Search Results

Advanced search

Link to this search: https://omia.org/results/?search_type=advanced&exclude_gb_species_id=9615%2C9913%2C9685%2C9823%2C9940%2C9796%2C9031%2C9986%2C9925&result_type=variant&singlelocus=yes&characterised=yes

275 variant records found

[show instead phene records]

By default, variants are sorted chronologically by year of publication, to provide a historical perspective. Readers can re-sort on any column by clicking on the column header. Click it again to sort in a descending order. To create a multiple-field sort, hold down Shift while clicking on the second, third etc relevant column headers.

WARNING! Inclusion of a variant in this table does not automatically mean that it should be used for DNA testing. Anyone contemplating the use of any of these variants for DNA testing should examine critically the relevant evidence (especially in breeds other than the breed in which the variant was first described). If it is decided to proceed, the location and orientation of the variant sequence should be checked very carefully.

Since October 2021, OMIA includes a semiautomated lift-over pipeline to facilitate updates of genomic positions to a recent reference genome position. These changes to genomic positions are not always reflected in the ‘acknowledgements’ or ‘verbal description’ fields in this table.

OMIA Variant ID OMIA Phene-Species ID(s) Species Name Breed(s) Variant Phenotype Gene Allele Variant Type Variant Effect Source of Genetic Variant AVCG Pathogenicity Classification* Reference Sequence Chr. g. or m. c. or n. p. Verbal Description EVA ID Year Published PubMed ID(s) Acknowledgements
1499 OMIA:002589-8839 Mallard Blue eggshell ABCG2 haplotype regulatory Naturally occurring variant Not currently evaluated BGI_duck1.0 NW_004676534.1 g.[3573054A>G;3573085A>G] The BGI_duck1.0 reference genome represents the blue eggshell genotype. 2020 33186356
1177 OMIA:001089-9542 Japanese macaque Antigen B ABO haplotype Naturally occurring variant Not currently evaluated Allele B reflects the peptide haplotype p.266Met + p.268Ala 2000 10984838
21 OMIA:001089-9544 Rhesus monkey Antigen A ABO haplotype Naturally occurring variant Not currently evaluated p.266L + p.268G Allele A is reflected in the peptide haplotype p.266Leu + p.268Gly 1998 9583803
20 OMIA:001089-9541 crab-eating macaque A antigen ABO haplotype Naturally occurring variant Not currently evaluated p.266L + p.268G Allele A is reflected in the peptide haplotype p.266Leu + p.268Gly 1998 9583803
1174 OMIA:001089-9544 Rhesus monkey Antigen B ABO haplotype Naturally occurring variant Not currently evaluated p.266M + p.268A Allele B is a reflection of the peptide haplotype p.266Met + p.268Ala 1998 9583803
1175 OMIA:001089-9541 crab-eating macaque B antigen ABO haplotype Naturally occurring variant Not currently evaluated p.266M + p.268A Allele B is a reflection of the peptide haplotype p.266Met + p.268Ala 1998 9583803
22 OMIA:001089-9579 agile gibbon Alleles A and B ABO haplotype missense Naturally occurring variant Not currently evaluated c.2178C>A and c.2185G>C Haplotype c.2178C + c.2185G is allele A; haplotype c.2178A + c.2185C is allele B 2009 19298858
23 OMIA:001089-9580 common gibbon Blood group system ABO ABO haplotype missense Naturally occurring variant Not currently evaluated c.2178C>A and c.2185G>C 2009 19298858
532 OMIA:001089-9598 chimpanzee O (lack of antigen) ABO O^del deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated c.514_522delGTGCTGGAG p.(V172-E174del) 1999 10380696
24 OMIA:001089-9598 chimpanzee O (lack of antigen) ABO O^x substitution missense Naturally occurring variant Not currently evaluated c.791A>C p.(Y264C) 1999 10380696
1060 OMIA:001271-9915 indicine cattle (zebu) Miniature Zebu, United Kingdom of Great Britain and Northern Ireland (Cattle) Bulldog calf ACAN insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 21 g.20428539_20428540insC c.5688_5689insC p.(V1897fs*9) cDNA position based on transcript NM_173981.2 2018 30305023
1801 OMIA:002956-176072 dusky lory Feather colour, red ALDH3A2 substitution regulatory Naturally occurring variant Not currently evaluated scaffold_13:6288712T>C 2024 39480920
1075 OMIA:001602-93934 Japanese quail Feather colour, fawn-2/beige ASIP Y^f2 duplication Naturally occurring variant Not currently evaluated 20 Robic et al. (2019) concluded "that fawn-2 and beige are the same allele, and that it is caused by a 70,895-bp tandem duplication . . . [with breakpoints] (NC-029535 [1,371,395(or 98)–1,442,295 (or 98)]) . . . located downstream of the ITCH exon 1 and upstream of the ASIP exon e4 (5′ UTR). . . . The 70,895 bp of the duplicated region include the entire AHCY gene on one strand, and parts of the ASIP and ITCH genes on the other strand." 2019 30987584
665 OMIA:000201-10042 North American deer mouse New Hampshire (Chicken) Melanic (non-agouti) ASIP deletion, gross (>20) regulatory Naturally occurring variant Not currently evaluated "a 125-kb deletion, which includes the upstream regulatory region and exons 1 and 2 of Agouti, results in a loss of Agouti expression" 2009 19649329
1321 OMIA:002200-9915 indicine cattle (zebu) Brahman (Cattle) Nellore, India (Sheep) Darkness of hair coat ASIP delins, gross (>20) Naturally occurring variant Not currently evaluated 13 1155-bp deletion followed by an insertion of a transposable element of more than 150 bp that may impact the recruitment of ASIP non-coding exons (Trigo et al.2021) 2021 33910501
251 OMIA:000201-61386 Kodkod Melanism (black coat) ASIP substitution missense Naturally occurring variant Not currently evaluated p.(C126Y) 2015 25695801
252 OMIA:000201-3055696 Colocolo Melanism (black coat) ASIP substitution missense Naturally occurring variant Not currently evaluated p.(R120C) 2015 25695801
1119 OMIA:000201-10141 domestic guinea pig Recessive black Asip deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated c.181_184delTTCA MH026115: c.181_184delTTCA; the deletion leads to a truncated protein of 77 amino acids due to the premature stop codon. 2019 30746725
330 OMIA:000201-10042 North American deer mouse Alaska, United States of America (North American deer mouse) Melanic (non-agouti) ASIP substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.193?>? p.(Q65*) 2009 19649329
333 OMIA:000201-9691 leopard Coat colour, black (black panther) ASIP substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.333C>A p.(C111*) 2012 23251368
1219 OMIA:000201-9858 Western roe deer Melanistic (black) ASIP substitution missense Naturally occurring variant Not currently evaluated c.33G>T p.(L11F) 2020 32545389
1587 OMIA:000201-9691 leopard Coat colour, black (black panther) ASIP substitution missense Naturally occurring variant Not currently evaluated c.353C>A p.(C113F) 2023 37440497
1666 OMIA:000201-10007 tassel-eared squirrel Coat colour, black ASIP substitution missense Naturally occurring variant Not currently evaluated c.370T>C p.(C124R) 2024 38396615
504 OMIA:001602-93934 Japanese quail Feather colour, recessive black ASIP rb deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated 20 c.373_380del "A deletion of 8 bases was found in the ASIP gene" 2008 18287406
253 OMIA:000201-61455 Asiatic golden cat Black ASIP substitution missense Naturally occurring variant Not currently evaluated c.384C>G p.(C128W) 2012 23251368
1010 OMIA:000201-9838 Arabian camel Black and dark-brown coat colour ASIP haplotype Naturally occurring variant Not currently evaluated c.[23delT;c.25G>A] KU179868; c.[23delT;c.25G>A]. As described by Almathen et al. (2018), this haplotype comprises "a 1-bp deletion (23delT/T) and a SNP (25G/A) in exon 2 of ASIP". 2018 29893870
654 OMIA:001602-93934 Japanese quail Feather colour, lethal yellow ASIP Y deletion, gross (>20) Naturally occurring variant Not currently evaluated 20 g.1463709_1604872del Nadeau et al. (2008): "a >90-kb [141162bp] deletion upstream of ASIP" 2008 18287407 The g. coordinates were provided by Robic et al. (2019)
149 OMIA:000201-9793 ass (donkey) Âne de Provence, France (Ass) Âne normand, France (Ass) Dezhou, China (Ass) Miniature, United States of America (Ass) No light points ASIP NLP substitution missense Naturally occurring variant Not currently evaluated ASM1607732v2 15 NC_052191.1:g.25406489T>C XM_044748287.1:c.349T>C XP_044604222.1:p.(C117R) The Dezhou reference genome ASM1607732v2 represents the 'no light points' variant: NC_052191.1:g.25406489C

2015 25887951
1847 OMIA:000201-9279 southeastern quoll Coat colour, melanistic ASIP deletion, gross (>20) start-lost Naturally occurring variant Not currently evaluated DasViv_v1.0 2 4.7 kb deletion encompassing the first two coding exons 2025 41119986
1734 OMIA:000201-30532 fallow deer Coat colour, black ASIP substitution splicing Naturally occurring variant Not currently evaluated GCF_033118175.1 23 NC_083703.1:g.63827550G>A XM_061127099.1:c.225+1G>A 2024 39202415
1735 OMIA:000201-30532 fallow deer Coat colour, black ASIP duplication Naturally occurring variant Not currently evaluated GCF_033118175.1 23 NC_083703.1:g.63830157_63830161dup 2024 39202415
1708 OMIA:000201-9337 common brushtail possum Coat colour, non-agouti (black) ASIP substitution missense Naturally occurring variant Not currently evaluated mTriVul1.pri 3 NC_050575.1:g.100483705C>T XM_036748710.1:c.343C>T XP_036604605.1:p.(R115C) 2024 39086822
667 OMIA:000201-9627 red fox Dark Standard Silver ASIP deletion, gross (>20) Naturally occurring variant Not currently evaluated VulVul2.2 NW_020356514.1 A 16.5-kb deletion resulting in "a 166-nt deletion in the Standard Silver fox cDNA, spanning the second exon ... .This deletion removes the start codon and entire signal peptide" 1997 9054949
1076 OMIA:001645-10036 golden hamster Black tremor Atrn insertion, gross (>20) Naturally occurring variant Not currently evaluated Kuramoto et al. (2002): "an approximately 10-kb DNA fragment, which had 557-bp direct repeats in both ends and was flanked by the identical 6-bp target duplication sequences, [that] was inserted into exon 24" 2002 11773967
1676 OMIA:002837-9646 giant panda Coat colour, brown white BACE2 deletion, gross (>20) Naturally occurring variant Not currently evaluated 1 c.176_200del Published as c.176_200delTCGCCCTGGAGCCCGCCGGCGGCGC; g.4545815_4545839del 2024 38437540
1131 OMIA:002216-9544 Rhesus monkey Bardet-Biedl syndrome 7 BBS7 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Mmul_8.0.1 c.160delG p.(A54fs) 2019 31589838
1375 OMIA:002466-48883 OMIA:002466-48882 OMIA:002466-87173 OMIA:002466-48884 OMIA:002466-48885 OMIA:002466-48886 OMIA:002466-1553461 medium ground-finch Beak colour, yellow BCO2 substitution synonymous Naturally occurring variant Not currently evaluated 24 g.6166878G>A p.(V?V) synonymous change 32 bp into exon 4 2021 34687609
1559 OMIA:002466-9135 common canary Beak and leg colour, red BCO2 substitution missense Naturally occurring variant Not currently evaluated NW_022042652.1 g.75258192G>A p.R413H 2020 31930402 XP_009096268.1, genomic position as reported by Bovo et al. (2023) PMID:37194440
1490 OMIA:002573-151761 yellow-crowned parrot Lewy body-like disease CADPS2 substitution missense Naturally occurring variant Not currently evaluated c.1675G>C p.(V559L) 2022 36086934
516 OMIA:001416-9612 gray wolf Coat colour, dominant black CBD103 K^B deletion, small (<=20) Naturally occurring variant Not currently evaluated 3bp deletion of the CBD103 gene 2009 19197024
520 OMIA:001416-9614 coyote Coat colour, dominant black CBD103 deletion, small (<=20) Naturally occurring variant Not currently evaluated 3bp deletion of the CBD103 gene 2009 19197024
1340 OMIA:002386-9544 Rhesus monkey OKT4 epitope deficiency CD4 substitution missense Naturally occurring variant Not currently evaluated 11 c.C793T p.(A265W) 2021 33893743
863 OMIA:001890-198806 ruff Male body size/courtship behaviour CENPN inversion Naturally occurring variant Not currently evaluated "a 4.5Mb inversion on the ruff orthologue of chicken chromosomr GGA11 which, due to the well-known lethality of recombinants within an inversion, has created a supergene determining male breeding behaviour, body size and plumage colour" 2016 26569123
1691 OMIA:002767-7957 goldfish Twin-tail chordinA substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated p.(E127*) 2014 24569511
490 OMIA:000685-9915 indicine cattle (zebu) Brahman (Cattle) Myasthenic syndrome, congenital, CHRNE-related CHRNE 470del20 deletion, small (<=20) Naturally occurring variant Not currently evaluated ARS-UCD1.2 19 g.26485848_26485867del c.470_489del Kraner et al. (2002): "a loss of 20 bp within the coding sequence of exon 5 (Fig. 2), between nucleotide 469 and 490 (nucleotide numbering referring to the cDNA sequence published under accession number X02597". These authors (and subsequent authors) call this variant "470del20". The current (2020) HGVS nomenclature is c.470_489del 200922: g. information move here (g.27119615) until standardised rs5334475050 2002 12481987 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
399 OMIA:000698-89462 water buffalo Murrah (Buffalo) Myotonia CLCN1 substitution splicing Naturally occurring variant Not currently evaluated UOA_WB_1 8 NC_037552.1:g.106762128C>T NM_001290916.1:c.396C>T abnormal splicing associated with synonymous SNP (Ser132, c.396C>T)  2013 23339992
1783 OMIA:002927-94885 corn snake Skin colour pattern, stripe CLCN2 insertion, gross (>20) frameshift Naturally occurring variant Not currently evaluated Scaffold 6 p.(G203Efs*4) insertion of a 5832-bp LTR-retrotransposon in the fifth intron of the CLCN2 gene - splicing of the retroposon results in a 397-bp insertion between exons 5 and 6 which introduces a premature stop codon after exon 5 (Montandon et al., 2025) 2025 40140900
1030 OMIA:001962-9542 Japanese macaque Neuronal ceroid lipofuscinosis, 7 CLN7 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated 4 c.769delA p.(I257Lfs*36) 2018 30048804
1795 OMIA:001718-8090 Japanese medaka Skeletal defects, col10a1a-related col10a1a deletion, small (<=20) frameshift Genome-editing (CRISPR-Cas9) Not currently evaluated p.(C633fs) 5 base pair deletion 2024 38510140
1506 OMIA:001274-452646 American mink Coat colour, black crystal COPA substitution missense Naturally occurring variant Not currently evaluated NNQGG.v01 FNWR01000261.1 g.4876673G>A c.478C>T p.(R160C) 2022 35729186
1012 OMIA:002159-9694 tiger Golden tiger CORIN substitution missense Naturally occurring variant Not currently evaluated c.1759C>T p.(H587Y) 2017 28281538
1491 OMIA:001643-10036 golden hamster duper Cry1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated c.578del p.(P193fs) published as c.578delC 2022 35471909
1176 OMIA:000168-10141 domestic guinea pig Cataract Cryz deletion, gross (>20) splicing Naturally occurring variant Not currently evaluated "a 102-bp deletion towards the 3' end of the coding region. This deletion does not interfere with the reading frame but results in a protein 34 amino acids shorter." (Rodriguez et al., 1992) 1992 1390943
1751 OMIA:000017-8128 Nile tilapia Steroid hormone-deprived sex reversal, CYP11A1-related cyp11a1 deletion, gross (>20) Genome-editing (CRISPR-Cas9) Not currently evaluated 22 bp deletion in exon 4 2024 39284885
1743 OMIA:002894-10036 golden hamster Dcaf17 deficiency Dcaf17 deletion, small (<=20) frameshift Genome-editing (CRISPR-Cas9) Not currently evaluated BCM_Maur_2.0 NW_024429189.1:g.39589667_39589671del XM_040745545.1:c.71_75del XP_040601479.1:p.(D24Gfs*24) 2024 39239833
1335 OMIA:002377-8845 swan goose Lion Head (Goose (domestic)) Sichuan White, China (Goose (domestic)) Knob, basal DIO2 substitution missense Naturally occurring variant Not currently evaluated AnsCyg_PRJNA183603_v1.0 NW_013185827.1 g.642923G>A p.(P265L) 2021 34193033
1739 OMIA:000543-103695 central bearded dragon Scaleless EDA Sca deletion, gross (>20) deletion (in-frame) Naturally occurring variant Not currently evaluated "in-frame deletion of 14 amino acids in a highly conserved tumor necrosis factor (TNF) motif of the EDA protein" 2016 28439533
724 OMIA:001695-8090 Japanese medaka Reduced scale-3 edar insertion, gross (>20) Naturally occurring variant Not currently evaluated "several kb of extra sequence in the 5' UTR that . . . contains out-of-frame start codons and stop codons, [and consequently] the mutant transcript is likely to result in premature initiation and termination of translation and, as a result, the EDAR protein is not synthesized" 2001 11516953
1869 OMIA:002887-37003 mangrove rivulus Ectodermal dysplasia, no-fin-ray edaradd nfr substitution missense Chemical mutagenesis (ENU) Not currently evaluated ASM164957v2 LH22 NC_051451.1:g.11425249C>T XM_017421743.3:c.574C>T XP_017277232.1:p.(R192C) 2025 39837941
1738 OMIA:002887-94885 corn snake Scaleless EDARADD scl deletion, small (<=20) nonsense (stop-gain) Naturally occurring variant Not currently evaluated UNIGE_PanGut_3.0 Super-Scaffold_423 NW_023010793.1:g.39572203_39572204del XM_034428296.1:c.545_546del XP_034284187.1:p.(C182*) 2023 37315141
1747 OMIA:002901-8296 axolotl Skin colour, white EDN3 d not known Not currently evaluated cDNA from animals with the white phenotype lack exon 2 2017 28127056
1632 OMIA:000375-8932 rock pigeon Piebald EDNRB2 Group 4 duplication Naturally occurring variant Not currently evaluated tandem duplication of a 37-kb region spanning from intron 1 of VAMP7 to just 5’ of EDNRB2 2023 37546953
1631 OMIA:000375-8932 rock pigeon Piebald EDNRB2 Group2 substitution missense Naturally occurring variant Not currently evaluated p.(A42E) 2023 37546953
1630 OMIA:000375-8932 rock pigeon Piebald EDNRB2 Group1 substitution missense Naturally occurring variant Not currently evaluated p.(R290C) 2023 37546953
1562 OMIA:002701-51751 ball python Skin colour, EDNRB2-related EDNRB2 yellowbelly deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated c.1646del OP589186.1; 1-bp deletion introduces a frameshift, which removes or alters three of the seven transmembrane helices 2023 37191439
1563 OMIA:002701-51751 ball python Skin colour, EDNRB2-related EDNRB2 yellowbelly deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated c.1747_1763del OP589186.1; "17-bp deletion introduces a frameshift into the transcript, which removes or alters two of the seven transmembrane helices" 2023 37191439
1564 OMIA:002701-51751 ball python Skin colour, EDNRB2-related EDNRB2 specter substitution missense Naturally occurring variant Not currently evaluated c.2601G>C p.(R315P) OP589186.1 2023 37191439
1567 OMIA:002701-51751 ball python Skin colour, EDNRB2-related EDNRB2 asphalt substitution splicing Naturally occurring variant Not currently evaluated c.3118G>A OP589186.1; G-to-A substitution in the sixth splice donor for the sixth intron 2023 37191439
1565 OMIA:002701-51751 ball python Skin colour, EDNRB2-related EDNRB2 spark substitution missense Naturally occurring variant Not currently evaluated c.481G>C p.(L152F) OP589186.1 2023 37191439
1566 OMIA:002701-51751 ball python Skin colour, EDNRB2-related EDNRB2 gravel substitution splicing Naturally occurring variant Not currently evaluated c.499G>A OP589186.1; G-to-A substitution at the splice donor for the first intron 2023 37191439
257 OMIA:000375-93934 Japanese quail Feather colour, panda/dotted white EDNRB2 substitution missense Naturally occurring variant Not currently evaluated c.995G>A p.(R332H) 2007 17313575
1633 OMIA:001252-8932 rock pigeon Recessive white and bull eye EDNRB2 substitution missense Naturally occurring variant Not currently evaluated 4A g.11167700C>T c.766G>A p.(E256K) 2023 37546953
1773 OMIA:000375-9049 Indian peafowl Feather colour, white EDNRB2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated 4 g.12583552G>A p.(W206*) 2025 39965774
1164 OMIA:001252-8843 domestic goose Gang, China (Goose (domestic)) Feather colour, recessive white EDNRB2 insertion, small (<=20) Naturally occurring variant Not currently evaluated AnsCyg_PRJNA183603_v1.0 NW_013185915.1:g.750748_750735insCACAGGTGAGCTCT 2020 32066369
1 OMIA:000240-8932 rock pigeon Crest EPHB2 cr substitution missense Naturally occurring variant Not currently evaluated c.???C>T p.(R758C) 2013 23371554
148 OMIA:000361-9783 Asiatic elephant Factor VII deficiency F7 substitution missense Naturally occurring variant Not currently evaluated c.202A>G p.(R68G) 2017 28118558
983 OMIA:000439-9844 llama Long hair FGF5 haplotype Naturally occurring variant Not currently evaluated A "a single base deletion (c.348delA), [and] a 12-bp insertion (c.351_352insCATATAACATAG)" that comprise a single likely causal variant 2017 29024003
982 OMIA:000439-10141 domestic guinea pig Long hair Fgf5 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.403C>T p.(R135*) "The data were submitted to the European Variation Archive (accession no. PRJEB24997)" 2018 29603294
984 OMIA:000439-9844 llama Long hair FGF5 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.499C>T 2017 29024003
559 OMIA:000439-10036 golden hamster Hair, long Fgf5 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated c.546delG p.(R184Gfs*6) 2015 26481120
347 OMIA:000439-9793 ass (donkey) Âne de Provence, France (Ass) Âne des Pyrénées, France (Ass) Âne grand noir du Berry, France (Ass) Âne normand, France (Ass) Hair, long FGF5 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ASM1607732v2 3 NC_052179.1:g.161373495G>A XM_014836312.2:c.245G>A XP_014691798.1:p.W82* 2014 25927731
560 OMIA:000439-9793 ass (donkey) Âne Bourbonnais, France (Ass) Âne des Pyrénées, France (Ass) Âne normand, France (Ass) Poitou (Ass) Hair, long FGF5 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ASM1607732v2 3 NC_052179.1:g.161381098_161381099del XM_014836312.2:c.433_434del XP_014691798.1:p.M145Vfs*15 2014 25927731
1343 OMIA:000439-9838 Arabian camel Long hair FGF5 substitution missense Naturally occurring variant Not currently evaluated CamDro3 2 g.76625546C>T c.779C>T p.(P260L) cDNA and protein positions based on transcript ENSCDRT00005003721.1 2021 34432312
1827 OMIA:000419-93934 Japanese quail Glycogen storage disease, type II GAA deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Coturnix japonica 2.1 c.1096delG p.(A366Hfs*23) 2025 40870023
517 OMIA:000578-9544 Rhesus monkey Krabbe disease GALC deletion, small (<=20) Naturally occurring variant Not currently evaluated c.387delAC 1997 9192853
1884 OMIA:003047-9541 crab-eating macaque Polycystic kidney disease, GANAB-related GANAB substitution missense Naturally occurring variant Not currently evaluated NM_001285075.1:c.2708T>C p.(V903A) 2023 36876010
1782 OMIA:002937-51751 ball python Skin colour, axanthism gch2/LOC103050242 substitution nonsense (stop-gain) Not currently evaluated 2 g.281146407C>T c.520C>T p.(R174*) The genomic location corresponds to chromosome 2 position 281146407 of the Burmese Python assembly 2025 40235167
190 OMIA:001473-9915 indicine cattle (zebu) Brahman (Cattle) Dwarfism, growth-hormone deficiency GH1 substitution missense Naturally occurring variant Not currently evaluated c.641C>T p.(T200M) Bos indicus cDNA position based on AF034386, protein position based on AAB92549 2009 19524387 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
677 OMIA:001920-27706 largemouth bass Abortion due to deletion in GHRH GHRH deletion, gross (>20) Naturally occurring variant Not currently evaluated a 66bp deletion (c.-923_-858del) in the 5' flanking region of the GHRH gene in an autosomal recessive embryonic lethal 2014 24697798
1832 OMIA:003004-80972 clown anemonefish Skin colour pattern, Snowflake gja5b substitution missense Naturally occurring variant Not currently evaluated c.124G>A p.(E42K) 2025 40909517
1802 OMIA:002957-7994 Mexican tetra Anophthalmia/microphthalmia gja8b substitution missense Naturally occurring variant Not currently evaluated p.(S89K) 2024 39554031
1803 OMIA:002957-7994 Mexican tetra Anophthalmia/microphthalmia gja8b substitution missense Naturally occurring variant Not currently evaluated p.(T39M) 2024 39554031
1178 OMIA:001461-9217 American flamingo Tay-Sachs disease HEXA substitution missense Naturally occurring variant Not currently evaluated c.1406C>T p.(P469L) 2008 18693054
1584 OMIA:001243-9601 Sumatran orangutan Alkaptonuria HGD substitution missense Naturally occurring variant Not currently evaluated Susiae_PABv2/ponAbe3 3 g.17314095G>A c.1081G>A p.(G361R) 2023 37354891
1800 OMIA:002769-8090 Japanese medaka dorsalfinless hoxc11a insertion, gross (>20) Naturally occurring variant Not currently evaluated 7 insertion of 12.8 kb transposon-like DNA in 3′ UTR of hoxc11a resulting in reduced expression of hoxc11a 
2024 38861596
1731 OMIA:002275-452646 American mink Coat colour, Royal pastel HPS3 b insertion, gross (>20) Naturally occurring variant Not currently evaluated NNQGG.v01 6 NC_058096.1:g.75137871_75137872ins[OR863243];75137865_75137871 2024 38956930
789 OMIA:002116-69293 three-spined stickleback Coat colour, albinism, oculocutaneous, HPS5-related Hps5 casper insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated "casper mutants have an insertion of a single nucleotide in the 6th exon of Hsp5, predicted to generate an early frameshift" 2017 28739598
331 OMIA:001348-9544 Rhesus monkey Atrichia with papular lesions HR substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated MMUL_1 8 g.22046679C>T c.1831C>T p.(R611*) 2002 11831740 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1786 OMIA:000664-9542 Japanese macaque Mucopolysaccharidosis I IDUA substitution missense Naturally occurring variant Not currently evaluated c.786 C>A p.(H262Q) 2025 40251406
1622 OMIA:002763-9541 crab-eating macaque Severe combined immunodeficiency disease IL2RG substitution nonsense (stop-gain) Base-editing Not currently evaluated Macaca_fascicularis_5.0 X g.68110639G>A c.391C>T p.(Q131*) XM_005593892.2; XP_005593949.1 2023 37661226
962 OMIA:001675-61379 black-footed cat Cone-rod dystrophy 2 IQCB1 deletion, small (<=20) nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.1282delCT p.(L428*) 2017 28322220
1711 OMIA:000284-10036 golden hamster Diabetes mellitus, type 2 Irs2 deletion, gross (>20) Genome-editing (CRISPR-Cas9) Not currently evaluated 2653-bp deletion in exon 1 2024 39134590
1525 OMIA:001652-9627 red fox Platinum coat colour KIT substitution splicing Naturally occurring variant Not currently evaluated G>A variant in the first nucleotide of KIT intron 17 causes skipping of exon 17 2015 25662789
1818 OMIA:000209-30521 domestic yak Coat colour, white KIT deletion, small (<=20) regulatory Naturally occurring variant Not currently evaluated 6 14bp deletion in KIT promoter 2025 40629379
566 OMIA:001737-9838 Arabian camel Coat colour, white spotting, KIT-related KIT deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated c.1842delG p.(M614Ifs*5) 2017 28282952
403 OMIA:000209-494514 Arctic fox Coat colour, dominant white KIT substitution splicing Naturally occurring variant Not currently evaluated c.1867+1G>T 2013 24308634
150 OMIA:000209-9793 ass (donkey) Coat colour, dominant white KIT W substitution missense Naturally occurring variant Not currently evaluated ASM1607732v2 3 NC_052179.1:g.139882496A>C XM_014853517.2:c.662A>C XP_014709003.2:p.(Y221S)

2015 25818843
405 OMIA:001737-9793 ass (donkey) Coat colour, white spotting, due to KIT KIT Ws substitution splicing Naturally occurring variant Not currently evaluated ASM1607732v2 3 NC_052179.1:g.139911533T>A XM_014853517.2:c.1978+2T>A 2015 25818843
1505 OMIA:000449-452646 American mink Shadow coat colour KIT S^h substitution missense Naturally occurring variant Not currently evaluated NNQGG.v01 NWR01000037.1 g.6253028G>T c.2374G>T p.(D792Y) 2022 35481560
1725 OMIA:001737-89462 water buffalo Coat colour, white spotting, KIT-related KIT substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated UOA_WB_1 7 NC_037551.1:47207784A>T NM_001290952.1:c.2016T>A NP_001277881.1:p.(Y672*) 2024 39048931
1102 OMIA:000209-30538 alpaca Classic grey coat colour KIT substitution missense Naturally occurring variant Not currently evaluated VicPac3.2 2 NW_021964157.1:g.38170962G>A XM_031688000.1:c.391G>A XP_031543860.1:p.G131R published as c.376G>A and p.(G126R), coordinates in this table are based on supplementary table 4 in Tan et al. (2024) 2019 31297861
1152 OMIA:002237-8090 Japanese medaka Few melanophore kitlga insertion, gross (>20) Naturally occurring variant Not currently evaluated Otsuki et al. (2020): "the phenotype of fm medaka is attributable to insertion of a Tcb1-like transposon at the kitlga locus" 2020 31757930
1556 OMIA:000499-9544 Rhesus monkey Hypercholesterolaemia LDLR substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated 19 p.(W284*) G>A in exon 6 in position 914 of the human cDNA resulting in p.(W284*) 1990 2326270
1557 OMIA:000499-9544 Rhesus monkey Hypercholesterolaemia LDLR substitution missense Naturally occurring variant Not currently evaluated 19 c.245G>A p.(C82Y) 2023 37186395
1672 OMIA:002796-9541 crab-eating macaque Cardiomyopathy, dilated, LMNA-related LMNA substitution splicing Base-editing Not currently evaluated MFA1912RKSv2 1 NC_052255.1:g.93546791T>C XM_045371898.1:c.357-2A>G 2024 38559624
1046 OMIA:001701-13146 budgerigar Feater colour, blue LOC101880715 substitution missense Naturally occurring variant Not currently evaluated 1 NW_004848279.1:g.21369066T>C XM_005153087.1c.1930T>C p.(R644W) 2017 28985565
1878 OMIA:002765-7957 goldfish Celestial eye lrp2a substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated 9 g.28575379C>T 2025 41226661
1877 OMIA:002765-7957 goldfish Telescope eye lrp2a insertion, gross (>20) frameshift Naturally occurring variant Not currently evaluated ASM336829v1 9 13-kBP insertion in intron 45 due to insertion of foamy-like endogenous retrovirus resulting in premature stop codon  2020 32392470
1876 OMIA:002765-7957 goldfish Telescope eye lrp2a substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ASM336829v1 9 NC_039251.1:g.7990395C>A XM_026271200.1:c.13549G>T XP_026126985.1:p.(G4517*) published as p.G4480* 2020 32392470
1875 OMIA:002765-7957 goldfish Telescope eye lrp2a substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ASM336829v1 9 NC_039251.1:g.8006317G>T XM_026271200.1:c.10386C>A XP_026126985.1:p.(Y3462*) published as p.(Y3425*) 2020 32392470
605 OMIA:001721-32536 cheetah Coat colour, king LVRN insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated p.(N977Kfs*110) 2012 22997338
1348 OMIA:002431-9694 tiger Pseudomelamism LVRN substitution missense Naturally occurring variant Not currently evaluated PanTig1.0 A1 c.1360C>T p.H454Y Sagar et al. (2021): "[Assembly PanTig1.0(GCF_000464555.1)]. . . . (Taqpep c.1360C > T); XP_007086933.1) of the protein (Taqpep p.H454Y)" 2021 34518374
518 OMIA:000185-452646 American mink Chediak-Higashi syndrome LYST deletion, small (<=20) Naturally occurring variant Not currently evaluated c.9468delC 2013 22762706
1359 OMIA:002449-94885 corn snake Skin colour, lavender LYST substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.9508C>T p.(Q3169*) 2020 33020272
249 OMIA:000625-10141 domestic guinea pig Mannosidosis, alpha Man2b1 substitution missense Naturally occurring variant Not currently evaluated c.679C>T p.(R227W) 2002 11959458
1646 OMIA:002804-9544 Rhesus monkey Germline mutation rate MBD4 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated MMul10 2 g.147059371del c.984del p.(I330Sfs*2) ENSMMUG00000012723 2023 37984997
1007 OMIA:001199-10141 domestic guinea pig Brown coat colour MC1R e (MC1R*4) deletion, gross (>20) Naturally occurring variant Not currently evaluated Vidal (2018): "a deletion of 2760 bp, including the entire MC1R coding region" 2018 30101449
674 OMIA:001199-30640 gray squirrel Melanism (black) MC1R E^B deletion, gross (>20) Naturally occurring variant Not currently evaluated MC1RΔ24 allele E^B ["at amino acid positions 87-94"] 2009 19643815
250 OMIA:001199-46844 Geoffroy's cat Melanism (black coat) MC1R substitution missense Naturally occurring variant Not currently evaluated p.(C125R) 2015 25695801
1328 OMIA:000374-495946 Eleonora's falcon Feather colour, extended black MC1R deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated p.(M114_V117del) 2011 21696477
1100 OMIA:000374-57662 red-footed booby White plumage MC1R haplotype Naturally occurring variant Not currently evaluated p.(M85V) + p.(R207H) 2007 17602182
1173 OMIA:001199-37349 woolly mammoth Light hair colour MC1R not known missense Naturally occurring variant Not currently evaluated p.(R67C) 2006 16825562
1101 OMIA:000374-70340 Lesser snow goose Blue plumage MC1R not known missense Naturally occurring variant Not currently evaluated p.(V85M) 2004 15031505
262 OMIA:001199-494514 Arctic fox Blue coat colour MC1R Ed haplotype missense Naturally occurring variant Not currently evaluated p.[(G5C);(F280C)] The blue (Ed) allele is a haplotype comprising two missense variants (p.Gly5Cys and p.Phe280Cys) (Våge et al., 2005) 2005 15982782
1271 OMIA:001199-30532 fallow deer Coat colour, white MC1R substitution missense Naturally occurring variant Not currently evaluated c.143T>C p.(L48P) 2020 33213385
1765 OMIA:002770-51751 ball python Skin colour, Clown colour morph MC1R substitution missense Naturally occurring variant Not currently evaluated 3 c.149G>A p.(S50N) 2025 39609249
180 OMIA:001199-9870 reindeer Coat colour, extension MC1R substitution missense Naturally occurring variant Not currently evaluated c.218T>C p.(M73T) 2014 25039753
1002 OMIA:002156-46218 Chinese painted quail Feather colour, Blue Face MC1R substitution missense Naturally occurring variant Not currently evaluated c.271G>A p.(E92K) 2018 29974967
18 OMIA:001494-9103 turkey Feather colour, dominant black MC1R substitution missense Naturally occurring variant Not currently evaluated c.364A>T p.(I122F) 2010 20634512
1329 OMIA:000374-120794 gyrfalcon Feather colour, extended black MC1R substitution missense Naturally occurring variant Not currently evaluated c.376A>G p.(I126V) 2012 22497627
1733 OMIA:001199-30532 fallow deer Coat colour, menil MC1R substitution missense Naturally occurring variant Not currently evaluated c.714G>A p.(G236D) 2024 39202415
1006 OMIA:001199-10141 domestic guinea pig Brown coat colour MC1R e (MC1R*2) substitution missense Naturally occurring variant Not currently evaluated c.749T>C p.(L250Q) 2018 30101449
181 OMIA:001199-9870 reindeer Coat colour, extension MC1R substitution missense Naturally occurring variant Not currently evaluated c.839T>G p.(F280C) 2014 25039753
1003 OMIA:002155-46218 Chinese painted quail Feather colour, Red Breasted MC1R substitution missense Naturally occurring variant Not currently evaluated c.872C>T p.(P292L) 2018 29974967
1346 OMIA:001199-37190 antarctic fur seal Hypopigmentation (blond) MC1R substitution missense Naturally occurring variant Not currently evaluated c.872C>T p.(S291F) 2016 27547348
19 OMIA:001494-9103 turkey Feather colour, black-wing bronze MC1R substitution missense Naturally occurring variant Not currently evaluated c.887C>T p.(A296V) 2010 20634512
1009 OMIA:001199-9838 Arabian camel White coat colour MC1R substitution missense Naturally occurring variant Not currently evaluated c.901C>T p.(R301C) KU179867; c.901C>T; p.R301C 2018 29893870
328 OMIA:001494-9103 turkey Bronze feathers MC1R substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.96G>A 2010 20634512
256 OMIA:001435-93934 Japanese quail Feather colour, extended brown MC1R substitution missense Naturally occurring variant Not currently evaluated c.?G>A p.(E92K) 2006 16734695
1848 OMIA:001199-37699 marsupial mole Coat colour, wildtype MC1R nonsense (stop-gain) Naturally occurring variant Not currently evaluated reference sequence the normal cream coat colour of marsupial moles is likley due to an MC1R in-frame stop codon at position 160  2025 41119986
996 OMIA:001199-9793 ass (donkey) Âne de Provence, France (Ass) Âne des Pyrénées, France (Ass) Âne normand, France (Ass) Miniature, United States of America (Ass) Coat colour, red MC1R e substitution missense Naturally occurring variant Not currently evaluated ASM1607732v2 28 NC_052204.1:g.63570188T>C XM_014836533.2:c.629T>C XP_014692019.1:p.(M210T) 2014 25155046
1896 OMIA:001199-36239 least weasel Coat colour, winter-brown MC1R delins, small (<=20) missense Naturally occurring variant Not currently evaluated mMusNiv2.hap1.1 scaffold 337 c.301_302delinsAA p.(L101K) 2026 41957296
1741 OMIA:000374-56313 barn owl Feather colour, rufous MC1R R substitution missense Naturally occurring variant Not currently evaluated T.alba_DEE_v4.0 Super-scaffold 26 NW_024881300.1:g.22522039G>A c.376G>A p.(V126I) valine allele is associated with whiter plumage colorations, whereas the isoleucine allele is associated to redder plumage (rufous) coloration  2015 25857339 Genomic coordinates as reported by Cumer et al. 2024 (PMID:38196365)
115 OMIA:001199-9627 red fox Coat colour, extension MC1R E^A substitution missense Naturally occurring variant Not currently evaluated VulVul2.2 NW_020356486.1 g.6101019T>C c.373T>C p.(C125R) XM_026005028.1; XP_025860813.1 1997 9054949
1287 OMIA:002309-9646 giant panda Cataract MIP substitution missense Naturally occurring variant Not currently evaluated c.686G>A p.(S229N) 2021 33530927
503 OMIA:000915-93934 Japanese quail Feather colour, silver MITF deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated "a two-base deletion resulting in premature termination of the polypeptide in the region following the zipper region" = 2 bp deletion in exon 11 1998 9576828
505 OMIA:000755-93934 Japanese quail Osteopetrosis MITF deletion, small (<=20) Naturally occurring variant Not currently evaluated same MITF variant as for silver, as reported in 1998 2001 11169846
385 OMIA:001401-10036 golden hamster Waardenburg syndrome, type 2A MITF substitution splicing Naturally occurring variant Not currently evaluated A T>A base substitution in intron 6 of MITF leads to the skipping of exon 7 and a premature termination. 2003 12871913
1727 OMIA:002679-8839 Mallard White Pekin (Duck (domestic)) Feather colour, white, MITF-related MITF insertion, gross (>20) Naturally occurring variant Not currently evaluated 13 intronic insertion of a 6634bp retrotransposon  2018 30018292
1205 OMIA:001680-452646 American mink Hedlund MITF h substitution splicing Naturally occurring variant Not currently evaluated MusPutFur1.0.86 c.33+1G>A GL896899.1:18635719 G/A (MITF-M C.33 + 1 G > A (Manakhov et al., 2017) 2019 30872653
409 OMIA:000214-89462 water buffalo Swamp buffalo (Buffalo) White spotting MITF substitution splicing Naturally occurring variant Not currently evaluated UOA_WB_1 21 NC_037565.1:g.31613452A>T XM_025273060.1:c.1179+2T>A Published as c.840+2T>A, coordinates in the table have been updated to reflect a recent reference genome. 2015 26417640
341 OMIA:000214-89462 water buffalo Swamp buffalo (Buffalo) White spotting MITF substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated UOA_WB_1 21 NC_037565.1:g.31637770G>A XM_025273060.1:c.649C>T XP_025128845.1:p.(R217*) Published as  c.328C>T , p.(R110*), coordinates in the table have been updated to reflect a recent reference genome.

2015 26417640
1209 OMIA:001654-8932 rock pigeon Almond MLANA st repeat variation Naturally occurring variant Not currently evaluated "The CNV captures a 77-kb segment of the reference genome (ScoHet5_227: 5,181,467–5,259,256), with an additional increase in coverage in a nested 25-kb segment (ScoHet5_227: 5,201,091–5,226,635). Read-depth analysis confirmed 7 copies of the outer 77-kb segment and 14 copies of the inner 25-kb segment in the genomes of female (ZStW) Almond pigeons, which have an St locus on only one chromosome. We used PCR to amplify across the outer and inner CNV breakpoints of Almond pigeons and determined that the CNV consists of tandem repeats of the 77-kb and nested 25-kb segments (Fig 3)." (Bruders et al., 2020) 2020 32433666
1014 OMIA:002145-9544 Rhesus monkey Colorectal cancer, MLH1-related MLH1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated 2 c.1029C<G p.(Y343*) Dray et al. (2018): "a de novo stop codon in the coding region of MLH1. This de novo stop codon occurs in exon 11 out of 19 in the MLH1 gene, and thus would produce a dramatically truncated and possibly non-functional protein". Ozirmak Lermi et al. (2022) reported the c. and p. coordinates of this variant. 2018 30108684
1013 OMIA:002145-9544 Rhesus monkey Colorectal cancer, hereditary nonpolyposis, MLH1-related MLH1 deletion, small (<=20) Naturally occurring variant Not currently evaluated 2 g.99561829_99561830del Brammer et al. (2018): "a heterozygous deletion in the putative promoter region of the MLH1 gene (rheMac2: 2:99,561,829– 99,561,830; hg19: ∼3:37,034,780; c.−258_259)" 2018 29490919
653 OMIA:001445-93934 Japanese quail Feather colour, lavender MLPH deletion, gross (>20) Naturally occurring variant Not currently evaluated a large deletion in the region of the quail MLPH gene 2002 12011184
672 OMIA:000031-452646 American mink Coat colour, silver-blue MLPH deletion, gross (>20) Naturally occurring variant Not currently evaluated deletion of exon 8 2013 23747352
1683 OMIA:000031-9669 domestic ferret Coat colour, silver MLPH deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated p.(S327Tfs*46)  an inversion of two nucleotides and a single nucleotide deletion in the 9th exon of MLPH 2023 38189891
1617 OMIA:002758-51751 ball python Skin colour, Ghost MLPH delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated c.4919_4923del p.(Q350Ilefs*15) OR035642 2023 37637270
1204 OMIA:000031-452646 American mink Silverblue MLPH p substitution splicing Naturally occurring variant Not currently evaluated MusPutFur1.0.86 g.662639G>A c.901+1G>A GL896909.1:662639 G/A (MLPH C.901 + 1 G > A) (Manakhov et al., 2019) 2019 30872653
1561 OMIA:001445-9135 common canary Feather colour, Opal / Mogno MLPH deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated NW_022042652.1 g.66493407_66493413del p.(A237fs) XP_009086443.1 2023 37194440
1560 OMIA:001445-9135 common canary Feather colour, Onyx MLPH substitution missense Naturally occurring variant Not currently evaluated NW_022042652.1 g.66497548C>T p.(R111K) XM_009088195.3; XP_009086443.1 2023 37194440
1015 OMIA:002160-9544 Rhesus monkey Colorectal cancer, hereditary nonpolyposis, MSH6-related MSH6 substitution missense Naturally occurring variant Not currently evaluated Dray et al. (2018): "a heterozygous missense mutation in MSH6 that has a CADD score of 22.8, indicating that it would be among the <1% most deleterious mutations possible in the human genome (if that variant occurred in the human MSH6 gene" 2018 30108684
519 OMIA:001342-8790 emu Mucopolysaccharidosis IIIB NAGLU deletion, small (<=20) Naturally occurring variant Not currently evaluated c.1098_1099delGG 2001 11414757
1064 OMIA:002189-8932 rock pigeon Barless NDP c not known start-lost Naturally occurring variant Not currently evaluated Cliv_1.0 Vickrey et al. (2018): "a nonsynonymous protein-coding change at the start codon of NDP". 2018 30014848
316 OMIA:000545-93934 Japanese quail Hypotrophic axonopathy NEFL substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.352C>T p.(Q114*) 1993 8468353
865 OMIA:002130-94885 corn snake Coat colour, oculocutaneous albinism, OCA2-related OCA2 insertion, gross (>20) Naturally occurring variant Not currently evaluated LTR retrotransposon in the 11th intron 2015 26597053
1602 OMIA:002130-9544 Rhesus monkey Coat colour, oculocutaneous albinism OCA2 substitution missense Naturally occurring variant Not currently evaluated c.2363C>T p.(S788L) 2020 32259106
1776 OMIA:002130-8084 green swordtail Oculocutaneous albinism, OCA2-related oca2 insertion, gross (>20) Naturally occurring variant Not currently evaluated Xiphophorus_hellerii-4.1 9 approximate 480 bp insertion in the oca2 gene which introduces a premature stop codon 2025 39896652
1715 OMIA:002871-9544 Rhesus monkey Optic atrophy OPA1 substitution missense Naturally occurring variant Not currently evaluated Mmul_10 2 NC_041755.1:g.4364931C>A XM_015132523.2:c.22G>T XP_014988009.1:p.(A8S) 2024 38969634
1740 OMIA:002889-481883 Leopard gecko Skin colour, Mack Super Snow morph PAX7 mss deletion, small (<=20) Naturally occurring variant Not currently evaluated MPM_Emac_v1.0 17 NC_072806.1:g.1828552_1828564del 13-nucleotide deletion spans the last six nucleotides of exon 4 and the first seven nucleotides of intron 4 2024 38976731
1022 OMIA:002163-9544 Rhesus monkey Cone dystrophy 4, PDE6C-related PDE6C substitution missense Naturally occurring variant Not currently evaluated Mmul_8.0.1 9 p.(R565Q) 2019 30667376
1212 OMIA:002270-8932 rock pigeon Feathered shank PITX1 deletion, gross (>20) Naturally occurring variant Not currently evaluated "a 44-kb deletion (from 6.719–6.763 Mb)" (Domyan et al., 2016) 2016 26977633
1883 OMIA:000807-9541 crab-eating macaque Polycystic kidney disease PKD1 substitution missense Naturally occurring variant Not currently evaluated XM_015442355.1:c.1144G>C p.(E382Q) 2023 36876010
1671 OMIA:001701-60466 yellow-collared lovebird Feather colour, blue PKS substitution missense Naturally occurring variant Not currently evaluated c.1930C>T p.(R644W) 2024 38528953
1670 OMIA:001701-60463 Fischer's lovebird Feather colour, blue PKS substitution missense Naturally occurring variant Not currently evaluated c.1930C>T p.(R644W) 2024 38528953
1863 OMIA:001701-9228 Rose-ringed parakeet Feather colour, blue PKS substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.2005G>T p.(E668*) 2025 39820005
1865 OMIA:001701-232655 Alexandrine parakeet Feather colour, blue PKS substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.2647A>T p.(K883*) 2025 39820005
1864 OMIA:001701-9228 Rose-ringed parakeet Feather colour, blue PKS substitution missense Naturally occurring variant Not currently evaluated c.334G>A p.(G112R) 2025 39820005
1867 OMIA:001701-176024 Eclectus parrot Feather colour, blue PKS substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.5869C>T p.(H1957*) 2025 39820005
1866 OMIA:001701-232655 Alexandrine parakeet Feather colour, blue PKS substitution missense Naturally occurring variant Not currently evaluated c.727G>A p.(R243K) 2025 39820005
1868 OMIA:001701-176039 galah Feather colour, blue PKS haplotype missense Naturally occurring variant Not currently evaluated c.[1284T>C;2374A.G] p.[(N428K;T792A)] 2025 39820005
540 OMIA:001545-30521 domestic yak Coat colour, dilution PMEL deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated c.50_52del p.(L18del) 2014 24989079
1071 OMIA:002191-93934 Japanese quail Yellowish plumage PMEL substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated g.811370G>A p.(W149*) Ishishita et al. (2018): g.811370G>A (NC_029544.1); Trp149* 2018 30425278
1736 OMIA:002884-94885 corn snake Skin colour, Terrazzo PMEL tz haplotype splicing Naturally occurring variant Not currently evaluated UNIGE_PanGut_3.0 NW_023010713:g.[13272041A>T;13272043G>C] XM_034412587.1:c.[1594C>G;1594+2T>A] "a multi-nucleotide polymorphism, from ACG to TCC (Super-scaffold 85; position 13,272,041) falls at the end of exon 8 (one nucleotide – A to T) and on the donor site of intron 8 of the Premelanosome Protein (PMEL) gene (two nucleotides – CG to CC)" 2024 39227572
845 OMIA:000483-30521 domestic yak Polled, Mongolian allele POLLED P[sub]M or P[sub]219ID complex rearrangement Naturally occurring variant Not currently evaluated "a complex 219-bp duplication-insertion (P219ID) beginning at 1,976,128 bp and a 7-bp deletion and 6-bp insertion (P1ID) located 621 bp upstream of this position . . . . This rearrangement results in duplication of an 11-bp motif (5'-AAAGAAGCAAA-3') that is entirely conserved among Bovidae . . . and that is also duplicated in the 80-kb duplication responsible for Friesian polledness" 2017 28135247
977 OMIA:000380-9103 turkey Feathering, Z-linked PRLR deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Turkey_5.1 Z g.9426018_9426022delTTGGT p.(E726Dfs*7) 2018 29566646
1507 OMIA:000944-447135 Bank vole Susceptibility to atypical scrapie PRNP not known missense Naturally occurring variant Not currently evaluated p.(M109I) 2022 35731839
1256 OMIA:002292-452646 American mink Moyle coat colour RAB38 deletion, small (<=20) Naturally occurring variant Not currently evaluated NNQGG.v01 1 g.16075438_16075453del c.574-589del "We identified a homozygous 16-bp deletion [FNWR01000007.1:16075438–16075453del (RAB38:c.574-589del)], hereinafter referred to as RAB383del, in the Moyle sample, at the third exon of RAB38 gene. We found a homozygous 2-bp duplication NWR01000007.1:16132224_16132225dupCT (RAB38:c.20-21dup)], hereinafter referred to as RAB381dup, in the Violet sample, at the first exon of the RAB38 gene. Both mutations potentially resulted in the loss of function of RAB38 protein" (Manakhov et al., 2020) 2020 32985525
1257 OMIA:002292-452646 American mink Moyle coat colour RAB38 duplication Naturally occurring variant Not currently evaluated NNQGG.v01 1 g.16132224_16132225dupCT c.20-21dup "We identified a homozygous 16-bp deletion [FNWR01000007.1:16075438–16075453del (RAB38:c.574-589del)], hereinafter referred to as RAB383del, in the Moyle sample, at the third exon of RAB38 gene. We found a homozygous 2-bp duplication NWR01000007.1:16132224_16132225dupCT (RAB38:c.20-21dup)], hereinafter referred to as RAB381dup, in the Violet sample, at the first exon of the RAB38 gene. Both mutations potentially resulted in the loss of function of RAB38 protein" (Manakhov et al., 2020) 2020 32985525
1621 OMIA:002763-9541 crab-eating macaque Severe combined immunodeficiency disease RAG1 substitution nonsense (stop-gain) Base-editing Not currently evaluated Macaca_fascicularis_5.0 14 g.30840789G>T c.181C>T p.(Q61*) XM_005578172.2; XP_005578229.1 2023 37661226
1099 OMIA:002209-7950 Atlantic herring Adaptation to a red-shifted light environment rho substitution missense Naturally occurring variant Not currently evaluated p.(F261Y) 2019 31451650
1796 OMIA:002945-8128 Nile tilapia Hypogonadism rln3b deletion, gross (>20) Genome-editing (CRISPR-Cas9) Not currently evaluated >500 bp deletion 2024 38729472
1558 OMIA:001252-9135 common canary Feather colour, recessive white SCARB1 substitution splicing Naturally occurring variant Not currently evaluated NW_022042652.1 g.27474120A>C Variant in located in the splice-donor site immediately downstream of exon 4 and results in transcript isoforms. Genomic coordinates as listed by Bovo et al., 2023, PMID:37194440. 2017 28465440
1427 OMIA:002531-74940 Chinook salmon XY female sdY substitution missense Naturally occurring variant Not currently evaluated p.(I183N) 2022 35100376
651 OMIA:000162-10036 golden hamster Cardiomyopathy, dilated SGCD deletion, gross (>20) Naturally occurring variant Not currently evaluated genomic deletion was found to be located at 6.1 kb 5' upstream of the second exon of δ-SG gene, and its 5' upstream region of more than 27.4 kb, including the authentic first exon of δ-SG gene, was deleted 1997 9391120
652 OMIA:002211-10036 golden hamster Cardiomyopathy, hypertrophic SGCD deletion, gross (>20) Naturally occurring variant Not currently evaluated a large deletion in the delta-SG gene 1997 9097966
1298 OMIA:002416-8932 rock pigeon Pearl-eye SLC2A11B tr substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated AKCR02000030.1 g.1895934G>A p.(W49X) Andrade et al. (2021): "This mutation creates a premature STOP codon in exon 3 of the likely canonical SLC2A11B transcript." 2021 33621224
386 OMIA:000370-93934 Japanese quail Feather colour, albinism, sex-linked, imperfect SLC45A2 substitution splicing Naturally occurring variant Not currently evaluated a splice-site mutation in the SLC45A2 gene: "a G>T transversion at the splice acceptor site just preceding exon 4" 2007 17151254
746 OMIA:001821-8090 Japanese medaka Coat colour, albinism, oculocutaneous type IV slc45a2 complex rearrangement Naturally occurring variant Not currently evaluated an inversion of 167 bp, an insertion of 48 bp, and a deletion of 172 bp 2008 18245373
1641 OMIA:000370-232655 Alexandrine parakeet Feather colour, yellow SLC45A2 substitution missense Naturally occurring variant Not currently evaluated c.1195G>A p.(G399R) 2024 37943814
1643 OMIA:000370-9228 Rose-ringed parakeet Feather colour, yellow or white SLC45A2 substitution missense Naturally occurring variant Not currently evaluated c.1195G>A p.(G399R) 2024 37943814
1644 OMIA:000370-9228 Rose-ringed parakeet Feather colour, yellow or white SLC45A2 substitution missense Naturally occurring variant Not currently evaluated c.1400G>T p.(G467V) 2024 37943814
1642 OMIA:000370-9228 Rose-ringed parakeet Feather colour, yellow SLC45A2 substitution missense Naturally occurring variant Not currently evaluated c.158C>T p.(P53L) 2024 37943814
259 OMIA:000370-93934 Japanese quail Feather colour, cinnamon SLC45A2 substitution missense Naturally occurring variant Not currently evaluated c.287C>A p.(A72D) 2007 17151254
1530 OMIA:002628-215402 northern snakehead Skin colour, yellow SLC45A2 YM substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated 19 c.383G>A p.(W128*) 2023 36789536
1640 OMIA:000370-232655 Alexandrine parakeet Feather colour, yellow SLC45A2 substitution missense Naturally occurring variant Not currently evaluated c.539T>C p.(L180P) 2024 37943814
1639 OMIA:000370-232645 Plum-headed parakeet Feather colour, yellow SLC45A2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.73G>T p.(R25*) 2024 37943814
254 OMIA:000213-74535 Bengal tiger Coat colour, white SLC45A2 substitution missense Naturally occurring variant Not currently evaluated C>T p.(A477V) 2013 23707431
1855 OMIA:001821-9793 ass (donkey) Coat colour, cream dilution SLC45A2 substitution missense Naturally occurring variant Not currently evaluated EquAss-T2T_v2 10 NC_091799.1:g.81796057C>T XM_014831209.3:c.1601C>T XP_014686695.1:p.(A534V) published as c.1457C>T, p.A486V 2025 41314234
861 OMIA:001821-9593 western gorilla Coat colour, albinism, oculocutaneous type IV SLC45A2 substitution missense Naturally occurring variant Not currently evaluated gorGor3.1 17 g.59753498G>C c.1552G>C p.(G518R) 2013 23721540 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1537 OMIA:002651-499056 Asian vine snakes Skin colour, yellow SMARCE1 substitution missense Naturally occurring variant Not currently evaluated 4 g.43233281C>T c.58C>T p.(P20S) 2023 36895044
1065 OMIA:002190-8932 rock pigeon Recessive red SOX10 e^1 deletion, gross (>20) Naturally occurring variant Not currently evaluated Domyan et al. (2014) reported a 7.5kb deletion that spans "a conserved enhancer element that drives Sox10 expression in melanocytes" 2014 24508169
1066 OMIA:002190-8932 rock pigeon Recessive red SOX10 e^2 deletion, gross (>20) Naturally occurring variant Not currently evaluated Domyan et al. (2014) reported a 2.5kb deletion that spans "a conserved enhancer element that drives Sox10 expression in melanocytes" 2014 24508169
1438 OMIA:002537-9541 crab-eating macaque Encephalopathy, STXBP1-related STXBP1 substitution missense Base-editing Not currently evaluated Macaca_fascicularis5.0 15 g.101106196C>T c.875G>A p.(R292H) XM_005582167.2; XP_005582224.1 2022 35283272
670 OMIA:001617-9694 tiger Sweet taste, lack TAS1R2 reference sequence allele Naturally occurring variant Not currently evaluated "a 247-base pair microdeletion in exon 3 and stop codons in exons 4 and 6" 2005 16103917
668 OMIA:001617-32536 cheetah Sweet taste, lack TAS1R2 reference sequence allele Naturally occurring variant Not currently evaluated "a 247-base pair microdeletion in exon 3 and stop codons in exons 4 and 6" 2005 16103917
1122 OMIA:002213-9447 Ring-tailed lemur Bitter taste TAS2R16 substitution missense Naturally occurring variant Not currently evaluated p.(S282L) 2019 31161904
1620 OMIA:000240-8839 Mallard Crest cushion TAS2R40 substitution regulatory Naturally occurring variant Not currently evaluated 1 published as variant in the 5′UTR of TAS2R40 (123272114_c. G78A) 2023 37652165
1277 OMIA:001972-9793 ass (donkey) Coat colour, dun TBX3 D insertion, small (<=20) Naturally occurring variant Not currently evaluated ASM1607732v2 8 NC_052184.1:42737976_42737977insT Wang et al. (2020) report 'non-dun' as a "1 bp deletion (chr8:g.42742556 CT>C−) located ~18.6 kb downstream of the transcription start site of the TBX3 gene." The reference genome ASM1607732v2 represents the non-dun allele and information has been changed in the table to report the coordinates for the dun allele [05/06/2024]

     


 
2020 33293529
1619 OMIA:002761-51751 ball python Skin colour, piebald TFEC substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.493C>T p.(R165*) Coordinates based on a Python bivittatus assembly 2023 36702128
397 OMIA:000162-9103 turkey Cardiomyopathy, dilated TNNT2 deletion, small (<=20) splicing Naturally occurring variant Not currently evaluated delGGGCTCCTC 2002 11886865
1538 OMIA:001472-9541 crab-eating macaque Neuronal ceroid lipofuscinosis, 2 TPP1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated c.42delC p.(L15Sfs*33) 2023 36918063
1682 OMIA:002841-30538 alpaca Suri (Alpaca) Fleece variation, Suri type TRPV3 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated VicPac3.2 16 NW_021964189.1:g.4265902G>T XM_031685167.1:c.1423G>T XP_031541027.1:p.(E475*) 2024 38365607
1829 OMIA:000202-1960652 red-necked wallaby Albinism, oculocutaneous TYR insertion, gross (>20) Naturally occurring variant Not currently evaluated 2022 35030050
723 OMIA:000202-8090 Japanese medaka Skin colour, albinism tyr i1 insertion, gross (>20) Naturally occurring variant Not currently evaluated a 1.9 kb fragment, corresponding to a novel transposable element (Tol1), has been inserted in exon 1 of the gene for tyrosinase 1995 8552044
1554 OMIA:000202-8090 Japanese medaka Skin colour, albino (quasi-albino) tyr i4 insertion, gross (>20) Naturally occurring variant Not currently evaluated a 4.7-kb insertion in exon 5 (Tol2-tyr) 1996 8779712
1555 OMIA:000202-8090 Japanese medaka Skin colour, albino (weak) tyr i(b) insertion, gross (>20) Naturally occurring variant Not currently evaluated a 4.7-kb insertion in the 5' untranslated region (Tol2) 2004 15016305
1027 OMIA:000202-9773 humpback whale Migaloo, the white whale TYR deletion, small (<=20) Naturally occurring variant Not currently evaluated "(264 del C) at codon 88" 2012 22140253
666 OMIA:000202-9669 domestic ferret Coat colour, albinism TYR deletion, gross (>20) Naturally occurring variant Not currently evaluated "deletion of exon 4" 2007 17655555
1746 OMIA:000202-8296 axolotl Skin colour, albino TYR deletion, gross (>20) frameshift Naturally occurring variant Not currently evaluated Linkage group 7 "a 142 bp deletion of tyr a coding sequence at the end of exon 1 (extending ~3 kb in to intron 1) that results in a frame-shift and premature stop codon" (Woodcock et al., 2017) 2017 28127056
1304 OMIA:000202-3370412 Japanese raccoon dog Albinism TYR complex rearrangement Naturally occurring variant Not currently evaluated Mae et al. (2020): "the third exon was removed due to a deletion ... :two separate regions of 3.8 kb and 7.3 kb had been removed, but a segment of 0.3 kb between these two regions was retained, though was present in the reverse orientation." 2020 32783776
1162 OMIA:000202-9557 hamadryas baboon Siamese coat colour pattern TYR substitution missense Naturally occurring variant Not currently evaluated p.(A365T) ENSPANT00000015629.2:c.1093G>A; A0A096MRE4:p.(Ala365Thr) [Koga et al., 2020] 2020 32053406
813 OMIA:000202-8410 Japanese wrinkled frog Albinism TYR substitution missense Naturally occurring variant Not currently evaluated c.1127G>A p.(G376D) 2018 28674275
814 OMIA:000202-8409 dark-spotted frog Albinism TYR insertion, small (<=20) Naturally occurring variant Not currently evaluated c.1244_1245insT 2018 28674275
332 OMIA:000202-452646 American mink Albinism TYR substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.138T>A p.(C46*) 2008 18822100
812 OMIA:000202-1772025 Rice frog Albinism TYR substitution missense Naturally occurring variant Not currently evaluated c.169G>A p.(G57R) 2018 28674275
260 OMIA:000202-452646 American mink Himalayan TYR substitution missense Naturally occurring variant Not currently evaluated c.1835C>G p.(H420Q) 2009 19308642
1011 OMIA:000202-9689 lion White lion TYR substitution missense Naturally occurring variant Not currently evaluated c.260G>A p.(R87Q) 2013 24045858
1600 OMIA:000202-9544 Rhesus monkey Coat colour, oculocutaneous albinism TYR substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated 14 c.552C>A p.(S184*) 2000 10751629
355 OMIA:000202-9515 Tufted capuchin Coat colour, albinism TYR substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.64C>T p.(R22*) 2017 28476152
816 OMIA:000202-8409 dark-spotted frog Albinism TYR deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated c.682_684del p.(L228del) 2018 28674275
1004 OMIA:000202-10141 domestic guinea pig Coat colour, albinism Tyr substitution missense Naturally occurring variant Not currently evaluated c.710A>G p.(D237G) PRJEB26285 2018 29947431
1599 OMIA:000202-9544 Rhesus monkey Coat colour, golden TYR substitution missense Naturally occurring variant Not currently evaluated 14 c.768C>G p.(H256Q) 2023 37522525
815 OMIA:000202-8409 dark-spotted frog Albinism TYR insertion, small (<=20) Naturally occurring variant Not currently evaluated c.768_769insT 2018 28674275
1303 OMIA:000202-31143 Japanese ratsnake Coat colour, oculocutaneous albinism TYR albino - pet trade substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.895C>T p.(R299X) 2018 30158334
1601 OMIA:000202-9544 Rhesus monkey Coat colour, oculocutaneous albinism TYR substitution missense Naturally occurring variant Not currently evaluated 14 c.934C>A p.(L312I) 2020 32259106
1594 OMIA:000202-9901 American bison Oculocutaneous albinism type I (OCA1), TYR-related TYR substitution missense Naturally occurring variant Not currently evaluated 29 g.7995584C>T c.1114C>T p.(G372R) 2023 37481261
1789 OMIA:000369-311895 green‐cheeked parakeet Feather colour, non-sex-linked lutino TYR substitution missense Naturally occurring variant Not currently evaluated ASM1176335v2 (GCA_011763355.2) c.1111C>T p.(H371Y) 2025 40195888
151 OMIA:000202-9793 ass (donkey) Coat colour, albinism TYR substitution missense Naturally occurring variant Not currently evaluated ASM1607732v2 20 NC_052196.1:58132615G>C XM_014827959.2:c.616C>G XP_014683445.2:p.(H206D) Published as c.604C>G, p.(H202D) - coordinates in the table were updated to reflect the recent reference genome




2016 26763160
1788 OMIA:000369-60463 Fischer's lovebird Feather colour, non-sex-linked lutino TYR delins, small (<=20) missense Naturally occurring variant Not currently evaluated ASM3478289v1 (GCA_034782895.1) c.736‐737TG>CT p.(W246L) 2025 40195888
1159 OMIA:000202-9860 red deer White TYR substitution missense Naturally occurring variant Not currently evaluated CerEla 1.0 2 c.871G>A p.(G291R) 2020 32041521
1748 OMIA:000369-9135 common canary Feather colour, pearl TYR substitution missense Naturally occurring variant Not currently evaluated serCan2020 1 NC_066313.1:g.34568603C>A XM_009102738.4:c.134C>A XP_009100986.1:p.(P45H) 2024 39377483
329 OMIA:000202-89462 water buffalo Murrah (Buffalo) Albinism TYR substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated UOA_WB_1 5 NC_037549.1:g.82063942C>T XM_006075179.2:c.1431G>A XP_006075241.1:p.(W477*) 2012 22817390
1118 OMIA:000202-9627 red fox Albinism TYR insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated VulVul2.2 NW_020356544.1 g.7130732dup c.365dup p.(N122Kfs4*) XM_026015193.1; XP_025870978.1; published as c.365dupA 2019 31246286
1255 OMIA:001249-452646 American mink American Palomino coat colour TYRP1 b^p insertion, gross (>20) Naturally occurring variant Not currently evaluated "a large insertion of approximately eight kb. The insertion most likely disrupts different elements necessary for the splicing of intron 2 of the TYRP1 gene" (Cicera et al., 2016) 2016 26886941
1597 OMIA:001249-9544 Rhesus monkey Coat colour, golden TYRP1 substitution missense Naturally occurring variant Not currently evaluated 15 c.1028A>G p.(N343G) 2023 37522525
1598 OMIA:001249-9544 Rhesus monkey Coat colour, golden TYRP1 substitution missense Naturally occurring variant Not currently evaluated 15 c.1244T>C p.(L415P) 2023 37522525
753 OMIA:002061-345164 Saker falcon Feather colour, light brown TYRP1 haplotype splicing Naturally occurring variant Not currently evaluated c.79C>T and c.79_80insT in exon 1, resulting in "a frameshift change and a premature stop codon at position 81 of the deduced protein sequence, which in the wild-type form contains 536 amino acids. 2017 27611661
258 OMIA:001322-93934 Japanese quail Feather colour, roux TYRP1 substitution missense Naturally occurring variant Not currently evaluated c.845T>C p.(F282S) 2007 18028514
1713 OMIA:001249-9691 leopard Coat colour, red TYRP1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated XM_019415513:c.369del XP_019271058:p.(G63Afs*6) 2022 35782007
1745 OMIA:002817-8296 axolotl Skin colour, copper TYRP1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated 6p g.1225541490del c.1156del p.(G388Efs*28) 2024 39333770
1518 OMIA:001249-9643 American black bear Cinnamon coat colour TYRP1 substitution missense Naturally occurring variant Not currently evaluated HiC_scaffold_24 g.6724152G>A p.(R153C) 2023 36528024
1791 OMIA:001259-9228 Rose-ringed parakeet Feather colour, cinnamon TYRP1 substitution missense Naturally occurring variant Not currently evaluated P.krameri1.0 c.691G>A p.(E231K) 2025 40195888
1790 OMIA:001259-9228 Rose-ringed parakeet Feather colour, cinnamon TYRP1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated P.krameri1.0 c.86_95del p.(C29fs*64) 2025 40195888

* Variant pathogenicity for single-gene diseases as evaluated according to the Animal Variant Classification Guidelines (AVCG) by the Variant Pathogenicity Working Group of the International Society of Animal Genetics (ISAG) Animal Genetic Testing Standardization (AGTS) Standing Committee: P = pathogenic, LP = likely pathogenic, VUS = variant of unknown significance, LB = likely benign, B = benign. For more information (including details on the classification of each variant) see LINKS.

Overall Statistics
Total number of variants 275
Variants with genomic location 73 (26.5% )
Variants in a variant database, i.e. with rs ID 2 (0.7%)
Variant Type Count Percent
complex rearrangement 3 1.1%
deletion, gross (>20) 22 8.0%
deletion, small (<=20) 41 14.9%
delins, gross (>20) 1 0.4%
delins, small (<=20) 3 1.1%
duplication 4 1.5%
haplotype 15 5.5%
insertion, gross (>20) 15 5.5%
insertion, small (<=20) 8 2.9%
inversion 1 0.4%
not known 5 1.8%
reference sequence allele 2 0.7%
repeat variation 1 0.4%
substitution 153 55.6%
unknown 1 0.4%
Variant Effect Count Percent
deletion (in-frame) 5 1.8%
frameshift 30 10.9%
missense 110 40.0%
nonsense (stop-gain) 38 13.8%
regulatory 5 1.8%
splicing 18 6.5%
start-lost 2 0.7%
synonymous 1 0.4%
unknown 66 24.0%
Year First Reported Count Percent
1990 1 0.4%
1991 0 0.0%
1992 1 0.4%
1993 1 0.4%
1994 0 0.0%
1995 1 0.4%
1996 1 0.4%
1997 5 1.8%
1998 5 1.8%
1999 2 0.7%
2000 2 0.7%
2001 3 1.1%
2002 6 2.2%
2003 1 0.4%
2004 2 0.7%
2005 3 1.1%
2006 2 0.7%
2007 6 2.2%
2008 5 1.8%
2009 9 3.3%
2010 3 1.1%
2011 1 0.4%
2012 6 2.2%
2013 8 2.9%
2014 10 3.6%
2015 12 4.4%
2016 6 2.2%
2017 14 5.1%
2018 23 8.4%
2019 10 3.6%
2020 19 6.9%
2021 8 2.9%
2022 9 3.3%
2023 33 12.0%
2024 32 11.6%
2025 24 8.7%
2026 1 0.4%