37kb deletion of exons 1-4 2000 10810088
781 OMIA:001135-9913 taurine cattle Japanese Black, Japan (Cattle) Renal dysplasia CLDN16 Type 2 deletion, gross (>20) Naturally occurring variant Not currently evaluated 1 "a 56-kb deletion that eliminates exons 1-4 and 21-bp of exon 5" 200922: g. info moved to here (g.77528017_?) until can be standardised 2002 12047224 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
1669 OMIA:002432-9913 taurine cattle Hereford (Cattle) Retinal degeneration, CLN3-realted CLN3 delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 25 NC_037352.1:g.26043843del NM_001075174.2:c.1106del NP_001068642.2:p.(P369Rfs*8) NM_001075174.2; NP_001068642.2 rs5377951844 2024 38516801
593 OMIA:001482-9913 taurine cattle Devon (Cattle) Neuronal ceroid lipofuscinosis, 5 CLN5 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 12 g.52112732_52112733insG c.662_663insG p.(R221Gfs*6) 2006 16935476 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) 210909: after checking the genome assembly sequence, FN changed g.52461241insG to g.52461241_52461242insG; and c.662insG to c.662_663insG
1400 OMIA:001365-9913 taurine cattle Brown Swiss (Cattle) Original Swiss Brown (Cattle) Achromatopsia CNGB3 OH1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 14 NC_037341.1:g.76011964G>A XM_015474554.2:c.751G>A XP_015330040.2:p.(D251N) XM_015474554.2: c.751G>A, XP_015330040.2: p.Asp251Asn ENSBTAT00000065296.2:c.751G>A ENSBTAP00000054173.2:p.Asp251Asn rs716218235 2021 34830323
839 OMIA:002127-9913 taurine cattle Simmental (Cattle) Osteogenesis imperfecta, type II, COL1A1-related COL1A1 delins, small (<=20) delins (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.2 19 g.36470764_36470767delinsT c.3145_3148delinsT p.(A1049_P1050delinsS) UMD3.1 position is g.37101299_37101302delinsT; cDNA position based on ENSBTAT00000017420.4 rs876049195 2017 28904385 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1031 OMIA:002127-9913 taurine cattle Red Angus (Cattle) Osteogenesis imperfecta, type II, COL1A1-related COL1A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.36463798G>A NM_001034039.2:c.1063G>A NP_001029211.1:p.(G355S) Petersen et al. (2019): "PolyPhen-2 predicted the mutation to be “probably damaging” with a score of 1.000 (sensitivity 0.00; specificity 1.00). Similarly, PROVEAN prediction classified the variant as “Deleterious” with a score of − 4.615, exceeding both the default (− 2.5) and stringent (− 4.1) thresholds for this classification." The genomic coordinate in the UMD3.1 assembly is g.37094333G>A (Petersen et al., 2019). The coding sequence coordinates are c.1063G>A (ENSBTAT00000017420.4) (Petersen, pers. comm.) rs3423092630 2019 30788588
1289 OMIA:002127-9913 taurine cattle Holstein (black and white) (Cattle) Osteogenesis imperfecta, type II, COL1A1-related COL1A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.36473359T>A NM_001034039.2:c.3917T>A NP_001029211.1:p.(V1306E) NM_001034039.2: c.3917T>A; XP_024835395.1: p.Val1306Glu (Jacinto et al., 2021) rs5334474947 2021 33672767
1698 OMIA:002127-9913 taurine cattle Normande (Cattle) Osteogenesis imperfecta, type II, COL1A1-related COL1A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.36473965G>A NM_001034039.2:c.4234G>A NP_001029211.1:p.(D1412N) 2024 38773368
1837 OMIA:002112-9913 taurine cattle Stabiliser, United Kingdom of Great Britain and Northern Ireland (Cattle) Osteogenesis imperfecta COL1A2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 4 NC_037331.1:g.11792118G > A NM_174520.2:c.1156G > A NP_776945.1:p.(G386R) 2025 40999323
1275 OMIA:001926-9913 taurine cattle Holstein Friesian (Cattle) Bulldog calf COL2A1 deletion, gross (>20) Naturally occurring variant Not currently evaluated ARS-UCD1.2 5 g.32301911_32308589del "Sanger sequencing revealed the precise breakpoints of the heterozygous deletion from position 32 301 911 located in intron 25 to 32 308 589 located within exon 45. The 6679 bp deletion includes the entire sequence of 18 exons (26–44) plus the first 36 nucleotides of exon 45" (Jacinto et al., 2020) 2021 33316082
840 OMIA:001926-9913 taurine cattle Charolais (Cattle) Salers (Cattle) Bulldog calf COL2A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.32301746G>A NM_001001135.3:c.1799G>A NP_001001135.2:p.(G600D) previously listed in OMIA as c.1791G>A, updated to reflect recent transcript inforamtion [03/09/2024] rs5334474917 2017 28904385
1241 OMIA:001926-9913 taurine cattle Holstein Friesian (Cattle) Bulldog calf COL2A1 delins, gross (>20) Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.32303127_32306640delinsTCTGGGGAGC deletion encompassing 10 of the 54 coding exons of COL2A1 2020 32894162
842 OMIA:001926-9913 taurine cattle Holstein Friesian (Cattle) Bulldog calf COL2A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.32303739G>A NM_001001135.3:c.2158G>A NP_001001135.2:p.(G720S) rs455596159 2017 28904385 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
414 OMIA:001926-9913 taurine cattle Danish Holstein (Cattle) bulldog calf COL2A1 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.32305226G>A NM_001001135.3:c.2463+1G>A rs5334475095 2016 27296271 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
223 OMIA:001926-9913 taurine cattle Holstein Friesian (Cattle) Bulldog calf COL2A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.32307658G>A NM_001001135.3:c.2878G>A NP_001001135.2:p.(G960R) rs3423194986 2014 25017103
841 OMIA:001926-9913 taurine cattle Holstein Friesian (Cattle) Bulldog calf COL2A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.32308008G>A NM_001001135.3:c.2986G>A NP_001001135.2:p.(G996S) rs876243579 2017 28904385
1026 OMIA:001926-9913 taurine cattle Holstein Friesian (Cattle) Bulldog calf COL2A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.32308734G>A NM_001001135.3:c.3166G>A NP_001001135.2:p.(G1056S) rs5334475093 2019 30378686
1835 OMIA:001926-9913 taurine cattle Holstein Friesian (Cattle) Achondrogenesis COL2A1 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.32312706_32312717del NM_001001135.3:c.4432_4443del NP_001001135.2:p.(G1478_I1481del) 2025 40999323
1263 OMIA:002295-9913 taurine cattle Holstein (black and white) (Cattle) Ehlers-Danlos syndrome, classic type, 2 COL5A2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.7331916G>T XM_024979774.1:c.2366G>T XP_024835542.1:p.(G789V) XM_024979774.1: c.2366G>T; XP_024835542.1: p.Gly789Val (Jacinto et al., 2020) rs5334475045 2020 33143196
1184 OMIA:002260-9913 taurine cattle Holstein Friesian (Cattle) de novo mutation in an AI sire COL6A3 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 3 NC_037330.1:g.116826597G>A XM_024990262.1:c.5675C>T XP_024846030.1:p.(T1892M) Bourneuf et al. (2017) detected COL6A3 g.117453719G>A; p.T1894M as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Holstein AI bull. No information was provided on the descendants of this bull. p. coordinates have been updated to reflect recent NCBI transcript [29/08/2024]. rs5334475059 2017 28904385
292 OMIA:000341-9913 taurine cattle Rotes Höhenvieh, Germany (Cattle) Vorderwälder, Germany (Cattle) Epidermolysis bullosa, dystrophic COL7A1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.2 22 g.51301158C>T c.4762C>T p.(R1588*) rs876174537 2012 22715415 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed and some variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
215 OMIA:001529-9913 taurine cattle Holstein Friesian (Cattle) Dominant red COPA DR^DR substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 3 NC_037330.1:g.9361962C>T NM_001105645.1:c.478C>T NP_001099115.1:p.(R160C) rs3423151160 2017 28904385 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
358 OMIA:002111-9913 taurine cattle Holstein (red and white) (Cattle) Cataract, recessive, CPAMD8-related CPAMD8 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 7 NC_037334.1:g.6073556C>T XM_015471929.2:c.220C>T XP_015327415.2:p.(Q74*) rs5334474964 2017 28683140
1418 OMIA:002519-9913 taurine cattle Brown Swiss (Cattle) Haplotype with homozygous deficiency BH24 CPT1C BH24 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 18 NC_037345.1:g.56098048G>A XM_002695120.5:c.158G>A XP_002695166.2:p.(G53D) XM_002695120.5 rs719328437 2021 34915862
220 OMIA:002033-9913 taurine cattle A2 milk CSN2 A2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 6 g.85451298T>G c.245A>C p.(H82P) Note that cattle cannot be genotyped for the A2 allele solely on the basis of the c.245A>C variant because this variant is common to 4 other alleles; see Table 2 of Caroli et al. (2009) J. Dairy Sci. 92, 5335-5352 (Matt McClure, pers. comm.) rs43703011 2013 23102962 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1186 OMIA:002262-9913 taurine cattle Montbéliarde (Cattle) de novo mutation in an AI sire CSNK1G2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 7 g.44265842G>C p.(D164H) Bourneuf et al. (2017) detected Chr7 CSNK1G2 g.45885860G>C; p.D164H as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Montbéliarde AI bull. No information was provided on the descendants of this bull. rs5334475073 2017 28904385
287 OMIA:001697-9913 taurine cattle Jersey (Cattle) Abortion due to haplotype JH1 CWC15 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 15 NC_037342.1:g.15449431C>T NM_001046399.2:c.163C>T NP_001039864.1:p.(R55*) UMD3.1 position is g.15707169C>T, cDNA and protein positions based on XM_005215764.2 rs1115118696 2013 23349982 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1251 OMIA:002288-9913 taurine cattle Hereford (Cattle) Mandibulofacial dysostosis CYP26C1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 26 g.14404993T>C c.563T>G p.(L188P) ENSBTAT00000056396.3:c.563T>G; ENSBTAP00000050244.2:p.Leu188Arg rs431913023 2020 33105751
1411 OMIA:002508-9913 taurine cattle Simmental (Cattle) Haplotype with homozygous deficiency SH8 CYP2B6 SH8 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 18 NC_037345.1:g.50296371A>T NM_001075173.1:c.938T>A NP_001068641.1:p.(I313N) NM_001075173.1 rs5352006042 2021 34944310
1624 OMIA:002582-9913 taurine cattle Japanese Black, Japan (Cattle) Hepatic fibrinogen storage disease DGKG substitution missense Genome-editing (CRISPR-Cas9) Not currently evaluated ARS-UCD1.3 1 NC_037328.1:g.81082187C>T XM_002684869.5:c.2162C>T XP_002684915.3:p.T721I XM_002684869.5; XP_002684915.3 2023 37681469
1412 OMIA:002505-9913 taurine cattle Simmental (Cattle) Haplotype with homozygous deficiency SH5 DIS3 SH5 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 12 g.47511687_47511687insT c.2032dup p.(I678Nfs*2) NP_025000110.1, XM_025000110.1 2021 34944310
615 OMIA:002109-9913 taurine cattle Brown Swiss (Cattle) Tricho-dento-osseous-like syndrome DLX3 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 19 g.36665831_36665832insGGAGCACA c.584_585insGGAGCACAGG p.(S198Rfs*99) NM_001081622 position is g.37298375_37298376insGGAGCACA rs5334475096 2017 28670783 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1408 OMIA:002243-9913 taurine cattle Highland (Cattle) Ichthyosis, DSP-related DSP substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 23 NC_037350.1:g.47826600G>T NM_001192368.2:c.6893C>A NP_001179297.1:p.(A2298D) NM_001192368.2; NP_001179297.1 rs5385033307 2022 34996433
711 OMIA:000543-9913 taurine cattle Danish Holstein (Cattle) Anhidrotic ectodermal dysplasia EDA HED6 insertion, gross (>20) frameshift Naturally occurring variant Not currently evaluated X "a LINE1-derived pseudoexon between EDA exons 1 and 2. The 161-bp-long pseudoexon introduces a shift in reading frame and a premature stop codon early in EDA exon 2" 2011 22034998 Allele id was copied from Table 1 of Capuzzello et al. (2022)
645 OMIA:000543-9913 taurine cattle Deutsche Holstein Schwarzbunt, Germany (Cattle) Anhidrotic ectodermal dysplasia EDA HED1 deletion, gross (>20) frameshift Naturally occurring variant Not currently evaluated X c.397_502del p.(M133Vfs*111) a large deletion including exon 3 in the gene for ectodysplasin (ED1; now called EDA) 200922: g. info moved to here (g.85821470) until it can be standardised 2001 11591646 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 Allele id and p. information were copied from Table 1 of Capuzzello et al. (2022)
1120 OMIA:000543-9913 taurine cattle Holstein Friesian (Cattle) Generalized hypohidrotic ectodermal dysplasia EDA HED8 inversion Naturally occurring variant Not currently evaluated ARS-UCD1.2 X g.77174882_80737442inv Escouflaire et al. (2019): The "first breakpoint . . . [is] between positions 82,271,052 and 82,271,053 bp on chromosome X . . . The second breakpoint is situated at position 86,034,441 bp within the EDA intron 1" 2019 31533624 Allele id was copied from Table 1 of Capuzzello et al. (2022).
1293 OMIA:000543-9913 taurine cattle Red Angus-Simmental cross Hypohidrotic ectodermal dysplasia EDA HED9 deletion, gross (>20) Naturally occurring variant Not currently evaluated ARS-UCD1.2 X g.80382423_80435202del GCF_002263795.1 (O'Toole et al., 2021) 2021 33801223 Allele id was copied from Table 1 of Capuzzello et al. (2022).
1484 OMIA:000543-9913 taurine cattle British Blue x Holstein-Friesian cross Anhidrotic ectodermal dysplasia, EDA-related EDA HED10 deletion, gross (>20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 X g.80516615_80538514del c.397_502del p.(M133Vfs*111) NM_001081743.2; NP_001075212.1 2022 36068608 Allele id was copied from Table 1 of Capuzzello et al. (2022).
586 OMIA:000543-9913 taurine cattle Japanese Black, Japan (Cattle) Anhidrotic ectodermal dysplasia EDA HED7 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 X g.80802800_80802801insCCCT c.280_281insAGGG p.(G94Qfs*49) rs5334475024 2012 22497423 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Allele id was copied from Table 1 of Capuzzello et al. (2022).
1665 OMIA:000543-9913 taurine cattle Fleckvieh-Simmental, Germany (Cattle) Hypohidrotic ectodermal dysplasia, X-linked EDA substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 X g.80417567C>T c.679G>A p.(G227R) NM_001081743.2; NP_001075212.1; published as g.85716041G>A in ARS-UCD2.0 rs1114816375 2023 38275590
373 OMIA:000543-9913 taurine cattle Deutsche Holstein Schwarzbunt, Germany (Cattle) Anhidrotic ectodermal dysplasia EDA HED2 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 X NC_037357.1:g.80411671A>C NM_001081743.2:c.924+2T>G c.DNA position is based on NM_001081743.2 rs5334474632 2002 12021844 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Allele id was copied from Table 1 of Capuzzello et al. (2022)
1661 OMIA:000543-9913 taurine cattle Limousin (Cattle) Hypohidrotic ectodermal dysplasia, X-linked EDA HED11 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 X NC_037357.1:g.80411716T>C NM_001081743.2:c.881A>G NP_001075212.1:p.(E294G) NM_001081743.2; NP_001075212.1 rs439722471 2024 38252617
1295 OMIA:000543-9913 taurine cattle Holstein Friesian (Cattle) Anhidrotic ectodermal dysplasia EDA HED5 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 X NC_037357.1:g.80411795C>T NM_001081743.2:c.802G>A "a single nucleotide polymorphism (SNP) G/A at the 9th base of exon 8 [GenBank: AJ278907.1 position 30.549] ... Sequencing of the RT-PCR products revealed that the amplified fragment of the affected animals lacked ... exon 8. At the protein level, the exon skipping leads to a frameshift and consequently to a premature stop codon." (Gargani et al., 2011) 2011 21740563 Allele id and c. information were initially copied from Table 1 of Capuzzello et al. (2022), where this variant was incorreclty listed as g.80411795C>A and c.802C>A. This variant table was corrected on [13/02/2026] based on invaluable feedback from David W. Silversides who noted the error.
1294 OMIA:000543-9913 taurine cattle Red Angus-Charolais-Simmental cross Anhidrotic ectodermal dysplasia EDA HED3 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 X NC_037357.1:g.80415626G>A NM_001081743.2:c.730C>T NP_001075212.1:p.(R244*) rs5334474792 2006 17616058 Reference not in PubMed; see OMIA 000543-9913 for reference details The g. coordinate for the named reference genome assembly, together with the c. coordinate, were kindly provided by Tosso Leeb (22 March 2021). Allele id was copied from Table 1 of Capuzzello et al. (2022).
482 OMIA:000543-9913 taurine cattle Holstein Friesian (Cattle) Anhidrotic ectodermal dysplasia EDA HED4 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 X NC_037357.1:g.80803015_80803033del NM_001081743.2:c.48_66del NP_001075212.1:p.(A16S22fs*55) "a 19-bp deletion at nucleotides c.48_66 in exon 1 ... . This mutation is predicted to generate a truncated 49 aa protein." rs5334474984 2011 21410470 Allele id and p. information were copied from Table 1 of Capuzzello et al. (2022)
843 OMIA:002128-9913 taurine cattle Charolais (Cattle) Anhidrotic ectodermal dysplasia, EDAR-related EDAR insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 11 g.44599876_44599877insC p.(P161Rfs*97) UMD3.1 position is g.44462236_44462237insC 2017 28904385 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1474 OMIA:002560-9913 taurine cattle Lidia, Spain (Cattle) Growth and respiratory lethal syndrome EDN2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 3 g.104701617G>A c.149G>A p.(C50Y) ENSBTAG00000021434; ENSBTAT00000028571.3 2022 35912509
1870 OMIA:003037-9913 taurine cattle Blonde d'Aquitaine (Cattle) Perinatal lethality, EGFR-related EGFR substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.2 22 g.916239C>T XP_002696936:p.(V876*) 2026 41501727
1753 OMIA:002904-9913 taurine cattle Angus (Cattle) Male subfertility, EML5-related EML5 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 10 NC_037337.1:g.100310158G>A NM_001206576.1:c.4960C>T NP_001193505.1:p.(R1654W) rs380547429 2022 35478957
617 OMIA:002540-9913 taurine cattle Japanese Brown, Japan (Cattle) Chondrodysplasia EVC2 delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 6 g.103609778_103609779delinsG c.2327_2328delinsG p.(A776Gfs*22) Published as c.2054_2055delCAinsG, cDNA and protein position in this table based on ENSBTAT00000005613.6 rs5334475076 2002 12136126 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
375 OMIA:002540-9913 taurine cattle Japanese Brown, Japan (Cattle) Chondrodysplasia EVC2 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 6 NC_037333.1:g.103594013C>T NM_173927.1:c.1356C>T Variant creates a cryptic splice donor site in exon 11 which is leading to improper splicing at position c.1355 and resulting in the 56-base RNA deletion between 1355 and 1410. The deletion causes a frameshift and premature termination. rs5334475072 2002 12136126 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
534 OMIA:002540-9913 taurine cattle Tiroler Grauvieh (Cattle) Chondrodysplasia EVC2 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 6 NC_037333.1:g.103651709_103651710del NM_173927.1:c.2993_2994del NP_776352.1:p.(D998Efs*13) rs5334475061 2014 24733244 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. 210909 FN: given that the variant is a 2bp del (AC), g.103651710_103651710del needs to be changed. BLASTing with AGAGGAGCAAGAAGAC from Fig.4 indicates that it is 719 and 710 that are deleted. THus the entry is changed to g.103651709_103651710del; and AC is removed from the c. entry.
346 OMIA:002042-9913 taurine cattle Belgian Blue (Cattle) Abortion (embryonic lethality), EXOSC4 EXOSC4 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 14 NC_037341.1:g.755826G>A NM_001078086.2:c.190G>A NP_001071554.1:p.(R64*) rs3423357300 2016 27646536 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
713 OMIA:000363-9913 taurine cattle Holstein (black and white) (Cattle) Sahiwal (Cattle) Factor XI deficiency F11 insertion, gross (>20) Naturally occurring variant Not currently evaluated 27 a 76-bp insertion in exon 12 of the Factor XI gene 200922: g. and c. info moved here (g.15367048; c.1406ins76) until can be standardised 2004 15566468 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
591 OMIA:000363-9913 taurine cattle Japanese Black, Japan (Cattle) Sahiwal (Cattle) Factor XI deficiency F11 delins, small (<=20) delins (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.2 27 g.16305660delinsATATGTGCAGAATATA c.870delinsATATGTGCAGAATATA P.(F290delinsLYVQNI) rs5334474726 2005 16104386 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1532 OMIA:001818-9913 taurine cattle Japanese Black, Japan (Cattle) Japanese Brown, Japan (Cattle) Factor XIII deficiency F13A1 substitution missense Naturally occurring variant Not currently evaluated UMD_3.1.1 23 g.48649432T>C c.248T>C p.(F83S) NM_001167894.1; NP_001161366.1; reported in Japanese Brown in PMID: 1996 Reference not in PubMed; see OMIA 001818-9913 for reference details Variant was first reported by Ogawa and Iga (1996). Variant information in this table is based on supplementary table 1 by Shibutani et al. (2023).
1038 OMIA:000437-9913 taurine cattle Fleckvieh-Simmental, Germany (Cattle) Haemophilia A F8 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 X NC_037357.1:g.36017426A>T NM_001145508.1:c.134A>T NP_001138980.1:p.(H45L) ENSBTAT00000036726.5:c.134A>T; ENSBTAP00000036581.4:p.His45Leu rs1117392179 2018 29774585
194 OMIA:000437-9913 taurine cattle Japanese Brown, Japan (Cattle) Haemophilia A F8 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 X NC_037357.1:g.36145188T>A NM_001145508.1:c.6458T>A NP_001138980.1:p.(L2153H) rs456129807 2009 19456318 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1360 OMIA:002450-9913 taurine cattle Chianina (Cattle) Ichthyosis congenita FA2H insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 18 g.2205625_2205626insG c.9dupC p.(A4Rfs*142) NM_001192455.1; NP_001179384.1 2021 34599683
1183 OMIA:002259-9913 taurine cattle Montbéliarde (Cattle) de novo mutation in an AI sire FAM189A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 21 g.28112913T>C p.(N192S) Bourneuf et al. (2017) detected FAM189A1 g.28644665T>C; p.N192S as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Montbéliarde AI bull. No information was provided on the descendants of this bull. rs5334475108 2017 28904385
646 OMIA:000151-9913 taurine cattle Holstein (black and white) (Cattle) Brachyspina FANCI deletion, gross (>20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 21 g.20773899_20777226del p.(V877Lfs*27) 2012 22952632 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
377 OMIA:000628-9913 taurine cattle Japanese Black, Japan (Cattle) Marfan syndrome FBN1 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.2 10 g.61917867G>A c.8227-1G>A rs5334475078 2012 22221020 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
201 OMIA:000628-9913 taurine cattle Limousin (Cattle) Marfan syndrome FBN1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 10 NC_037337.1:g.61831200G>A NM_174053.2:c.3598G>A NP_776478.1:p.(E1200K) rs5334475103 2005 15776436 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
910 OMIA:000836-9913 taurine cattle Blonde d'Aquitaine (Cattle) Limousin (Cattle) Protoporphyria FECH substitution extension (stop-lost) Naturally occurring variant Not currently evaluated ARS-UCD1.3 24 NC_037351.1:g.56787697C>A NM_174054.2:c.1250G>T NP_776479.1:p.(*417Lext*27) rs5334474668 1998 9784594 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1529 OMIA:002625-9913 taurine cattle Japanese Black, Japan (Cattle) Skeletal dysplasia, FGD3 related FGD3 delins, small (<=20) missense Naturally occurring variant Not currently evaluated UMD_3.1.1 8 g.85826989_85826990delinsTG p.(H171C) 2015 26306008
1326 OMIA:002374-9913 taurine cattle Holstein Friesian (Cattle) Jersey (Cattle) Charcot Marie Tooth disease FGD4 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.77262490C>T XM_024992559.1:c.1671+1G>A Splice donor mutation based on XM_005206883.3 rs5334475069 2021 34045765
787 OMIA:002090-9913 taurine cattle Holstein (black and white) (Cattle) Facial dysplasia syndrome FGFR2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 26 NC_037353.1:g.41489034C>A NM_001205310.1:c.927G>T NP_001192239.1:p.(W309C) rs5334475009 2017 28768473 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1179 OMIA:001703-9913 taurine cattle Holstein (black and white) (Cattle) Chondrodysplasia, disproportionate FGFR3 substitution extension (stop-lost) Naturally occurring variant Not currently evaluated ARS-UCD1.3 6 NC_037333.1:g.116767863C>A NM_174318.3:c.2408G>T NP_776743.1:p.(*803Lext*93) NM_174318.3: c.2408G>T; [XM_024992994.1: p.(Ter803Leuext*93) rs5334474953 2020 32239744
304 OMIA:001360-9913 taurine cattle Swedish Red and White (Cattle) Trimethylaminuria (fishy taint) FMO3 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 16 NC_037343.1:g.38666821C>T NM_174057.2:c.712C>T NP_776482.1:p.(R238*) rs797790546 2002 12466292 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; rsID gleaned from or confirmed by Table 1 of  Sharma et al. (2017) Animal Genetics 48(3):369-370
1299 OMIA:002318-9913 taurine cattle Montbéliarde (Cattle) coat colour, dilution (milca) FZD7 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.90572569G>C NM_001144091.1:c.1241G>C NP_001137563.1:p.(G414A) CDS position in transcript ENSBTAT00000002946.6 based on ENSEMBL Variant Effect Predictor rs5334475107 2021 33686687
488 OMIA:000419-9913 taurine cattle Shorthorn (Cattle) Glycogen storage disease II GAA E18 deletion, small (<=20) Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.52484973_52484974del NM_173913.2:c.2454_2455del NP_776338.1:p.(T819R) 2000 10723725 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
294 OMIA:000419-9913 taurine cattle Blanco Orejinegro, Colombia (Cattle) Brahman (Cattle) Glycogen storage disease II GAA E13 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.52488949G>A NM_173913.2:c.1783C>T NP_776338.1:p.(R595*) UMD3.1 position is g.53105979C>T; variant initially identified in Brahman cattle and later reported in additional breeds:PMID:34779908. rs5334474904 2000 10723725 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
487 OMIA:000419-9913 taurine cattle Blanco Orejinegro, Colombia (Cattle) Brahman (Cattle) Droughtmaster (Cattle) Glycogen storage disease II GAA E7 deletion, small (<=20) Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.52492405_52492406del NM_173913.2:c.1057_1058del NP_776338.1:p.(Y353L) UMD3.1 position is g.53109436_53109437del; variant initially identified in Brahman cattle and later reported in additional breeds: PMID:28444756, PMID:34779908. 2000 10723725 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1327 OMIA:002375-9913 taurine cattle Holstein Friesian (Cattle) Jersey (Cattle) Congenital disorder of glycosylation GALNT2 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.2 28 g.2281801G>A c.1561-1G>A Splice acceptor mutation based on NM_001193103.1. rs5334474933 2021 34045765
182 OMIA:001826-9913 taurine cattle Holstein (black and white) (Cattle) Abortion due to haplotype HH4 GART substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 1 NC_037328.1:g.1997582A>C NM_001040473.2:c.869A>C NP_001035563.1:p.(N290T) rs465495560 2013 23762392 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1501 OMIA:002559-9913 taurine cattle Holstein Friesian (Cattle) Persistent truncus arteriosus GATA6 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.2 24 g.34187181T>A c.1249A>T p.(K417X) ENSBTAT00000007537.6 2023 36333145
1494 OMIA:002579-9913 taurine cattle Irish Moiled (Cattle) Perinatal mortality syndrome, GCK-related GCK substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.2 4 g.77173487A>T 2022 36105082
293 OMIA:001442-9913 taurine cattle Japanese Black, Japan (Cattle) Forelimb-girdle muscular anomaly GFRA1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 26 NC_037353.1:g.36627244G>A NM_001105411.1:c.430C>T NP_001098881.1:p.(Q144*) rs5334475112 2013 Reference not in PubMed; see OMIA 001442-9913 for reference details Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
302 OMIA:000689-9913 taurine cattle Polled Hereford (Cattle) Myoclonus GLRA1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 7 NC_037334.1:g.63070074G>T NM_174321.2:c.156C>A NP_776746.1:p.(Y52*) rs5334475027 2001 11178872 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1804 OMIA:002958-9913 taurine cattle Aubrac (Cattle) Rhizomelic chondrodysplasia punctata GNPAT substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.2 28 NC_037355.1:g.4039268G>A r.spl 2024 40394457 Reference not in PubMed; see OMIA 002958-9913 for reference details
778 OMIA:001985-9913 taurine cattle Simmental (Cattle) Dwarfism, Fleckvieh GON4L deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 3 NC_037330.1:g.15024247del NM_001192625.1:c.4287del NP_001179554.1:p.(G1430Kfs*66) Previously listed as ARS-UCD1.2: g.15024245del and c.4286del; g. and c. updated to reflect HGVS recommendations  (3' rule) [29/08/2024] rs723240647 2016 27036302 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 210909 
1831 OMIA:003002-9913 taurine cattle Simmental (Cattle) Short stature–auditory depigmentation syndrome GRID1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 28 NC_037355.1:g.40526902G>T XM_024986926.1:c.1466C>A XP_024842694.1:p.(P489H) s719437442 2025 40913728
296 OMIA:002230-9913 taurine cattle Belted Galloway (Cattle) Brown Swiss (Cattle) Hypotrichosis HEPHL1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 29 NC_037356.1:g.721234T>A NM_001192511.2:c.1684A>T NP_001179440.1:p.(K562*) NC_037356.1 (ARS-UCD1.2 assembly, chromosome 29): g.721234A>T; NM_001192511.2 c.1684A>T; NP_001179440.1: p.Lys562* (Kuca et al., 2021); Variant initially identified in Galloway cattle and later reported in additional breeds: PMID:30014197 rs5334475051 2021 33926013
1825 OMIA:001461-9913 taurine cattle Angus (Cattle) Gangliosidosis, GM2 HEXA delins, small (<=20) nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD2.0 10 NC_037337.1:g.19269480_19269481delinsGGAGT NM_001075164.2: c.834_835delinsACTCC) NP_001068632.1:p.(Y278*) 2025 41290211
727 OMIA:000317-9913 taurine cattle Highland (Cattle) Ears, crop HMX1 insertion, gross (>20) Naturally occurring variant Not currently evaluated 6 76bp duplication of 106,720058 to 106,720,133 on BTA6; UMD3 reference assembly 2013 24194898
919 OMIA:001319-9913 taurine cattle Holstein Friesian (Cattle) Myopathy of the diaphragmatic muscles HSPA1A deletion, gross (>20) Naturally occurring variant Not currently evaluated 23 Deletion of one of two HSP70 (heat-shock protein) genes in the bovine major histocompatibility complex 2003 12755819
204 OMIA:001817-9913 taurine cattle Japanese Black, Japan (Cattle) Perinatal weak calf syndrome IARS substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 8 NC_037335.1:g.83909754C>G NM_001101069.2:c.235G>C NP_001094539.1:p.(V79L) rs5334475110 2013 23700453 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1396 OMIA:001823-9913 taurine cattle Holstein Friesian (Cattle) Haplotype with homozygous deficiency-HH2 IFT80 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 1 NC_037328.1:g.107172616del NM_001098959.1:c.1155del NP_001092429.1:p.(L385Ffs*3) published as g.107172616delT, ENSBTAT00000044761.4:c.1140del ENSBTAP00000042227.4:p.Leu381PhefsTer3, c. and p. coordinates updated to NCBI transcripts [29/08/2024] rs523422030 2021 34873723
1202 OMIA:002271-9913 taurine cattle Holstein Friesian (Cattle) Immunodeficiency, IL17Ra-related IL17RA deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.108813252del XM_015460734.2:c.180del XP_015316220.2:p.(C61Afs*62) published as g.108813251delC, g. coordinates in this table updated to reflect HGVS nomenclature (3' rule) [03/09/2024] rs5334474974 2020 32448141
1185 OMIA:002261-9913 taurine cattle Holstein (black and white) (Cattle) de novo mutation in an AI sire ITGA3 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 19 g.36586185G>A p.(T252M) Bourneuf et al. (2017) detected ITGA3 g.37219021G>A; p.T252M as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Holstein AI bull. No information was provided on the descendants of this bull. rs5334475090 2017 28904385
1577 OMIA:002718-9913 taurine cattle Charolais (Cattle) Epidermolysis bullosa, junctional, ITGA6-related ITGA6 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.24112740C>A NM_001109981.1:c.2160+1G>T NP_001103451.1:p.(I657Mfs) NM_001109981.1 2023 37308849
197 OMIA:000595-9913 taurine cattle Blanco Orejinegro, Colombia (Cattle) Holstein Friesian (Cattle) Jersey (Cattle) Simmental (Cattle) Leukocyte adhesion deficiency, type I ITGB2 BLAD substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 1 NC_037328.1:g.144770078T>C NM_175781.1:c.383A>G NP_786975.1:p.(D128G) Variant initially identified in Holstein Friesian cattle and later reported in additional breeds. rs445709131 1992 1384046 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries.
684 OMIA:001948-9913 taurine cattle Charolais (Cattle) Epidermolysis bullosa, junctionalis, ITGB4 ITGB4 deletion, gross (>20) Naturally occurring variant Not currently evaluated 19 "a 4.4 kb deletion involving exons 17 to 22" of the ITGB4 gene 2015 25890340
1716 OMIA:002872-9913 taurine cattle Holstein Friesian (Cattle) Bovine lymphocyte intestinal retention defect ITGB7 BLIRD substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.26807079G>A NP_001098835.1:904G>A NP_001098835.1:p.(G302S) Published as ENSBTAT00000025279.5:p.(G375S) rs444441523 2023 Reference not in PubMed; see OMIA 002872-9913 for reference details
1390 OMIA:002483-9913 taurine cattle Neuromuscular channelopathy KCNG1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 13 NC_037340.1:g.78918850C>A NM_001205719.1:c.1248G>T NP_001192648.1:p.(W416C) NM_001205719.1; NP_001192648.1 rs3423356335 2021 34828398
196 OMIA:001722-9913 taurine cattle Marchigiana (Cattle) Romagnola (Cattle) Lethal multi-organ developmental dysplasia KDM2B substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 17 NC_037344.1:g.53761149G>A XM_005217983.4:c.2503G>A XP_005218040.1:p.(D835N) rs5334475109 2012 23029151 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
207 OMIA:002390-9913 taurine cattle Brown Swiss (Cattle) Original Swiss Brown (Cattle) Spinal muscular atrophy KDSR substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 24 g.61620302C>T c.562G>A p.(A188T) rs5334475102 2007 17420465 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1005 OMIA:000527-9913 taurine cattle Angus (Cattle) Charolais (Cattle) Uckermärker, Germany (Cattle) Progressive ataxia KIF1C substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.26407668C>T NM_001205802.2:c.608G>A NP_001192731.2:p.(R203Q); p.(R203_T204delinsQ*) ENSBTAT00000081136.1:c.608G>A ENSBTAP00000062635.1:p.Arg203Gln Duchesne et al. (2018): "This substitution has two effects: firstly, it modifies a conserved amino acid (p.R203Q). Secondly, it causes an alternative splicing event, resulting in exon 5 skipping in most of the transcripts (p.RT203-204QStop) associated with a drastic reduction of overall mRNA expression and leading to the absence of detectable KIF1C protein in brain extracts from affected cattle." The variant was initially reported in Charolais cattle and later reported in additional breeds (see PMIDs 38338009 and 32281115). rs800926237 2018 30067756
1440 OMIA:001836-9913 taurine cattle Holstein-Friesian, Switzerland (Cattle) Abortion due to haplotype HH13 KIR2DS1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 18 NC_037345.1:g.62758881G>A NM_001097567.1:c.475C>T NP_001091036.1:p.(Q159*) NM_001097567.1; NP_001091036.1 rs437566778 2022 35361830
748 OMIA:000426-9913 taurine cattle Bohuskulla, Sweden (Cattle) Chillingham (Cattle) Fjällnära boskap, Sweden (Cattle) Pohjoissuomenkarja, Finland (Cattle) Svensk Fjällras (Cattle) Svensk kullig boskap (skb), Sweden (Cattle) Väneko, Sweden (Cattle) Gonadal hypoplasia KIT cs(29) complex rearrangement Naturally occurring variant Not currently evaluated 29 "gonadal hypoplasia in Northern Finncattle and Swedish Mountain cattle is associated with a complex chromosomal rearrangement including a ~500kb duplicated segment from BTA6 which is translocated to BTA29. This duplicated segment includes the entire coding sequence of the KIT gene" 2013 24086604 Additional breed information based on Hall et al. (2021) and PMID:40624682
749 OMIA:001576-9913 taurine cattle Belgian Blue (Cattle) Bohuskulla, Sweden (Cattle) Brown Swiss (Cattle) Fjällnära boskap, Sweden (Cattle) Galloway (Cattle) Pohjoissuomenkarja, Finland (Cattle) Svensk Fjällras (Cattle) Svensk kullig boskap (skb), Sweden (Cattle) Väneko, Sweden (Cattle) White Park, United Kingdom of Great Britain and Northern Ireland (Cattle) Coat colour, colour-sided KIT Cs(29) complex rearrangement Naturally occurring variant Not currently evaluated 29 Durkin et al. (2012): "colour sidedness is determined by a first allele on chromosome 29 (Cs(29)), which results from the translocation of a 492-kilobase chromosome 6 segment encompassing KIT to chromosome 29, and a second allele on chromosome 6 (Cs(6)), derived from the first by repatriation of fused 575-kilobase chromosome 6 and 29 sequences to the KIT locus. We provide evidence that both translocation events involved circular intermediates. This is the first example, to our knowledge, of a phenotype determined by homologous yet non-syntenic alleles that result from a novel copy-number-variant-generating mechanism." 2012 22297974 Additional breeds based on PMID:40624682
1133 OMIA:001576-9913 taurine cattle Belgian Blue (Cattle) Bohuskulla, Sweden (Cattle) Brown Swiss (Cattle) Fjällnära boskap, Sweden (Cattle) Svensk Fjällras (Cattle) Svensk kullig boskap (skb), Sweden (Cattle) Coat colour, colour-sided KIT Cs(6) complex rearrangement Naturally occurring variant Not currently evaluated 6 Durkin et al. (2012): "colour sidedness is determined by a first allele on chromosome 29 (Cs(29)), which results from the translocation of a 492-kilobase chromosome 6 segment encompassing KIT to chromosome 29, and a second allele on chromosome 6 (Cs(6)), derived from the first by repatriation of fused 575-kilobase chromosome 6 and 29 sequences to the KIT locus. We provide evidence that both translocation events involved circular intermediates. This is the first example, to our knowledge, of a phenotype determined by homologous yet non-syntenic alleles that result from a novel copy-number-variant-generating mechanism." 2012 22297974 Additional breeds based on PMID:40624682
1116 OMIA:001576-9913 taurine cattle Berrenda en Negro, Spain (Cattle) Cikasto govedo, Slovenia (Cattle) Evolèner, Switzerland (Cattle) Gloucester, United Kingdom of Great Britain and Northern Ireland (Cattle) Herens (Cattle) Pinzgau (Cattle) Tux-Zillertaler, Austria (Cattle) Pinzgauer spotting KIT KIT^PINZ complex rearrangement Naturally occurring variant Not currently evaluated 6 Briefly: the KIT^PINZ variant is "characterized by the fusion of a duplicated chromosome 4 segment into a deleted part of chromosome 6." (Küttel et al., 2019) In more detail: "a complex structural variant characterized by a ~9.4-kb deletion . . . and in silico evidence for a duplication of ~1.5 kb about 34 kb farther downstream . . . . Apparently, the duplicated copy of the ~1.5-kb segment appears inversely inserted at the upstream breakpoint of the ~9.4-kb deletion . . . . Furthermore, we noticed at the upstream breakpoint of the inversely inserted segment chimeric read pairs in which both ends mapped to chromosome 6 and 4 . . . . The inspection of the sequence coverage of the involved genome region on chromosome 4 indicated a ~310-kb duplication from 84 864 544 to ~85 174 000 bp". (Küttel et al., 2019) 2019 31294880
1762 OMIA:001737-9913 taurine cattle Coat colour, colour-headed KIT deletion, gross (>20) Naturally occurring variant Not currently evaluated ARS-UCD1.2 6 The ARS-UCD1.2 reference genome was generated from a white-headed Hereford. Colour-headed cattle have a deletion of 20.6 kb upstream of KIT relative to the ARS-UCD1.2 reference genome. 2024 39694857
1763 OMIA:001737-9913 taurine cattle Hereford (Cattle) Coat colour, white-headed KIT complex rearrangement Naturally occurring variant Not currently evaluated ARS-UCD1.2 6 The ARS-UCD1.2 reference genome was generated from a white-headed Hereford and contains two copies of a segmental duplication upstream of KIT associated with depigmentation in white-headed cattle. The segments miss 1.8 kb and 800 bp of sequence, respectively, relative to the full 14.3 kb sequence observed in Simmental cattle.  2024 39694857
1764 OMIA:001737-9913 taurine cattle Simmental (Cattle) Coat colour, white-headed KIT complex rearrangement Naturally occurring variant Not currently evaluated ARS-UCD1.2 6 The ARS-UCD1.2 reference genome was generated from a white-headed Hereford and contains two copies of a segmental duplication upstream of KIT associated with depigmentation in white-
headed cattle. White-headed Simmental cattle contain three copies of the 14.3 kb segmental duplication. 
2024 39694857
1849 OMIA:001737-9913 taurine cattle Gelbvieh (Cattle) Hereford (Cattle) Holstein Friesian (Cattle) Jersey (Cattle) Maine-Anjou (Cattle) Montbéliarde (Cattle) Normande (Cattle) Red Angus (Cattle) Coat colour, white spotting KIT deletion, gross (>20) regulatory Naturally occurring variant Not currently evaluated ARS-UCD1.2 6 The ARS-UCD1.2 reference genome was generated from a white-headed Hereford and contains two copies of the deletion allele. Animals with ancestrial / solid colour phenotype have an insertion of either 6948-bp (long) or ~6000-bp (intermediate) ~114-kbp upstream of KIT exon 1 (NM_001166484.1) compared the the reference genome. 2025 41237223
1165 OMIA:001737-9913 taurine cattle Brown Swiss (Cattle) Coat colour, white spotting KIT deletion, gross (>20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 6 g.70239551_70239590del c.1390_1429del p.(N464Afs*50) "NC_037333.1:g.70239551_70239590del; NM_001166484.1:c.1390_1429del; NP_001159956.1:p.(Asn464AlafsTer50)" (Häfliger et al., 2020) rs5411005071 2020 32065668
186 OMIA:001216-9913 taurine cattle Belgian Blue (Cattle) Shorthorn (Cattle) Roan KITLG substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:18262908G>T NM_174375.2:c.653C>A NP_776800.1:p.(A218D) rs5366937507 1999 10384045 NM_174375.2; NP_776800.1; published as c.654 variant, p.Ala193Asp. Variant information in this table were originally based on information listed in Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The coordinates were corrected after Cord Drögemüller notified OMIA curators that the previously listed variant was not present in roan cattle [17/11/2022]
777 OMIA:000246-9913 taurine cattle Aberdeen-Angus (Cattle) Ayrshire (Cattle) Montbéliarde (Cattle) Simmental (Cattle) Curly hair, karakul-type KRT27 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.40982250G>C NM_001075815.1:c.276C>G NP_001069283.1:p.(N92K) rs384881761 2014 25017103 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
1265 OMIA:002081-9913 taurine cattle Belgian Blue (Cattle) Epidermolysis bullosa, simplex, KRT5-related` KRT5 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.27367611_27367613del NM_001008663.1:c.534_536del NP_001008663.1:p.(N178del) Publised as '27367604delCAA' coordinates in the table have been updated to reflect HGVS nomenclature (3' rule) [03/09/2024] 2020 33135329
192 OMIA:002081-9913 taurine cattle Friesian cross (Cattle) Jersey cross Epidermolysis bullosa KRT5 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.27371128G>A NM_001008663.1:c.1432G>A NP_001008663.1:p.(E478K) rs5334474982 2005 15955091 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1337 OMIA:002114-9913 taurine cattle Hereford (Cattle) Hypotrichosis, KRT71-related KRT71 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.27331221_27331228del NM_001075970.1:c.281_288del NP_001069438.1:p.(M94Nfs*14) cDNA and protein positions based on NM_001075970.1 and NP_001069438.1, respectively 2021 34356054 210909: FN checked the ARS-UCD1.2 assembly, and discovered that the deletion spans 27331221 to 27331228. Thus g.27331221delTGTGCCCA was changed to g.27331221_27331228del. From NCBI's genome browser, worked out that the c. notation needs to be changed from c.281delTGTGCCCA to c.281_288del.
909 OMIA:001677-9913 taurine cattle Belgian Blue (Cattle) Epidermolysis bullosa, junctionalis, LAMA3-related LAMA3 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.2 24 g.32749369G>A c.7549C>T p.(R2517*) rs5334475046 2015 26370913 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1387 OMIA:002479-9913 taurine cattle Romagnola (Cattle) Hemifacial microsomia LAMB1 HFM substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 4 NC_037331.1:g.49019693G>A NM_001206519.1:c.2002C>T NP_001193448.1:p.(R668C) NM_001206519.1; NP_001193448.1; 2022 34796979
682 OMIA:001678-9913 taurine cattle Hereford (Cattle) Epidermolysis bullosa, junctionalis, LAMC2 LAMC2 deletion, gross (>20) Naturally occurring variant Not currently evaluated 16 "2.4 kb deletion encompassing the first exon of the LAMC2 gene" 2015 25888738
1415 OMIA:002516-9913 taurine cattle Brown Swiss (Cattle) Original Swiss Brown (Cattle) Haplotype with homozygous deficiency OH4 LIG3 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.15080336_15080341del NM_001038107.2:c.2483_2484+4delAGGTG NP_001033196.1:p.K828fs NM_001038107.2 rs5381613636 2021 34915862
1842 OMIA:003023-9913 taurine cattle Brown Swiss (Cattle) Ataxia LIPC ATX substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 10 NC_037337.1:g.51715800G>C NM_001035410.1:c.924C>G NP_001030487.1:p.(F308L) 2026 42007389
627 OMIA:000963-9913 taurine cattle Holstein Friesian (Cattle) Syndactyly (mule foot) LRP4 delins, small (<=20) delins (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.2 15 g.76800972_76800973delinsAT c.4863_4864delinsAT p.(N1621_G1622delinsKC) Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4 2006 16859890
378 OMIA:000963-9913 taurine cattle Angus (Cattle) Syndactyly (mule foot) LRP4 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 15 NC_037342.1:g.76792588C>T NM_001077843.1:c.5385+1G>A "a G to A transition at the first nucleotide in the splice donor site of intron 37" rs5334475003 2006 16963222 Variant information was initially kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4
769 OMIA:000963-9913 taurine cattle Simmental (Cattle) Syndactyly (mule foot) LRP4 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 15 NC_037342.1:g.76807508C>T NM_001077843.1:c.3595G>A NP_001071311.1:p.(G1199S) rs3423411024 2007 17319939 Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4
768 OMIA:000963-9913 taurine cattle Simmental Charolais Cross Syndactyly (mule foot) LRP4 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 15 NC_037342.1:g.76812187C>T NM_001077843.1:c.2719G>A NP_001071311.1:p.(G907R) rs5334474664 2007 17319939 Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4
1844 OMIA:000963-9913 taurine cattle Holstein Friesian (Cattle) Syndactyly (mule foot) LRP4 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 15 NC_037342.1:g.76819481G>A NM_001077843.1:c.1480C>T NP_001071311.1:p.(R494C) rs380401761 2025 40999323
1882 OMIA:000963-9913 taurine cattle Limousin (Cattle) Syndactyly, syndromic LRP4 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 15 NC_037342.1:g.76826546C>A NM_001077843.1:c.170G>T NP_001071311.1:p.(C57F) 2026 41854179
183 OMIA:000185-9913 taurine cattle Japanese Black, Japan (Cattle) Chediak-Higashi syndrome LYST substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 28 NC_037355.1:g.8464077T>C NM_174020.2:c.6044A>G NP_776445.1:p.(H2015R) rs481318527 1999 10594238 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
199 OMIA:000625-9913 taurine cattle Galloway (Cattle) Mannosidosis, alpha MAN2B1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 7 NC_037334.1:g.12840983G>A NM_174561.2:c.662G>A NP_776986.2:p.(R221H) rs5334474945 1997 9208932 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
198 OMIA:000625-9913 taurine cattle Angus (Cattle) Murray Grey (Cattle) Mannosidosis, alpha MAN2B1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 7 NC_037334.1:g.12842292T>C NM_174561.2:c.961T>C NP_776986.2:p.(F321L) rs5334474873 1997 9208932 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
297 OMIA:000626-9913 taurine cattle Salers (Cattle) Mannosidosis, beta MANBA substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 6 NC_037333.1:g.22188765G>A NM_174387.2:c.2574G>A NP_776812.1:p.(W858*) rs5334475094 1999 10594236 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1473 OMIA:002381-9913 taurine cattle Romagnola (Cattle) Skeletal-cardio-enteric dysplasia MAP2K2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 7 NC_037334.1:g.19923991C>T NM_001038071.2:c.535G>A NP_001033160.2:p.(R179W) NM_001038071.2; NP_001033160.2; possible de-novo causal variant 2021 34209498
1416 OMIA:002517-9913 taurine cattle Brown Swiss (Cattle) Original Swiss Brown (Cattle) Haplotype with homozygous deficiency BH6 MARS2 BH6 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.86191230G>A NM_001098971.1:c.1553G>A NP_001092441.1:p.(R518Q) NM_001098971.1 rs434672528 2021 34915862
1509 OMIA:001199-9913 taurine cattle Abondance (Cattle) Brown Swiss (Cattle) Evolèner, Switzerland (Cattle) Herens (Cattle) Holstein Friesian (Cattle) Itäsuomenkarja, Finland (Cattle) Original Swiss Brown (Cattle) Rotes Höhenvieh, Germany (Cattle) Simmental (Cattle) Recessive red MC1R e^v2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 18 NC_037345.1:g.14705638G>A NM_174108.2:c.263G>A NP_776533.1:p.(S88N) NM_174108; NP_776533 rs5412784355 2022 35451516
185 OMIA:001199-9913 taurine cattle Angus (Cattle) Holstein Friesian (Cattle) Icelandic Cattle (Cattle) Dominant black MC1R E^D substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 18 NC_037345.1:g.14705671T>C NM_174108.2:c.296T>C NP_776533.1:p.(L99P) NM_174108; NP_776533 rs109688013 1995 8535072 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1167 OMIA:001544-9913 taurine cattle Rat-tail syndrome MC1R E^D substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 18 NC_037345.1:g.14705671T>C NM_174108.2:c.296T>C NP_776533.1:p.(L99P) rs109688013 2016 27037038
485 OMIA:001199-9913 taurine cattle Angus (Cattle) Fries Roodbont, Netherlands (Cattle) Simmental (Cattle) Recessive red MC1R e deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 18 NC_037345.1:g.14705685del NM_174108.2:c.310del NP_776533.1:p.(G104Vfs*53) NM_174108; NP_776533 rs110710422 1995 8535072 Variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1508 OMIA:001199-9913 taurine cattle Angus (Cattle) Brown Swiss (Cattle) Evolèner, Switzerland (Cattle) Herens (Cattle) Holstein Friesian (Cattle) Limousin (Cattle) Normande (Cattle) Original Swiss Brown (Cattle) Witrood Ras van Belgie, Belgium (Cattle) recessive red MC1R e^v1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 18 NC_037345.1:g.14705799C>T NM_174108.2:c.424C>T NP_776533.1:p.(R142C) NM_174108; NP_776533 rs3423445958 2022 35451516
558 OMIA:002043-9913 taurine cattle Belgian Blue (Cattle) Abortion (embryonic lethality), MED22-related MED22 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated 11 p.(L38Rfs*25) 2016 27646536
374 OMIA:001106-9913 taurine cattle Blanco Orejinegro, Colombia (Cattle) Tiroler Grauvieh (Cattle) Axonopathy MFN2 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 16 NC_037343.1:g.41686003G>A NM_001190270.1:c.2229C>T "This SNP is located within a putative exonic splice enhancer (ESE) and the variant allele leads to partial retention of the entire intron 19 and a premature stop codon in the aberrant MFN2 transcript". Variant initially identified in Tiroler Grauvieh and later reported in additional breeds: PMID:34779908 rs5334475057 2011 21526202 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
644 OMIA:001565-9913 taurine cattle Ayrshire (Cattle) Abortion and stillbirth due to mutation in MIMT1 MIMT1 deletion, gross (>20) Naturally occurring variant Not currently evaluated 18 a 110 kb deletion in the MIMT1 gene 2010 21152099
678 OMIA:001931-9913 taurine cattle Holstein (black and white) (Cattle) Depigmentation associated with microphthalmia MITF deletion, gross (>20) Naturally occurring variant Not currently evaluated 22 a de novo deletion of a 19.1 Mb region of BTA22 from 28 835 247-47 983 179 2014 25199536
837 OMIA:001680-9913 taurine cattle Holstein (black and white) (Cattle) Glass-eyed albino MITF deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.2 22 g.31628127_31628129del p.(R211del) UMD3.1 position g.31746506_31746508del rs5334474965 2017 28904385 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1547 OMIA:001401-9913 taurine cattle Angus (Cattle) White coat colour MITF deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.2 22 g.31628133_31628135del c.668_670del p.(R224del) ENSBTAT00000080989.1; ENSBTAP00000059022.1; published as chr22.g.31628127_31628128del and delR217 - coordinates have been changed to HGVS nomenclature in this table 2023 37062854
189 OMIA:001680-9913 taurine cattle Fleckvieh-Simmental, Germany (Cattle) Dominant white with bilateral deafness MITF substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 22 NC_037349.1:g.31628131C>A NM_001001150.2:c.629G>T NP_001001150.1:p.(R210I) UMD3.1 position is g.31746502 rs5334474903 2011 22174915 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
553 OMIA:000031-9913 taurine cattle Belgian Blue (Cattle) Coat colour, cool gray MLPH deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 3 NC_037330.1:g.116966611_116966620del NM_001081597.1:c.87_96del NP_001075066.1:p.(E32Dfs*1) rs5334474900 2016 26582259 The genomic location on ARS-UCD1.2 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries.
492 OMIA:001819-9913 taurine cattle Brown Swiss (Cattle) Original Swiss Brown (Cattle) Tiroler Grauvieh (Cattle) Xanthinuria, type II MOCOS deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 24 NC_037351.1:g.20911933del XM_024984177.1:c.1881del XP_024839945.1:p.(S628Vfs9*) Published using UMD3.1 position: g.21222030delC; cDNA and protein positions are given transcript: ENSBTAT00000048768. Positions for a second transcript (ENSBTAT00000065375) were given in the paper: c.1782del and p.(S595Vfs9*). Variant was initially described in Tyrolean Grey cattle and later reported in Brown Swiss cattle (PMID: 37675885) rs5334474910 2016 27919260 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
446 OMIA:001819-9913 taurine cattle Japanese Black, Japan (Cattle) Xanthinuria, type II MOCOS deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.3 24 NC_037351.1:g.20936257_20936259del NM_174081.2:c.769_771del NP_776506.1:p.(Y257del) published as c.769_771delTAC 2000 10801779 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
483 OMIA:001541-9913 taurine cattle Simmental (Cattle) Arachnomelia, BTA23 MOCS1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 23 g.13837657_13837658del c.1224_1225del p.(H408Qfs*51) 220110: changed g.13837654_13837655del to g.13837657_13837658del based on HGVS 3'rule. ENSBTAT00000013792.6:c.1224_1225del ENSBTAP00000013792.5:p.His408GlnfsTer51 rs383500843 2011 21255426 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446.
491 OMIA:001452-9913 taurine cattle Belgian Blue (Cattle) Tail, crooked MRC2 deletion, small (<=20) nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.2 19 g.47095176_47095177del c.2904_2905del p.(G934*) rs5334475077 2009 19779552 Breed and some variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) 210908 the entry g.47740473delAG can't be correct because if two bases have been deleted, the g. notation must include the two relevant base positions. FN BLASTED the sequence CCAGACCTGCCGCCCACAG obtained from Fig 3 against UMD3.1.1, and determined that the entry should be g.47740474_47740475del
208 OMIA:001452-9913 taurine cattle Belgian Blue (Cattle) Tail, crooked MRC2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.47089627T>G NM_001192670.1:c.1906T>G NP_001179599.1:p.(C636G) rs466131011 2012 22497452 Breed and some variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1417 OMIA:002518-9913 taurine cattle Brown Swiss (Cattle) Original Swiss Brown (Cattle) Haplotype with homozygous deficiency BH14 MRPL55 BH14 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 7 NC_037334.1:g.2996436C>T NM_001303490.1:c.169C>T NP_001290419.1:p.(R57*) NM_001303490.1 rs461014370 2021 34915862
618 OMIA:000683-9913 taurine cattle Maine-Anjou (Cattle) Muscular hypertrophy (double muscling) MSTN nt419(del7-ins10) delins, small (<=20) nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.2 2 g.6281243_6281249delinsAAGCATACAA c.419_425delinsAAGCATACAA p.(F140*) cDNA and protein positions based on NM_001001525.3 and NP_001001525.1, retrospectively rs5334475091 1998 9501304 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Variant coordinates updated based on Johnsson and Jungnickel (2021)
212 OMIA:000683-9913 taurine cattle Gelbvieh (Cattle) Muscular hypertrophy (double muscling) MSTN substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.6279187T>C NM_001001525.3:c.191T>C NP_001001525.1:p.(L64P) UMD3.1 position is g.6213889T>C rs449270213 2015 25515003 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
771 OMIA:000683-9913 taurine cattle Angus (Cattle) Limousin (Cattle) Muscular hypertrophy (double muscling) MSTN substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.6279278C>A NM_001001525.3:c.282C>A NP_001001525.1:p.(F94L) UMD3.1 position is g.6213980A>C rs110065568 1998 9501304 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
772 OMIA:000683-9913 taurine cattle Parthenais (Cattle) Muscular hypertrophy (double muscling) MSTN substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.6279310C>G NP_001001525.1:c.314C>G NP_001001525.1:p.(S105C) UMD3.1 position is g.6214012C>G rs5334475047 2002 Reference not in PubMed; see OMIA 000683-9913 for reference details Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
773 OMIA:000683-9913 taurine cattle Maine-Anjou (Cattle) Muscular hypertrophy (double muscling) MSTN D182N substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.6281368G>A NM_001001525.3:c.544G>A NP_001001525.1:p.(D182N) rs5334475067 2002 Reference not in PubMed; see OMIA 000683-9913 for reference details The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
299 OMIA:000683-9913 taurine cattle Blonde d'Aquitaine (Cattle) Charolais (Cattle) Limousin (Cattle) Muscular hypertrophy (double muscling) MSTN substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.6281434C>T NM_001001525.3:c.610C>T NP_001001525.1:p.(Q204*) UMD3.1 position is g.6216138C>T rs110344317 1998 9501304 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
300 OMIA:000683-9913 taurine cattle Maine-Anjou (Cattle) Marchigiana (Cattle) Muscular hypertrophy (double muscling) MSTN substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.6281500G>T NM_001001525.3:c.676G>T NP_001001525.1:p.(E226*) UMD3.1 position is g.6216204G>T rs5334474940 1998 9501304 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
489 OMIA:000683-9913 taurine cattle Angus (Cattle) Asturian Valley (Cattle) Belgian Blue (Cattle) Blonde d'Aquitaine (Cattle) Braford (Cattle) Japanese Black, Japan (Cattle) Limousin (Cattle) Murray Grey (Cattle) Parthenais (Cattle) Santa Gertrudis (Cattle) South Devon (Cattle) Muscular hypertrophy (double muscling) MSTN deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.6283674_6283684del NM_001001525.3:c.818_828del NP_001001525.1:p.(D273Rfs*14) UMD3.1 position is g.6218379delATGAACACTCC; c. previously listed as c.821_831del - updated to recent transcript ID and incorrect EVA rs382669990 replaced [29/08/2024]  rs5384554823 1997 9288100 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Protein coordinates updated based on Johnsson and Jungnickel (2021). Additional breeds added based on recent publications: PMID: 40170586.
301 OMIA:000683-9913 taurine cattle Maine-Anjou (Cattle) Marchigiana (Cattle) Muscular hypertrophy (double muscling) MSTN substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.6283727G>T NM_001001525.3:c.871G>T NP_001001525.1:p.(E291*) UMD3.1 position is g.6218432G>T; c.1004G>T updated to c.871G>T [29/08/2024] rs5334475075 2013 22497537 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
203 OMIA:000683-9913 taurine cattle Gascon (Cattle) Parthenais (Cattle) Piedmont (Cattle) Muscular hypertrophy (double muscling) MSTN substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.6283794G>A NM_001001525.3:c.938G>A NP_001001525.1:p.(C313Y) UMD3.1 position is g.6218499G>A rs5334475012 1997 9314496 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
217 OMIA:001978-9913 taurine cattle Holstein Friesian (Cattle) Arthrogryposis, distal, type 1B MYBPC1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.65446598T>G NM_001110773.1:c.884T>G NP_001104243.1:p.(L295R) rs5369172067 2015 26289121 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1500 OMIA:002590-9913 taurine cattle Limousin (Cattle) Cleft palate MYH3 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 19 g.[29609605-29609615del;29609623A>G] c.[2864T>C;2872_2882del] c.[I955T; p.L958Tfs*5] NM_001101835.1 2022 36309651
556 OMIA:002039-9913 taurine cattle Belgian Blue (Cattle) Abortion (embryonic lethality), MYH6-related MYH6 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.2 10 g.21538917_21538919del p.(K1730del) 2016 27646536 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
202 OMIA:001342-9913 taurine cattle Santa Gertrudis (Cattle) Mucopolysaccharidosis IIIB NAGLU substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.42624367G>A NM_001102226.2:c.1354G>A NP_001095696.1:p.(E452K) rs5334475071 2007 17458708 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1469 OMIA:002557-9913 taurine cattle Cikasto govedo, Slovenia (Cattle) Leber optic neuropathy ND4L substitution missense Naturally occurring variant Not currently evaluated M m.10432T>C Novosel et al. (2022): "two “mutant” Cika cattle animals (GenBank acc. Nos. MZ901663 and MZ MZ901663)" 2019 Reference not in PubMed; see OMIA 002557-9913 for reference details
766 OMIA:002103-9913 taurine cattle Angus (Cattle) Developmental duplications NHLRC2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 26 NC_037353.1:g.34340886T>C NM_001083723.2:c.932T>C NP_001077192.1:p.(V311A) rs5334474969 2014 Reference not in PubMed; see OMIA 002103-9913 for reference details Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
679 OMIA:001936-9913 taurine cattle Romagnola (Cattle) Cataract, recessive, Romagnola NID1 deletion, gross (>20) Naturally occurring variant Not currently evaluated 28 "an 855 bp deletion across the exon 19/intron 19 border of the bovine nidogen 1 (NID1) gene (c.3579_3604+829del)" 2014 25347398
1718 OMIA:002874-9913 taurine cattle Montbéliarde (Cattle) Haplotype with homozygous deficiency, NOA1-related NOA1A insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 6 NC_037333.1:g.72359797_72359798insG NM_001038188.2:c.1086_1087insC NP_001033277.1:(p.D363Rfs*9) Published as ENSBTAT00000071135.1:p.D400RfsX9 rs5411279036 2023 39343954 Reference not in PubMed; see OMIA 002874-9913 for reference details
1244 OMIA:000725-9913 taurine cattle Angus (Cattle) Niemann-Pick type C1 NPC1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 24 NC_037351.1:g.33099467C>G NM_174758.2:c.2969C>G NP_777183.1:p.(P990R) NM_174758.2:c.2969C>G rs482882512 2020 32970694
1410 OMIA:002509-9913 taurine cattle Simmental (Cattle) Haplotype with homozygous deficiency SH9 NUBPL SH9 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 21 NC_037348.1:g.42154344C>A NM_001193042.1:c.428C>A NP_001179971.1:p.(S143Y) NM_001193042.1 rs5335823597 2021 34944310
1468 OMIA:002556-9913 taurine cattle Chianina (Cattle) Double-outlet right ventricle NUMB substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 10 NC_037337.1:g.84751870G>A NM_001101951.1:c.416C>T NP_001095421.1:p.(T139M) NM_001101951.1; NP_001095421.1 2022 35748177
555 OMIA:002035-9913 taurine cattle Jersey (Cattle) Abortion (embryonic lethality), OBFC1-related OBFC1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 26 g.24461804_24461805del c.379_380del p.(K127Vfs*29) rs455647476 2016 27646536 220110: Changed from g.24461803_24461804del to g.24461804_24461805del to adhere to HGVS 3'rule ENSBTAT00000019995.6:c.379_380del ENSBTAP00000019995.5:p.Lys127ValfsTer29 210909: FN changed c.379_380delAA to c.379_380del. He also added the ref sequence, based on the words in the text "Sequence reads were aligned to the bosTau6 reference genome". FN also checked the g. location against Suppl Material S2, which lists the location as 24720154. However, a search of the UMD assembly confirms that the AA del is actually as given, i.e. g.24720155_24720156del
288 OMIA:000162-9913 taurine cattle Holstein Friesian (Cattle) Red Holstein, Switzerland (Cattle) Simmental (Cattle) Swiss Fleckvieh (Cattle) Cardiomyopathy, dilated OPA3 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 18 NC_037345.1:g.53152213G>A NM_001245934.1:c.343C>T NP_001232863.1:p.(Q115*) UMD3.1 position is g.53546443C>T; cDNA position based on ENSBTAT00000064088.2 rs479222100 2011 20923700 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Additional breeds based on PMID:40312951
428 OMIA:001437-9913 taurine cattle Brown Swiss (Cattle) Beta-lactoglobulin, aberrant low expression PAEP substitution regulatory Naturally occurring variant Not currently evaluated ARS-UCD1.2 11 g.103255964C>A c.-215C>A "C to A transversion at position 215 bp upstream of the translation initiation site" rs5334475105 2006 17033029 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
1443 OMIA:002548-9913 taurine cattle Holstein Friesian (Cattle) Deficiency of haplotype HH35 PCDH15 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 26 NC_037353.1:g.5325675C>G XM_059881970.1:c.2599C>G XP_059737953.1:p.(L867V) XM_015460562.2; XP_015316048.2 rs469553146 2022 35361830
1841 OMIA:003012-9913 taurine cattle Holstein Friesian (Cattle) Dwarfism, primordial disproportionate and craniofacial dysmorphism PDGFRA substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 6 NC_037333.1:g.69749162T>C NM_001192345.2:c.1685T>C NP_001179274.1:p.(I562T) 2025 40999323
820 OMIA:001827-9913 taurine cattle Montbéliarde (Cattle) Vorderwälder, Germany (Cattle) Abortion due to haplotype MH1 PFAS substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.27895397C>T NM_001256564.1:c.3613C>T NP_001243493.1:p.(R1205C) rs455876205 2017 28803020 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
406 OMIA:001953-9913 taurine cattle Belgian Blue (Cattle) Arthrogryposis, lethal syndrome PIGH substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 10 NC_037337.1:g.79469727G>C NM_001038116.2:c.211-10C>G rs451004237 2015 25895751 Variant information gleaned from or confirmed by Table 1 of  Sharma et al. (2017) Animal Genetics 48(3):369-370
339 OMIA:001935-9913 taurine cattle Simmental (Cattle) Zinc deficiency-like syndrome PLD4 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.2 21 g.69352995G>A c.702G>A p.(W234*) UMD3.1 position is g.71001232G>A rs378824791 2014 25052073 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; rsID gleaned from or confirmed by Table 1 of  Sharma et al. (2017) Animal Genetics 48(3):369-370. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1493 OMIA:002578-9913 taurine cattle Holstein (black and white) (Cattle) Mast cell tumour, congenital PLP2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 X NC_037357.1:g.87216480C>T NM_203363.1:c.50C>T NP_976239.1:p.(T17I) NM_203363.1; XP_005642144.1 2022 36139188
1166 OMIA:001544-9913 taurine cattle Rat-tail syndrome PMEL deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.2 5 g.57345302_57345304del c.50_52del p.(L19del) rs385468954 2016 27037038
484 OMIA:001545-9913 taurine cattle Charolais (Cattle) Galloway (Cattle) Hereford (Cattle) Highland (Cattle) Japanese Brown, Japan (Cattle) Simmental (Cattle) Coat colour, dilution PMEL deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 g.57345303_57345305del NM_001080215.2:c.53_55del NP_001073684.2:p.(L19del) Published as 'three-base (CTT) deletion at nucleotide 54 in exon 1 of the PMel17 gene'; previously listed in OMIA as ARS-UCD1.2:g.57345302_57345304del, c.50_52del, p.(L19del) based on the inforamtion provided by "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170); updated to reflect HGVS recommendation (3'-rule) on [03/09/2024] rs385468954 2008 18408794
774 OMIA:001545-9913 taurine cattle Charolais (Cattle) Coat colour, dilution PMEL substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.57345315G>A NM_001080215.2:c.64G>A NP_001073684.2:p.(G22R) rs718553050 2007 17705851 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
765 OMIA:000827-9913 taurine cattle Brown Swiss (Cattle) Carora, Venezuela (Bolivarian Republic of) (Cattle) Progressive degenerative myeloencephalopathy (Weaver syndrome) PNPLA8 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 4 NC_037331.1:g.49600585C>T XM_005205444.4:c.1703G>A XP_005205501.2:p.(S568N) rs800397662 2016 26992691 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1070 OMIA:000483-9913 taurine cattle Nelore (Cattle) Polled, Guarani POLLED P[sub]G duplication Naturally occurring variant Not currently evaluated ARS-UCD1.2 1 g.2614828_2724315dup "a novel duplication variant" in the region BTA1:1,893,790–2,004,553 (Utsunomiya et al., (2019) 2019 30644114 Randhawa et al. (2019): ARS-UCD1.2 g.2614828_2724315dup
867 OMIA:000483-9913 taurine cattle Holstein (black and white) (Cattle) Polled, Friesian POLLED P[sub]F OR P(sub)80kbID duplication Naturally occurring variant Not currently evaluated ARS-UCD1.2 1 g.2629113_2709240dup 2013 23717440 In relation to assembly UMD v3.1.1, Utsunomiya et al. (2019) described this variant as "a duplication of CHR1:1,909,352–1,989,480". Randhawa et al. (2019): ARS-UCD1.2 g.2629113_2709240dup
866 OMIA:000483-9913 taurine cattle Brahman (Cattle) Polled, Celtic POLLED P[sub]C OR P[sub]202ID complex rearrangement Naturally occurring variant Not currently evaluated ARS-UCD1.2 1 g.[2429327_2429336del;2429109_2429320dupins] UMD3.1: g.1706051_1706060 delins170583 2012 22737241 Coordinates in OMIA were previously shown based on Randhawa et al. (2019) as ARS-UCD1.2 g.[22429326_2429335del;2429109_2429320dupins]. After review of the original publication the coordinates have been corrected in OMIA to g.[2429327_2429336del;2429109_2429320dupins] [18/9/2022]
844 OMIA:000483-9913 taurine cattle Kazakh (Cattle) Polled, Mongolian POLLED P[sub]M OR P[sub]219ID complex rearrangement Naturally occurring variant Not currently evaluated ARS-UCD1.2 1 g.[2695261_2695267delinsTCTGAA;2695889_2696047dupins] "a complex 219-bp duplication-insertion (P219ID) beginning at 1,976,128 bp and a 7-bp deletion and 6-bp insertion (P1ID) located 621 bp upstream of this position . . . . This rearrangement results in duplication of an 11-bp motif (5'-AAAGAAGCAAA-3') that is entirely conserved among Bovidae . . . and that is also duplicated in the 80-kb duplication responsible for Friesian polledness" In relation to assembly UMD v3.1.1, Utsunomiya et al. (2019) described this variant as "a complex duplication starting at CHR1:1,976,128". 2017 28135247 Randhawa et al. (2019): ARS-UCD1.2 g.[2695261_2695267delinsTCTGAA;2695889_2696047dupins]
588 OMIA:000161-9913 taurine cattle Polled Hereford (Cattle) Cardiomyopathy and woolly haircoat syndrome PPP1R13L duplication frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 18 g.53013747_53013753dup c.956-962dupACAGGCG p.(G335Efs*36) 2009 19016676 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1840 OMIA:003013-9913 taurine cattle Angus (Cattle) Dwarfism, primordial disproportionate PRDM10 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 29 NC_037356.1:g.36138136G>A NM_001191168.1:c.866C>T NP_001178097.1:p.(P289L) 2025 40999323
291 OMIA:001485-9913 taurine cattle Angus (Cattle) Dwarfism, Angus PRKG2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.2 6 g.95896205G>A c.1573C>T p.(R525*) rs109639251 2009 19887637 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
352 OMIA:001485-9913 taurine cattle Angus (Cattle) Dwarfism, Angus PRKG2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 6 NC_037333.1:g.95896205G>A NM_001144099.1:c.2032C>T NP_001137571.1:p.(R678*) ENSBTAT00000003877.4:c.2032C>T ENSBTAP00000003877.4:p.Arg678Ter rs109639251 2009 19887637 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
216 OMIA:000441-9913 taurine cattle Holstein Friesian (Cattle) Jersey (Cattle) Simmental (Cattle) Hairy PRL substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 23 NC_037350.1:g.35332871A>C NM_173953.2:c.661A>C NP_776378.2:p.(C221G) ENSBTAT00000020313.4:c.661T>G ENSBTAP00000020313.3:p.Cys221Gly rs520582588 2014 25519203 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1447 OMIA:001372-9913 taurine cattle Criollo Lechero Tropical, Mexico (Cattle) Slick hair PRLR SLICK4 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 20 NC_037347.1:g.39099113C>G NM_001039726.2:c.1281C>G NP_001034815.1:p.(Y427*) 2021 33259090
544 OMIA:001372-9913 taurine cattle Blanco Orejinegro, Colombia (Cattle) Carora, Venezuela (Bolivarian Republic of) (Cattle) Chino Santandereano, Colombia (Cattle) Costeno con Cuernos (Cattle) Criollo Caqueteño, Colombia (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) Romosinuano, Venezuela (Bolivarian Republic of) (Cattle) Senepol (Cattle) Tropicarne, Mexico (Cattle) Slick hair PRLR SLICK1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 20 NC_037347.1:g.39099214del NM_001039726.2:c.1382del NP_001034815.1:p.(A461Vfs*2) rs517047387 2014 25519203 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; some variant information gleaned from or confirmed by Table 1 of Sharma et al. (2017) Animal Genetics 48(3):369-370, breed infromation updated based on PMID:39377537
974 OMIA:001372-9913 taurine cattle Criollo Lechero Tropical, Mexico (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) Slick hair PRLR SLICK3 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 20 NC_037347.1:g.39099226C>A NM_001039726.2:c.1394C>A NP_001034815.1:p.(S465*) rs5334474999 2018 29527221 Breed infromation updated based on PMID:39377537
1448 OMIA:001372-9913 taurine cattle Blanco Orejinegro, Colombia (Cattle) Carora, Venezuela (Bolivarian Republic of) (Cattle) Chino Santandereano, Colombia (Cattle) Costeno con Cuernos (Cattle) Criollo Caqueteño, Colombia (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) Romosinuano, Venezuela (Bolivarian Republic of) (Cattle) Slick hair PRLR SLICK5 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 20 NC_037347.1:g.39099228A>T NM_001039726.2:c.1396A>T NP_001034815.1:p.(K466*) 2021 33259090 Breed infromation updated based on PMID:39377537
1449 OMIA:001372-9913 taurine cattle Carora, Venezuela (Bolivarian Republic of) (Cattle) Costeno con Cuernos (Cattle) Criollo Caqueteño, Colombia (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) Romosinuano, Venezuela (Bolivarian Republic of) (Cattle) Senepol (Cattle) Tropicarne, Mexico (Cattle) Slick hair PRLR SLICK6 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 20 NC_037347.1:g.39099267C>T NM_001039726.2:c.1435C>T NP_001034815.1:p.(Q479*) 2021 33259090 Breed infromation updated based on PMID:39377537
975 OMIA:001372-9913 taurine cattle Baoulé (Cattle) Caracu, Brazil (Cattle) Carora, Venezuela (Bolivarian Republic of) (Cattle) Casanareño, Colombia (Cattle) Chino Santandereano, Colombia (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) Romosinuano, Venezuela (Bolivarian Republic of) (Cattle) West African Zebu (Cattle) Slick hair PRLR SLICK2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 20 NC_037347.1:g.39099321C>T NM_001039726.2:c.1489C>T NP_001034815.1:p.(R497*) rs5334474702 2018 29527221 Breed infromation updated based on PMID:39377537 and PMID:39710878
1688 OMIA:001139-9913 taurine cattle Red Angus (Cattle) Glycogen storage disease V PYGM substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 29 NC_037356.1:g.42989581G>A NM_175786.2 c.1948C>T NP_786980.1:p.(R650*) published as c.2257C>T in ARS-UCD1.2 2024 38678201
193 OMIA:001139-9913 taurine cattle Charolais (Cattle) Glycogen storage disease V PYGM substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 29 NC_037356.1:g.42991370G>A NM_175786.2:c.1468C>T NP_786980.1:p.(R490W) rs5334475023 1996 8845714 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
1689 OMIA:002848-9913 taurine cattle Brown Swiss (Cattle) Spermatogenic failure, QRICH2-related QRICH2 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.55436710del XM_002696205.5:c.4929del XP_002696251.3:C1644Afs*52 Coordinates in this table consider 3' rule of HGVS recommendation 2022 35255804
221 OMIA:002037-9913 taurine cattle Holstein Friesian (Cattle) Abortion (embryonic lethality), RABGGTB RABGGTB substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 3 NC_037330.1:g.69060748T>C NM_001015646.1:c.584A>G NP_001015646.1:p.(Y195C) ENSBTAT00000024551.6:c.584A>G ENSBTAP00000024551.6:p.Tyr195Cys rs1118263722 2016 27646536 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
209 OMIA:002433-9913 taurine cattle Holstein Friesian (Cattle) Simmental (Cattle) Swiss Fleckvieh (Cattle) Thrombopathia RASGRP2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 29 NC_037356.1:g.42978791A>G NM_001099946.1:c.701T>C NP_001093416.1:p.(L234P) Additional breeds based on PMID:40312951 rs385444696 2007 18039909 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1717 OMIA:002873-9913 taurine cattle Normande (Cattle) Haplotype with homozygous deficiency, RFC5-related RFC5 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.3 17 NC_037344.1:g.57188407_57188409del NM_001075358.1:c.573_575del NP_001068826.1:p.(E192del)  Published as ENSBTAT00000085991.1:p.E369del rs5366807285 2023 Reference not in PubMed; see OMIA 002873-9913 for reference details
1442 OMIA:002547-9913 taurine cattle Holstein-Friesian, Switzerland (Cattle) Haplotype HH25 deficiency RIOX1 deletion, gross (>20) deletion (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.2 10 g.84938408_84938437del c.396_425del p.(A133_E142del) NM_001099702.1; NP_001093172.1; published as c.396_425delGGCGCAGACCCCGGCGGCACGCTTGGTGGA 2022 35361830
676 OMIA:001901-9913 taurine cattle Nordic Red (Cattle) Abortion due to deletion of RNASEH2B RNASEH2B deletion, gross (>20) Naturally occurring variant Not currently evaluated ARS-UCD1.2 12 g.20007546_20691454del A 662kb deletion encompases the gene RNASEH2B, lack of which creates embryonic lethality. 2014 24391517 Genomic position gained from Mesbah-Uddin et al. (2021) - structural variant id esv4015629 (Database of Genomic Variants archive extracted from Ensembl release 94 - http://ftp.ensembl.org/pub/release-94/).
376 OMIA:001686-9913 taurine cattle Belgian Blue (Cattle) Dwarfism, proportionate, with inflammatory lesions RNF11 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 3 NC_037330.1:g.95015373T>C NM_001077953.1:c.124-2A>G NM_001077953.1 rs3423159409 2012 22438830 Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
344 OMIA:002038-9913 taurine cattle Holstein Friesian (Cattle) Abortion (embryonic lethality), RNF20 RNF20 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 8 NC_037335.1:g.91297797A>T NM_001081587.1:c.2077A>T NP_001075056.1:p.(K693*) rs5334474936 2016 27646536 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
611 OMIA:002029-9913 taurine cattle Angus (Cattle) Belgian Blue (Cattle) Charolais (Cattle) Gelbvieh (Cattle) Holstein Friesian (Cattle) Maine-Anjou (Cattle) Normande (Cattle) Red Angus (Cattle) Simmental (Cattle) Swiss Fleckvieh (Cattle) Retinitis pigmentosa 1 RP1 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 14 g.22340665_22340666insA p.(R791Kfs*13) 2016 27510606 Additional breeds based on PMID:40312951
858 OMIA:002134-9913 taurine cattle Ayrshire (Cattle) Abortion due to haplotype AH2 RPAP2 substitution splicing Naturally occurring variant Not currently evaluated 3 a splice acceptor variant at 51,267,548 bp [reference sequence not specified] in RPAP2 2017 Reference not in PubMed; see OMIA 002134-9913 for reference details
416 OMIA:002041-9913 taurine cattle Belgian Blue (Cattle) Abortion (embryonic lethality), RPIA-related RPIA substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 11 NC_037338.1:g.47355110C>T NM_001035433.2:c.826+1G>A rs5334475111 2016 27646536 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1269 OMIA:002297-9913 taurine cattle Holstein Friesian (Cattle) Tetradysmelia RSPO2 delins, gross (>20) Naturally occurring variant Not currently evaluated ARS-UCD1.2 14 g.56451029_56501201delinsTGACAA a 50-kb deletion spanning three exons of the R-spondin 2 (RSPO2) gene 2020 33176673
990 OMIA:002149-9913 taurine cattle Holstein (black and white) (Cattle) Abortion due to haplotype HH6 SDE2 substitution start-lost Naturally occurring variant Not currently evaluated ARS-UCD1.3 16 NC_037343.1:g.29020700A>G NM_001099065.2:c.2T>C NP_001092535.1:p.(M1?) ENSBTAT00000016992.6:c.2T>C ENSBTAP00000016992.5:p.Met1? "This A-to-G transition changes the initiator ATG (methionine) codon to ACG because the gene is transcribed on the reverse strand. . . . Initiation of translation at the closest in-frame Met codon would truncate SDE2 by 83 amino acids, including an 8-amino acid motif conserved among eukaryotes" rs434666183 2018 29680649
222 OMIA:002444-9913 taurine cattle Japanese Black, Japan (Cattle) Hydrallantois SLC12A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 10 g.62157819G>A p.(P372L) rs5334475056 2016 27613513
1853 OMIA:003026-9913 taurine cattle Limousin (Cattle) Porencephaly SLC25A12 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.24733509G>A NM_001101194.2:c.1742G>A NP_001094664.1:p.(R581Q) 2026 42252407
992 OMIA:002150-9913 taurine cattle Rouge des prés, France (Cattle) Syndrome des veaux tourneurs (Turning calves syndrome) SLC25A46 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 7 g.109742796C>T c.376C>T p.(R126C) rs5334475040 2017 28376083
626 OMIA:000366-9913 taurine cattle Brown Swiss (Cattle) Holstein Friesian (Cattle) Original Swiss Brown (Cattle) Simmental (Cattle) Swiss Fleckvieh (Cattle) Fanconi syndrome SLC2A2 delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 1 NC_037328.1:g.96472797_96472804delinsCATC NM_001103222.1:c.772_779delinsCATC NP_001096692.1:p.(L258fs*16) Previously listed as c.771_778delinsCATC, updated to NCBI transcript [29/08/2024] 2016 27169150 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 210909: FN changed c.771_778delTTGAAAAGinsCATC to c.771_778delinsCATC. Also, since the del is of 8 bp, the g. designation has been changed from g.97239973_97239976delTTGAAAAG (which encompasses a deletion of only 4bp) to g.97239973_97239980delinsCATC. Additional breed inforamtion based on PMID: 40312951
187 OMIA:001340-9913 taurine cattle Holstein Friesian (Cattle) Complex vertebral malformation SLC35A3 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 3 NC_037330.1:g.43261945C>A NM_001105386.1:c.538G>T NP_001098856.1:p.(V180F) rs438228855 2006 16344554 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1181 OMIA:001340-9913 taurine cattle Montbéliarde (Cattle) de novo mutation in an AI sire SLC35A3 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 3 NC_037330.1:g.43268369G>T NM_001105386.1:c.73C>A NP_001098856.1:p.(R25S) This variant was detected by Bourneuf et al. (2017) as a de novo mutation from an analysis of whole-genome-sequence of an AI Montbéliarde bull. No information was provided on the descendants of this bull. rs5334475074 2017 28904385
263 OMIA:001828-9913 taurine cattle Montbéliarde (Cattle) Vorderwälder, Germany (Cattle) Abortion due to haplotype MH2 SLC37A2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 29 NC_037356.1:g.28510651C>T NM_001024486.1:c.34C>T NP_001019657.1:p.(R12*) rs5358558602 2013 23762392 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
372 OMIA:000593-9913 taurine cattle Holstein Friesian (Cattle) Acrodermatitis enteropathica SLC39A4 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD2 14 NC_037341.1:g.537517G>A NM_001046067.1:c.1645+1G>A "a single nucleotide mutation of the splice donor site in intron 10" rs5334475080 2006 16714095
1839 OMIA:003020-9913 taurine cattle Holstein Friesian (Cattle) Caudal and thoracic vertebral and viscerocranial malformation SLC40A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.6785954T>A NM_001077970.1:c.323T>A NP_001071438.1:p.(I108N) 2025 40999323
847 OMIA:001821-9913 taurine cattle Brown Swiss (Cattle) Coat colour, albinism, oculocutaneous type IV SLC45A2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 20 g.39790069G>A c.134G>A p.(R45Q) Important note by Rothammer et al. (2017): "To determine which of the two mutations or even if the combination of both is causal for oculocutaneous albinism in Braunvieh, it would be necessary to produce additional cases and investigate them more precisely" rs5334474931 2017 28982372 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
848 OMIA:001821-9913 taurine cattle Brown Swiss (Cattle) Coat colour, albinism, oculocutaneous type IV SLC45A2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 20 g.39824417C>T c.1331C>T p.(T444I) Important note by Rothammer et al. 92017): "To determine which of the two mutations or even if the combination of both is causal for oculocutaneous albinism in Braunvieh, it would be necessary to produce additional cases and investigate them more precisely" rs5334474883 2017 28982372 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1846 OMIA:001821-9913 taurine cattle Dexter (Cattle) Coat colour, dilution (chocolate / cream) SLC45A2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 20 NC_037347.1: g.39790189A>C XM_002696386.6: c.398A>C XP_002696432.2: p.(Q133P) 2025 41101985
303 OMIA:001228-9913 taurine cattle Japanese Black, Japan (Cattle) Spherocytosis SLC4A1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.44069903G>A NM_181036.2:c.1990C>T NP_851379.1:p.(R664*) rs5334475039 1996 8621763 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
647 OMIA:002443-9913 taurine cattle Angus (Cattle) Hereford (Cattle) Holstein (black and white) (Cattle) Simmental (Cattle) Osteopetrosis SLC4A2 deletion, gross (>20) Naturally occurring variant Not currently evaluated ARS-UCD1.2 4 g.113638011_113640784del "approximately 2.8-kb deletion mutation in affected calves that encompasses exon 2 and nearly half of exon 3" 2010 20507629 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
904 OMIA:001451-9913 taurine cattle Belgian Blue (Cattle) Congenital muscular dystonia 2 SLC6A5 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 29 g.24366560A>G c.809T>C p.(L270P) rs3423560860 2008 18344998 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
211 OMIA:001824-9913 taurine cattle Holstein (black and white) (Cattle) Abortion due to haplotype HH3 SMC2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 8 NC_037335.1:g.93753358T>C XM_015472668.2:c.3404T>C XP_015328154.1:p.(F1135S) XM_015472668.2; XP_015328154.1 rs456206907 2014 24667746 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
557 OMIA:002040-9913 taurine cattle Belgian Blue (Cattle) Abortion (embryonic lethality), SNAPC4-related SNAPC4 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated 11 p.(L1227Afs*134) 2016 27646536
1182 OMIA:002258-9913 taurine cattle Charolais (Cattle) Lethality, SOWAHB-related SOWAHB substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 6 g.91735816G>T p.(Q379K) This variant was detected by Bourneuf et al. (2017) as a de novo mutation from an analysis of whole-genome-sequence of a Charolais AI bull. No information was provided on the descendants of this bull. rs5334475088 2017 28904385
206 OMIA:001247-9913 taurine cattle Brown Swiss (Cattle) Original Swiss Brown (Cattle) Spinal dysmyelination SPAST substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 11 g.14742184G>A c.1964G>A p.(R560Q) rs445770480 2010 19714378 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
920 OMIA:001230-9913 taurine cattle Holstein Friesian (Cattle) Japanese Black, Japan (Cattle) Jersey (Cattle) Ovotesticular DSD (Disorder of Sexual Development) SRY deletion, gross (>20) Naturally occurring variant Not currently evaluated Y A deletion of the SRY gene 1996 8978769
214 OMIA:001960-9913 taurine cattle Simmental (Cattle) Abortion due to haplotype FH4 SUGT1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 12 NC_037339.1:g.11102143A>G NM_001046203.2:c.949T>C NP_001039668.1:p.(W317R) rs110793536 2015 25927203 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
587 OMIA:000059-9913 taurine cattle Brown Swiss (Cattle) Arachnomelia, BTA5 SUOX insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 5 g.57316723_57316724insG c.363_364insG p.(A124Gfs*42) rs5334475086 2010 20865119 Variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
213 OMIA:001951-9913 taurine cattle Holstein (black and white) (Cattle) Vertebral and spinal dysplasia TBXT substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 9 NC_037336.1:g.101160274T>C NM_001192985.1:c.196A>G NP_001179914.1:p.(K66E) rs5334475020 2015 25614605 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
963 OMIA:001941-9913 taurine cattle Holstein (black and white) (Cattle) Abortion due to haplotype HH5 TFB1M complex rearrangement Naturally occurring variant Not currently evaluated 9 "a deletion of 138kbp, spanning position 93,233kb to 93,371kb on chromosome 9 (BTA9), harboring only dimethyl-adenosine transferase 1 (TFB1M). The deletion breakpoints are flanked by bovine long interspersed nuclear elements Bov-B (upstream) and L1ME3 (downstream), suggesting a homologous recombination/deletion event." 2016 27128314
295 OMIA:000424-9913 taurine cattle Africander (Cattle) Goitre, familial TG substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 14 NC_037341.1:g.8432343G>A XM_025001401.1:c.1963C>T XP_024857169.1:p.(R655*) rs480120030 1987 3472203 Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool
779 OMIA:001902-9913 taurine cattle Simmental (Cattle) Male subfertility TMEM95 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.2 19 g.27056843C>A c.483C>A p.(C161*) rs378652941 2014 24391514 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
410 OMIA:000542-9913 taurine cattle Pezzata Rossa Italiana, Italy (Cattle) Hypotrichosis, streaked TSR2 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.2 X g.91964644A>G c.441+226A>G rs5334475030 2015 26203908 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
345 OMIA:002036-9913 taurine cattle Holstein Friesian (Cattle) Abortion (embryonic lethality), TTF1 TTF1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 11 NC_037338.1:g.102463944G>A NM_001102083.1:c.1579G>A NP_001095553.1:p.(R527*) rs715966442 2016 27646536 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
776 OMIA:001939-9913 taurine cattle Brown Swiss (Cattle) Original Swiss Brown (Cattle) Simmental (Cattle) Haplotype with homozygous deficiency BH2 TUBD1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 19 g.10833921T>C c.757T>C p.(H210R) rs383232842 2016 27225349 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
1414 OMIA:002515-9913 taurine cattle Brown Swiss (Cattle) Haplotype with homozygous deficiency OH2 TUBGCP5 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.1268426G>T NM_001102495.1:c.311C>A NP_001095965.1:p.(T104K) NM_001102495.1 rs720533878 2021 34915862
594 OMIA:001593-9913 taurine cattle Charolais (Cattle) Scurs, type 2 TWIST1 duplication frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 4 NC_037331.1:g.27819577_27819586dup NM_001191145.1:c.148_157dup NP_001178074.1:p.(A56Rfs*87) c.DNA position based on NM_001191145.1 2011 21814570 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446.
761 OMIA:001469-9913 taurine cattle Belted Galloway (Cattle) Brown Swiss (Cattle) Dutch Belted (Cattle) Lakenvelder (Cattle) Yakutskii Skot, Russian Federation (Cattle) Coat colour, white belt TWIST2 repeat variation Naturally occurring variant Not currently evaluated 3 "The belt-associated variant was a copy number variant (CNV) involving the quadruplication of a 6 kb non-coding sequence located approximately 16 kb upstream of the TWIST2 gene" (Awasthi Mishra et al., 2017) 200922: g. info moved to here (g.118,607,715-118,614,131) until it can be standardised "a quadruplication on bovine chromosome 3 between positions 118,608,362 and 118,614,132 bp" (UMD3.1) (Rothammer et al., 2018) 2017 28658273
1851 OMIA:000202-9913 taurine cattle Angus (Cattle) Coat colour, albinism, oculocutaneous TYR substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 29 NC_037356.1:g.6389480C>G NM_181001.3:c.1184+1G>C 2026 42101288
1830 OMIA:000202-9913 taurine cattle Simmental (Cattle) Coat colour, albinism, oculocutaneous TYR substitution missense Naturally occurring variant Not currently evaluated ARS-UCD2.0 29 NC_037356.1:g.6343738G>A NM_181001.3:c.1283C>T NP_851344.1:p.(P428L) 2025 40913728
589 OMIA:000202-9913 taurine cattle Brown Swiss (Cattle) Coat colour, albinism, oculocutaneous TYR insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD2.0 29 NC_037356.1:g.6424971_6424972insG NM_181001.3:c.925_926insC Insertion causes a frameshift that resulted in a premature stop codon at residue 316, whereas normal sequence contains 517 amino acids. 2004 14727143 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
184 OMIA:001249-9913 taurine cattle Dexter (Cattle) Dun brown TYRP1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 8 NC_037335.1:g.31633328G>A NM_174480.3:c.1300C>T NP_776905.2:p.(H434Y) rs3423268465 2003 12755816 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
404 OMIA:001934-9913 taurine cattle Ayrshire, Finland (Cattle) Ptosis, intellectual disability, retarded growth and mortality (PIRM) syndrome UBE3B substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 17 NC_037344.1:g.63668380C>T NM_001206232.2:c.2076G>A NP_001193161.1:p.(E692E) ENSBTAT00000003493.5:c.2076G>A ENSBTAP00000003493.4:p.Glu692= rs475678587 2014 25306138 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Variant rsID kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
1409 OMIA:002298-9913 taurine cattle Jersey (Cattle) Neuropathy with splayed forelimbs UCHL1 JNS substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 6 g.60158901G>A c.979G>A p.(E327K) Several transcripts are reported: ENSBTAT00000046823.2:c.718G>A ENSBTAP00000044075.1:p.Glu240Lys ENSBTAT00000066434.1:c.931G>A ENSBTAP00000063885.1:p.Glu311Lys ENSBTAT00000072800.1:c.979G>A ENSBTAP00000059848.1:p.Glu327Lys ENSBTAT00000074165.1:c.706G>A ENSBTAP00000057432.1:p.Glu236Lys rs1116058914 2022 34955244
290 OMIA:000262-9913 taurine cattle Holstein (black and white) (Cattle) Holstein Friesian (Cattle) Red Holstein, Switzerland (Cattle) Wagyu (Cattle) Deficiency of uridine monophosphate synthase UMPS substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 1 NC_037328.1:g.69151931C>T NM_177508.1:c.1213C>T NP_803474.1:p.(R405*) rs5334474835 1993 8486364 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1814 OMIA:002970-9913 taurine cattle Belgian Blue (Cattle) Cleft palate, syndromic WDR33 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.4772428C>T NM_001206078.1: c.2617C>T NP_001193007.1: p.(P873S) 2025 40525707
592 OMIA:002423-9913 taurine cattle Japanese Black, Japan (Cattle) Multiple ocular defects WFDC1 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 18 g.10567100_10567101insC c.321insC insertion of a single base causes a frame shift mutation and a premature termination codon appeared at codon 126 2009 19374945 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1618 OMIA:002759-9913 taurine cattle Brown Swiss (Cattle) Brachygnathia WNT10B duplication frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.30846510dup XM_010805029.3:c.910dup XP_010803331.1:p.R304Pfs*14 XM_010805029.3; XP_010803331.1; published as g.30,846,510dupC; c.910dupC; variant is associated with increased risk of brachygnathia rs525007739 2023 37641348
921 OMIA:001736-9913 taurine cattle Charolais (Cattle) Polled and multisystemic syndrome ZEB2 deletion, gross (>20) Naturally occurring variant Not currently evaluated 2 A 3.7Mb deletion encompassing the genes ARHGAP15, GTDC1 and ZEB2 2012 23152852
1246 OMIA:001736-9913 taurine cattle Simmental (Cattle) Polledness, abnormal skull shape, small body stature and subfertility ZEB2 Del11 deletion, small (<=20) Naturally occurring variant Not currently evaluated ARS-UCD1.2 2 g.52263360_52263370del 2020 33046754
1283 OMIA:002307-9913 taurine cattle Limousin (Cattle) Frontonasal dysplasia ZIC2 deletion, small (<=20) nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.2 12 g.76742067del c.1596del p.(S453*) rs3423095151 2021 33388042

* Variant pathogenicity for single-gene diseases as evaluated according to the Animal Variant Classification Guidelines (AVCG) by the Variant Pathogenicity Working Group of the International Society of Animal Genetics (ISAG) Animal Genetic Testing Standardization (AGTS) Standing Committee: P = pathogenic, LP = likely pathogenic, VUS = variant of unknown significance, LB = likely benign, B = benign. For more information (including details on the classification of each variant) see LINKS.

Overall Statistics
Total number of variants 299
Variants with genomic location 268 (89.6% )
Variants in a variant database, i.e. with rs ID 187 (62.5%)
Variant Type Count Percent
complex rearrangement 9 3.0%
deletion, gross (>20) 25 8.4%
deletion, small (<=20) 36 12.0%
delins, gross (>20) 2 0.7%
delins, small (<=20) 10 3.3%
duplication 6 2.0%
haplotype 1 0.3%
insertion, gross (>20) 5 1.7%
insertion, small (<=20) 13 4.3%
inversion 1 0.3%
repeat variation 2 0.7%
substitution 189 63.2%
Variant Effect Count Percent
deletion (in-frame) 10 3.3%
delins (in-frame) 3 1.0%
extension (stop-lost) 2 0.7%
frameshift 47 15.7%
missense 121 40.5%
nonsense (stop-gain) 46 15.4%
regulatory 3 1.0%
splicing 24 8.0%
start-lost 1 0.3%
unknown 42 14.0%
Year First Reported Count Percent
1987 1 0.3%
1988 0 0.0%
1989 1 0.3%
1990 1 0.3%
1991 0 0.0%
1992 1 0.3%
1993 1 0.3%
1994 0 0.0%
1995 2 0.7%
1996 4 1.3%
1997 4 1.3%
1998 5 1.7%
1999 5 1.7%
2000 5 1.7%
2001 2 0.7%
2002 7 2.3%
2003 2 0.7%
2004 2 0.7%
2005 3 1.0%
2006 8 2.7%
2007 8 2.7%
2008 5 1.7%
2009 7 2.3%
2010 4 1.3%
2011 9 3.0%
2012 14 4.7%
2013 10 3.3%
2014 15 5.0%
2015 12 4.0%
2016 27 9.0%
2017 24 8.0%
2018 5 1.7%
2019 9 3.0%
2020 14 4.7%
2021 28 9.4%
2022 17 5.7%
2023 9 3.0%
2024 9 3.0%
2025 13 4.3%
2026 6 2.0%