Search Results
Advanced search
Link to this search: https://omia.org/results/?search_type=advanced&exclude_gb_species_id=9615%2C9913%2C9685%2C9823%2C9940%2C9796%2C9031%2C9986%2C9925&result_type=variant&singlelocus=yes&characterised=yes
275 variant records found |
[show instead phene records] |
By default, variants are sorted chronologically by year of publication, to provide a historical perspective.
Readers can re-sort on any column by clicking on the column header. Click it again to sort in a descending
order. To create a multiple-field sort, hold down Shift while clicking on the second, third etc relevant column
headers.
WARNING! Inclusion of a variant in this table does not automatically mean that it should be used for DNA testing. Anyone contemplating the use of any of these variants for DNA testing should examine critically the relevant evidence (especially in breeds other than the breed in which the variant was first described). If it is decided to proceed, the location and orientation of the variant sequence should be checked very carefully.
Since October 2021, OMIA includes a semiautomated lift-over pipeline to facilitate updates of genomic positions to a recent reference genome position. These changes to genomic positions are not always reflected in the ‘acknowledgements’ or ‘verbal description’ fields in this table.
| OMIA Variant ID | OMIA Phene-Species ID(s) | Species Name | Breed(s) | Variant Phenotype | Gene | Allele | Variant Type | Variant Effect | Source of Genetic Variant | AVCG Pathogenicity Classification* | Reference Sequence | Chr. | g. or m. | c. or n. | p. | Verbal Description | EVA ID | Year Published | PubMed ID(s) | Acknowledgements |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1499 | OMIA:002589-8839 | Mallard | Blue eggshell | ABCG2 | haplotype | regulatory | Naturally occurring variant | Not currently evaluated | BGI_duck1.0 | NW_004676534.1 | g.[3573054A>G;3573085A>G] | The BGI_duck1.0 reference genome represents the blue eggshell genotype. | 2020 | 33186356 | ||||||
| 1177 | OMIA:001089-9542 | Japanese macaque | Antigen B | ABO | haplotype | Naturally occurring variant | Not currently evaluated | Allele B reflects the peptide haplotype p.266Met + p.268Ala | 2000 | 10984838 | ||||||||||
| 21 | OMIA:001089-9544 | Rhesus monkey | Antigen A | ABO | haplotype | Naturally occurring variant | Not currently evaluated | p.266L + p.268G | Allele A is reflected in the peptide haplotype p.266Leu + p.268Gly | 1998 | 9583803 | |||||||||
| 20 | OMIA:001089-9541 | crab-eating macaque | A antigen | ABO | haplotype | Naturally occurring variant | Not currently evaluated | p.266L + p.268G | Allele A is reflected in the peptide haplotype p.266Leu + p.268Gly | 1998 | 9583803 | |||||||||
| 1174 | OMIA:001089-9544 | Rhesus monkey | Antigen B | ABO | haplotype | Naturally occurring variant | Not currently evaluated | p.266M + p.268A | Allele B is a reflection of the peptide haplotype p.266Met + p.268Ala | 1998 | 9583803 | |||||||||
| 1175 | OMIA:001089-9541 | crab-eating macaque | B antigen | ABO | haplotype | Naturally occurring variant | Not currently evaluated | p.266M + p.268A | Allele B is a reflection of the peptide haplotype p.266Met + p.268Ala | 1998 | 9583803 | |||||||||
| 22 | OMIA:001089-9579 | agile gibbon | Alleles A and B | ABO | haplotype | missense | Naturally occurring variant | Not currently evaluated | c.2178C>A and c.2185G>C | Haplotype c.2178C + c.2185G is allele A; haplotype c.2178A + c.2185C is allele B | 2009 | 19298858 | ||||||||
| 23 | OMIA:001089-9580 | common gibbon | Blood group system ABO | ABO | haplotype | missense | Naturally occurring variant | Not currently evaluated | c.2178C>A and c.2185G>C | 2009 | 19298858 | |||||||||
| 532 | OMIA:001089-9598 | chimpanzee | O (lack of antigen) | ABO | O^del | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | c.514_522delGTGCTGGAG | p.(V172-E174del) | 1999 | 10380696 | |||||||
| 24 | OMIA:001089-9598 | chimpanzee | O (lack of antigen) | ABO | O^x | substitution | missense | Naturally occurring variant | Not currently evaluated | c.791A>C | p.(Y264C) | 1999 | 10380696 | |||||||
| 1060 | OMIA:001271-9915 | indicine cattle (zebu) | Miniature Zebu, United Kingdom of Great Britain and Northern Ireland (Cattle) | Bulldog calf | ACAN | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 21 | g.20428539_20428540insC | c.5688_5689insC | p.(V1897fs*9) | cDNA position based on transcript NM_173981.2 | 2018 | 30305023 | |||
| 1801 | OMIA:002956-176072 | dusky lory | Feather colour, red | ALDH3A2 | substitution | regulatory | Naturally occurring variant | Not currently evaluated | scaffold_13:6288712T>C | 2024 | 39480920 | |||||||||
| 1075 | OMIA:001602-93934 | Japanese quail | Feather colour, fawn-2/beige | ASIP | Y^f2 | duplication | Naturally occurring variant | Not currently evaluated | 20 | Robic et al. (2019) concluded "that fawn-2 and beige are the same allele, and that it is caused by a 70,895-bp tandem duplication . . . [with breakpoints] (NC-029535 [1,371,395(or 98)–1,442,295 (or 98)]) . . . located downstream of the ITCH exon 1 and upstream of the ASIP exon e4 (5′ UTR). . . . The 70,895 bp of the duplicated region include the entire AHCY gene on one strand, and parts of the ASIP and ITCH genes on the other strand." | 2019 | 30987584 | ||||||||
| 665 | OMIA:000201-10042 | North American deer mouse | New Hampshire (Chicken) | Melanic (non-agouti) | ASIP | deletion, gross (>20) | regulatory | Naturally occurring variant | Not currently evaluated | "a 125-kb deletion, which includes the upstream regulatory region and exons 1 and 2 of Agouti, results in a loss of Agouti expression" | 2009 | 19649329 | ||||||||
| 1321 | OMIA:002200-9915 | indicine cattle (zebu) | Brahman (Cattle) Nellore, India (Sheep) | Darkness of hair coat | ASIP | delins, gross (>20) | Naturally occurring variant | Not currently evaluated | 13 | 1155-bp deletion followed by an insertion of a transposable element of more than 150 bp that may impact the recruitment of ASIP non-coding exons (Trigo et al.2021) | 2021 | 33910501 | ||||||||
| 251 | OMIA:000201-61386 | Kodkod | Melanism (black coat) | ASIP | substitution | missense | Naturally occurring variant | Not currently evaluated | p.(C126Y) | 2015 | 25695801 | |||||||||
| 252 | OMIA:000201-3055696 | Colocolo | Melanism (black coat) | ASIP | substitution | missense | Naturally occurring variant | Not currently evaluated | p.(R120C) | 2015 | 25695801 | |||||||||
| 1119 | OMIA:000201-10141 | domestic guinea pig | Recessive black | Asip | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | c.181_184delTTCA | MH026115: c.181_184delTTCA; the deletion leads to a truncated protein of 77 amino acids due to the premature stop codon. | 2019 | 30746725 | ||||||||
| 330 | OMIA:000201-10042 | North American deer mouse | Alaska, United States of America (North American deer mouse) | Melanic (non-agouti) | ASIP | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.193?>? | p.(Q65*) | 2009 | 19649329 | |||||||
| 333 | OMIA:000201-9691 | leopard | Coat colour, black (black panther) | ASIP | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.333C>A | p.(C111*) | 2012 | 23251368 | ||||||||
| 1219 | OMIA:000201-9858 | Western roe deer | Melanistic (black) | ASIP | substitution | missense | Naturally occurring variant | Not currently evaluated | c.33G>T | p.(L11F) | 2020 | 32545389 | ||||||||
| 1587 | OMIA:000201-9691 | leopard | Coat colour, black (black panther) | ASIP | substitution | missense | Naturally occurring variant | Not currently evaluated | c.353C>A | p.(C113F) | 2023 | 37440497 | ||||||||
| 1666 | OMIA:000201-10007 | tassel-eared squirrel | Coat colour, black | ASIP | substitution | missense | Naturally occurring variant | Not currently evaluated | c.370T>C | p.(C124R) | 2024 | 38396615 | ||||||||
| 504 | OMIA:001602-93934 | Japanese quail | Feather colour, recessive black | ASIP | rb | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | 20 | c.373_380del | "A deletion of 8 bases was found in the ASIP gene" | 2008 | 18287406 | ||||||
| 253 | OMIA:000201-61455 | Asiatic golden cat | Black | ASIP | substitution | missense | Naturally occurring variant | Not currently evaluated | c.384C>G | p.(C128W) | 2012 | 23251368 | ||||||||
| 1010 | OMIA:000201-9838 | Arabian camel | Black and dark-brown coat colour | ASIP | haplotype | Naturally occurring variant | Not currently evaluated | c.[23delT;c.25G>A] | KU179868; c.[23delT;c.25G>A]. As described by Almathen et al. (2018), this haplotype comprises "a 1-bp deletion (23delT/T) and a SNP (25G/A) in exon 2 of ASIP". | 2018 | 29893870 | |||||||||
| 654 | OMIA:001602-93934 | Japanese quail | Feather colour, lethal yellow | ASIP | Y | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 20 | g.1463709_1604872del | Nadeau et al. (2008): "a >90-kb [141162bp] deletion upstream of ASIP" | 2008 | 18287407 | The g. coordinates were provided by Robic et al. (2019) | ||||||
| 149 | OMIA:000201-9793 | ass (donkey) | Âne de Provence, France (Ass) Âne normand, France (Ass) Dezhou, China (Ass) Miniature, United States of America (Ass) | No light points | ASIP | NLP | substitution | missense | Naturally occurring variant | Not currently evaluated | ASM1607732v2 | 15 | NC_052191.1:g.25406489T>C | XM_044748287.1:c.349T>C | XP_044604222.1:p.(C117R) | The Dezhou reference genome ASM1607732v2 represents the 'no light points' variant: NC_052191.1:g.25406489C |
2015 | 25887951 | ||
| 1847 | OMIA:000201-9279 | southeastern quoll | Coat colour, melanistic | ASIP | deletion, gross (>20) | start-lost | Naturally occurring variant | Not currently evaluated | DasViv_v1.0 | 2 | 4.7 kb deletion encompassing the first two coding exons | 2025 | 41119986 | |||||||
| 1734 | OMIA:000201-30532 | fallow deer | Coat colour, black | ASIP | substitution | splicing | Naturally occurring variant | Not currently evaluated | GCF_033118175.1 | 23 | NC_083703.1:g.63827550G>A | XM_061127099.1:c.225+1G>A | 2024 | 39202415 | ||||||
| 1735 | OMIA:000201-30532 | fallow deer | Coat colour, black | ASIP | duplication | Naturally occurring variant | Not currently evaluated | GCF_033118175.1 | 23 | NC_083703.1:g.63830157_63830161dup | 2024 | 39202415 | ||||||||
| 1708 | OMIA:000201-9337 | common brushtail possum | Coat colour, non-agouti (black) | ASIP | substitution | missense | Naturally occurring variant | Not currently evaluated | mTriVul1.pri | 3 | NC_050575.1:g.100483705C>T | XM_036748710.1:c.343C>T | XP_036604605.1:p.(R115C) | 2024 | 39086822 | |||||
| 667 | OMIA:000201-9627 | red fox | Dark Standard Silver | ASIP | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | VulVul2.2 | NW_020356514.1 | A 16.5-kb deletion resulting in "a 166-nt deletion in the Standard Silver fox cDNA, spanning the second exon ... .This deletion removes the start codon and entire signal peptide" | 1997 | 9054949 | ||||||||
| 1076 | OMIA:001645-10036 | golden hamster | Black tremor | Atrn | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | Kuramoto et al. (2002): "an approximately 10-kb DNA fragment, which had 557-bp direct repeats in both ends and was flanked by the identical 6-bp target duplication sequences, [that] was inserted into exon 24" | 2002 | 11773967 | ||||||||||
| 1676 | OMIA:002837-9646 | giant panda | Coat colour, brown white | BACE2 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 1 | c.176_200del | Published as c.176_200delTCGCCCTGGAGCCCGCCGGCGGCGC; g.4545815_4545839del | 2024 | 38437540 | ||||||||
| 1131 | OMIA:002216-9544 | Rhesus monkey | Bardet-Biedl syndrome 7 | BBS7 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Mmul_8.0.1 | c.160delG | p.(A54fs) | 2019 | 31589838 | |||||||
| 1375 | OMIA:002466-48883 OMIA:002466-48882 OMIA:002466-87173 OMIA:002466-48884 OMIA:002466-48885 OMIA:002466-48886 OMIA:002466-1553461 | medium ground-finch | Beak colour, yellow | BCO2 | substitution | synonymous | Naturally occurring variant | Not currently evaluated | 24 | g.6166878G>A | p.(V?V) | synonymous change 32 bp into exon 4 | 2021 | 34687609 | ||||||
| 1559 | OMIA:002466-9135 | common canary | Beak and leg colour, red | BCO2 | substitution | missense | Naturally occurring variant | Not currently evaluated | NW_022042652.1 | g.75258192G>A | p.R413H | 2020 | 31930402 | XP_009096268.1, genomic position as reported by Bovo et al. (2023) PMID:37194440 | ||||||
| 1490 | OMIA:002573-151761 | yellow-crowned parrot | Lewy body-like disease | CADPS2 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.1675G>C | p.(V559L) | 2022 | 36086934 | ||||||||
| 516 | OMIA:001416-9612 | gray wolf | Coat colour, dominant black | CBD103 | K^B | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | 3bp deletion of the CBD103 gene | 2009 | 19197024 | |||||||||
| 520 | OMIA:001416-9614 | coyote | Coat colour, dominant black | CBD103 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | 3bp deletion of the CBD103 gene | 2009 | 19197024 | ||||||||||
| 1340 | OMIA:002386-9544 | Rhesus monkey | OKT4 epitope deficiency | CD4 | substitution | missense | Naturally occurring variant | Not currently evaluated | 11 | c.C793T | p.(A265W) | 2021 | 33893743 | |||||||
| 863 | OMIA:001890-198806 | ruff | Male body size/courtship behaviour | CENPN | inversion | Naturally occurring variant | Not currently evaluated | "a 4.5Mb inversion on the ruff orthologue of chicken chromosomr GGA11 which, due to the well-known lethality of recombinants within an inversion, has created a supergene determining male breeding behaviour, body size and plumage colour" | 2016 | 26569123 | ||||||||||
| 1691 | OMIA:002767-7957 | goldfish | Twin-tail | chordinA | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | p.(E127*) | 2014 | 24569511 | |||||||||
| 490 | OMIA:000685-9915 | indicine cattle (zebu) | Brahman (Cattle) | Myasthenic syndrome, congenital, CHRNE-related | CHRNE | 470del20 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 19 | g.26485848_26485867del | c.470_489del | Kraner et al. (2002): "a loss of 20 bp within the coding sequence of exon 5 (Fig. 2), between nucleotide 469 and 490 (nucleotide numbering referring to the cDNA sequence published under accession number X02597". These authors (and subsequent authors) call this variant "470del20". The current (2020) HGVS nomenclature is c.470_489del 200922: g. information move here (g.27119615) until standardised | rs5334475050 | 2002 | 12481987 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||
| 399 | OMIA:000698-89462 | water buffalo | Murrah (Buffalo) | Myotonia | CLCN1 | substitution | splicing | Naturally occurring variant | Not currently evaluated | UOA_WB_1 | 8 | NC_037552.1:g.106762128C>T | NM_001290916.1:c.396C>T | abnormal splicing associated with synonymous SNP (Ser132, c.396C>T) | 2013 | 23339992 | ||||
| 1783 | OMIA:002927-94885 | corn snake | Skin colour pattern, stripe | CLCN2 | insertion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | Scaffold 6 | p.(G203Efs*4) | insertion of a 5832-bp LTR-retrotransposon in the fifth intron of the CLCN2 gene - splicing of the retroposon results in a 397-bp insertion between exons 5 and 6 which introduces a premature stop codon after exon 5 (Montandon et al., 2025) | 2025 | 40140900 | |||||||
| 1030 | OMIA:001962-9542 | Japanese macaque | Neuronal ceroid lipofuscinosis, 7 | CLN7 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | 4 | c.769delA | p.(I257Lfs*36) | 2018 | 30048804 | |||||||
| 1795 | OMIA:001718-8090 | Japanese medaka | Skeletal defects, col10a1a-related | col10a1a | deletion, small (<=20) | frameshift | Genome-editing (CRISPR-Cas9) | Not currently evaluated | p.(C633fs) | 5 base pair deletion | 2024 | 38510140 | ||||||||
| 1506 | OMIA:001274-452646 | American mink | Coat colour, black crystal | COPA | substitution | missense | Naturally occurring variant | Not currently evaluated | NNQGG.v01 | FNWR01000261.1 | g.4876673G>A | c.478C>T | p.(R160C) | 2022 | 35729186 | |||||
| 1012 | OMIA:002159-9694 | tiger | Golden tiger | CORIN | substitution | missense | Naturally occurring variant | Not currently evaluated | c.1759C>T | p.(H587Y) | 2017 | 28281538 | ||||||||
| 1491 | OMIA:001643-10036 | golden hamster | duper | Cry1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | c.578del | p.(P193fs) | published as c.578delC | 2022 | 35471909 | |||||||
| 1176 | OMIA:000168-10141 | domestic guinea pig | Cataract | Cryz | deletion, gross (>20) | splicing | Naturally occurring variant | Not currently evaluated | "a 102-bp deletion towards the 3' end of the coding region. This deletion does not interfere with the reading frame but results in a protein 34 amino acids shorter." (Rodriguez et al., 1992) | 1992 | 1390943 | |||||||||
| 1751 | OMIA:000017-8128 | Nile tilapia | Steroid hormone-deprived sex reversal, CYP11A1-related | cyp11a1 | deletion, gross (>20) | Genome-editing (CRISPR-Cas9) | Not currently evaluated | 22 bp deletion in exon 4 | 2024 | 39284885 | ||||||||||
| 1743 | OMIA:002894-10036 | golden hamster | Dcaf17 deficiency | Dcaf17 | deletion, small (<=20) | frameshift | Genome-editing (CRISPR-Cas9) | Not currently evaluated | BCM_Maur_2.0 | NW_024429189.1:g.39589667_39589671del | XM_040745545.1:c.71_75del | XP_040601479.1:p.(D24Gfs*24) | 2024 | 39239833 | ||||||
| 1335 | OMIA:002377-8845 | swan goose | Lion Head (Goose (domestic)) Sichuan White, China (Goose (domestic)) | Knob, basal | DIO2 | substitution | missense | Naturally occurring variant | Not currently evaluated | AnsCyg_PRJNA183603_v1.0 | NW_013185827.1 | g.642923G>A | p.(P265L) | 2021 | 34193033 | |||||
| 1739 | OMIA:000543-103695 | central bearded dragon | Scaleless | EDA | Sca | deletion, gross (>20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | "in-frame deletion of 14 amino acids in a highly conserved tumor necrosis factor (TNF) motif of the EDA protein" | 2016 | 28439533 | ||||||||
| 724 | OMIA:001695-8090 | Japanese medaka | Reduced scale-3 | edar | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | "several kb of extra sequence in the 5' UTR that . . . contains out-of-frame start codons and stop codons, [and consequently] the mutant transcript is likely to result in premature initiation and termination of translation and, as a result, the EDAR protein is not synthesized" | 2001 | 11516953 | ||||||||||
| 1869 | OMIA:002887-37003 | mangrove rivulus | Ectodermal dysplasia, no-fin-ray | edaradd | nfr | substitution | missense | Chemical mutagenesis (ENU) | Not currently evaluated | ASM164957v2 | LH22 | NC_051451.1:g.11425249C>T | XM_017421743.3:c.574C>T | XP_017277232.1:p.(R192C) | 2025 | 39837941 | ||||
| 1738 | OMIA:002887-94885 | corn snake | Scaleless | EDARADD | scl | deletion, small (<=20) | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | UNIGE_PanGut_3.0 | Super-Scaffold_423 | NW_023010793.1:g.39572203_39572204del | XM_034428296.1:c.545_546del | XP_034284187.1:p.(C182*) | 2023 | 37315141 | ||||
| 1747 | OMIA:002901-8296 | axolotl | Skin colour, white | EDN3 | d | not known | Not currently evaluated | cDNA from animals with the white phenotype lack exon 2 | 2017 | 28127056 | ||||||||||
| 1632 | OMIA:000375-8932 | rock pigeon | Piebald | EDNRB2 | Group 4 | duplication | Naturally occurring variant | Not currently evaluated | tandem duplication of a 37-kb region spanning from intron 1 of VAMP7 to just 5’ of EDNRB2 | 2023 | 37546953 | |||||||||
| 1631 | OMIA:000375-8932 | rock pigeon | Piebald | EDNRB2 | Group2 | substitution | missense | Naturally occurring variant | Not currently evaluated | p.(A42E) | 2023 | 37546953 | ||||||||
| 1630 | OMIA:000375-8932 | rock pigeon | Piebald | EDNRB2 | Group1 | substitution | missense | Naturally occurring variant | Not currently evaluated | p.(R290C) | 2023 | 37546953 | ||||||||
| 1562 | OMIA:002701-51751 | ball python | Skin colour, EDNRB2-related | EDNRB2 | yellowbelly | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | c.1646del | OP589186.1; 1-bp deletion introduces a frameshift, which removes or alters three of the seven transmembrane helices | 2023 | 37191439 | |||||||
| 1563 | OMIA:002701-51751 | ball python | Skin colour, EDNRB2-related | EDNRB2 | yellowbelly | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | c.1747_1763del | OP589186.1; "17-bp deletion introduces a frameshift into the transcript, which removes or alters two of the seven transmembrane helices" | 2023 | 37191439 | |||||||
| 1564 | OMIA:002701-51751 | ball python | Skin colour, EDNRB2-related | EDNRB2 | specter | substitution | missense | Naturally occurring variant | Not currently evaluated | c.2601G>C | p.(R315P) | OP589186.1 | 2023 | 37191439 | ||||||
| 1567 | OMIA:002701-51751 | ball python | Skin colour, EDNRB2-related | EDNRB2 | asphalt | substitution | splicing | Naturally occurring variant | Not currently evaluated | c.3118G>A | OP589186.1; G-to-A substitution in the sixth splice donor for the sixth intron | 2023 | 37191439 | |||||||
| 1565 | OMIA:002701-51751 | ball python | Skin colour, EDNRB2-related | EDNRB2 | spark | substitution | missense | Naturally occurring variant | Not currently evaluated | c.481G>C | p.(L152F) | OP589186.1 | 2023 | 37191439 | ||||||
| 1566 | OMIA:002701-51751 | ball python | Skin colour, EDNRB2-related | EDNRB2 | gravel | substitution | splicing | Naturally occurring variant | Not currently evaluated | c.499G>A | OP589186.1; G-to-A substitution at the splice donor for the first intron | 2023 | 37191439 | |||||||
| 257 | OMIA:000375-93934 | Japanese quail | Feather colour, panda/dotted white | EDNRB2 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.995G>A | p.(R332H) | 2007 | 17313575 | ||||||||
| 1633 | OMIA:001252-8932 | rock pigeon | Recessive white and bull eye | EDNRB2 | substitution | missense | Naturally occurring variant | Not currently evaluated | 4A | g.11167700C>T | c.766G>A | p.(E256K) | 2023 | 37546953 | ||||||
| 1773 | OMIA:000375-9049 | Indian peafowl | Feather colour, white | EDNRB2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | 4 | g.12583552G>A | p.(W206*) | 2025 | 39965774 | |||||||
| 1164 | OMIA:001252-8843 | domestic goose | Gang, China (Goose (domestic)) | Feather colour, recessive white | EDNRB2 | insertion, small (<=20) | Naturally occurring variant | Not currently evaluated | AnsCyg_PRJNA183603_v1.0 | NW_013185915.1:g.750748_750735insCACAGGTGAGCTCT | 2020 | 32066369 | ||||||||
| 1 | OMIA:000240-8932 | rock pigeon | Crest | EPHB2 | cr | substitution | missense | Naturally occurring variant | Not currently evaluated | c.???C>T | p.(R758C) | 2013 | 23371554 | |||||||
| 148 | OMIA:000361-9783 | Asiatic elephant | Factor VII deficiency | F7 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.202A>G | p.(R68G) | 2017 | 28118558 | ||||||||
| 983 | OMIA:000439-9844 | llama | Long hair | FGF5 | haplotype | Naturally occurring variant | Not currently evaluated | A "a single base deletion (c.348delA), [and] a 12-bp insertion (c.351_352insCATATAACATAG)" that comprise a single likely causal variant | 2017 | 29024003 | ||||||||||
| 982 | OMIA:000439-10141 | domestic guinea pig | Long hair | Fgf5 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.403C>T | p.(R135*) | "The data were submitted to the European Variation Archive (accession no. PRJEB24997)" | 2018 | 29603294 | |||||||
| 984 | OMIA:000439-9844 | llama | Long hair | FGF5 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.499C>T | 2017 | 29024003 | |||||||||
| 559 | OMIA:000439-10036 | golden hamster | Hair, long | Fgf5 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | c.546delG | p.(R184Gfs*6) | 2015 | 26481120 | ||||||||
| 347 | OMIA:000439-9793 | ass (donkey) | Âne de Provence, France (Ass) Âne des Pyrénées, France (Ass) Âne grand noir du Berry, France (Ass) Âne normand, France (Ass) | Hair, long | FGF5 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ASM1607732v2 | 3 | NC_052179.1:g.161373495G>A | XM_014836312.2:c.245G>A | XP_014691798.1:p.W82* | 2014 | 25927731 | ||||
| 560 | OMIA:000439-9793 | ass (donkey) | Âne Bourbonnais, France (Ass) Âne des Pyrénées, France (Ass) Âne normand, France (Ass) Poitou (Ass) | Hair, long | FGF5 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ASM1607732v2 | 3 | NC_052179.1:g.161381098_161381099del | XM_014836312.2:c.433_434del | XP_014691798.1:p.M145Vfs*15 | 2014 | 25927731 | ||||
| 1343 | OMIA:000439-9838 | Arabian camel | Long hair | FGF5 | substitution | missense | Naturally occurring variant | Not currently evaluated | CamDro3 | 2 | g.76625546C>T | c.779C>T | p.(P260L) | cDNA and protein positions based on transcript ENSCDRT00005003721.1 | 2021 | 34432312 | ||||
| 1827 | OMIA:000419-93934 | Japanese quail | Glycogen storage disease, type II | GAA | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Coturnix japonica 2.1 | c.1096delG | p.(A366Hfs*23) | 2025 | 40870023 | |||||||
| 517 | OMIA:000578-9544 | Rhesus monkey | Krabbe disease | GALC | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | c.387delAC | 1997 | 9192853 | ||||||||||
| 1884 | OMIA:003047-9541 | crab-eating macaque | Polycystic kidney disease, GANAB-related | GANAB | substitution | missense | Naturally occurring variant | Not currently evaluated | NM_001285075.1:c.2708T>C | p.(V903A) | 2023 | 36876010 | ||||||||
| 1782 | OMIA:002937-51751 | ball python | Skin colour, axanthism | gch2/LOC103050242 | substitution | nonsense (stop-gain) | Not currently evaluated | 2 | g.281146407C>T | c.520C>T | p.(R174*) | The genomic location corresponds to chromosome 2 position 281146407 of the Burmese Python assembly | 2025 | 40235167 | ||||||
| 190 | OMIA:001473-9915 | indicine cattle (zebu) | Brahman (Cattle) | Dwarfism, growth-hormone deficiency | GH1 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.641C>T | p.(T200M) | Bos indicus cDNA position based on AF034386, protein position based on AAB92549 | 2009 | 19524387 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||||
| 677 | OMIA:001920-27706 | largemouth bass | Abortion due to deletion in GHRH | GHRH | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | a 66bp deletion (c.-923_-858del) in the 5' flanking region of the GHRH gene in an autosomal recessive embryonic lethal | 2014 | 24697798 | ||||||||||
| 1832 | OMIA:003004-80972 | clown anemonefish | Skin colour pattern, Snowflake | gja5b | substitution | missense | Naturally occurring variant | Not currently evaluated | c.124G>A | p.(E42K) | 2025 | 40909517 | ||||||||
| 1802 | OMIA:002957-7994 | Mexican tetra | Anophthalmia/microphthalmia | gja8b | substitution | missense | Naturally occurring variant | Not currently evaluated | p.(S89K) | 2024 | 39554031 | |||||||||
| 1803 | OMIA:002957-7994 | Mexican tetra | Anophthalmia/microphthalmia | gja8b | substitution | missense | Naturally occurring variant | Not currently evaluated | p.(T39M) | 2024 | 39554031 | |||||||||
| 1178 | OMIA:001461-9217 | American flamingo | Tay-Sachs disease | HEXA | substitution | missense | Naturally occurring variant | Not currently evaluated | c.1406C>T | p.(P469L) | 2008 | 18693054 | ||||||||
| 1584 | OMIA:001243-9601 | Sumatran orangutan | Alkaptonuria | HGD | substitution | missense | Naturally occurring variant | Not currently evaluated | Susiae_PABv2/ponAbe3 | 3 | g.17314095G>A | c.1081G>A | p.(G361R) | 2023 | 37354891 | |||||
| 1800 | OMIA:002769-8090 | Japanese medaka | dorsalfinless | hoxc11a | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 7 | insertion of 12.8 kb transposon-like DNA in 3′ UTR of hoxc11a resulting in reduced expression of hoxc11a |
2024 | 38861596 | |||||||||
| 1731 | OMIA:002275-452646 | American mink | Coat colour, Royal pastel | HPS3 | b | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | NNQGG.v01 | 6 | NC_058096.1:g.75137871_75137872ins[OR863243];75137865_75137871 | 2024 | 38956930 | |||||||
| 789 | OMIA:002116-69293 | three-spined stickleback | Coat colour, albinism, oculocutaneous, HPS5-related | Hps5 | casper | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | "casper mutants have an insertion of a single nucleotide in the 6th exon of Hsp5, predicted to generate an early frameshift" | 2017 | 28739598 | ||||||||
| 331 | OMIA:001348-9544 | Rhesus monkey | Atrichia with papular lesions | HR | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | MMUL_1 | 8 | g.22046679C>T | c.1831C>T | p.(R611*) | 2002 | 11831740 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||||
| 1786 | OMIA:000664-9542 | Japanese macaque | Mucopolysaccharidosis I | IDUA | substitution | missense | Naturally occurring variant | Not currently evaluated | c.786 C>A | p.(H262Q) | 2025 | 40251406 | ||||||||
| 1622 | OMIA:002763-9541 | crab-eating macaque | Severe combined immunodeficiency disease | IL2RG | substitution | nonsense (stop-gain) | Base-editing | Not currently evaluated | Macaca_fascicularis_5.0 | X | g.68110639G>A | c.391C>T | p.(Q131*) | XM_005593892.2; XP_005593949.1 | 2023 | 37661226 | ||||
| 962 | OMIA:001675-61379 | black-footed cat | Cone-rod dystrophy 2 | IQCB1 | deletion, small (<=20) | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.1282delCT | p.(L428*) | 2017 | 28322220 | ||||||||
| 1711 | OMIA:000284-10036 | golden hamster | Diabetes mellitus, type 2 | Irs2 | deletion, gross (>20) | Genome-editing (CRISPR-Cas9) | Not currently evaluated | 2653-bp deletion in exon 1 | 2024 | 39134590 | ||||||||||
| 1525 | OMIA:001652-9627 | red fox | Platinum coat colour | KIT | substitution | splicing | Naturally occurring variant | Not currently evaluated | G>A variant in the first nucleotide of KIT intron 17 causes skipping of exon 17 | 2015 | 25662789 | |||||||||
| 1818 | OMIA:000209-30521 | domestic yak | Coat colour, white | KIT | deletion, small (<=20) | regulatory | Naturally occurring variant | Not currently evaluated | 6 | 14bp deletion in KIT promoter | 2025 | 40629379 | ||||||||
| 566 | OMIA:001737-9838 | Arabian camel | Coat colour, white spotting, KIT-related | KIT | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | c.1842delG | p.(M614Ifs*5) | 2017 | 28282952 | ||||||||
| 403 | OMIA:000209-494514 | Arctic fox | Coat colour, dominant white | KIT | substitution | splicing | Naturally occurring variant | Not currently evaluated | c.1867+1G>T | 2013 | 24308634 | |||||||||
| 150 | OMIA:000209-9793 | ass (donkey) | Coat colour, dominant white | KIT | W | substitution | missense | Naturally occurring variant | Not currently evaluated | ASM1607732v2 | 3 | NC_052179.1:g.139882496A>C | XM_014853517.2:c.662A>C | XP_014709003.2:p.(Y221S) | 2015 | 25818843 | ||||
| 405 | OMIA:001737-9793 | ass (donkey) | Coat colour, white spotting, due to KIT | KIT | Ws | substitution | splicing | Naturally occurring variant | Not currently evaluated | ASM1607732v2 | 3 | NC_052179.1:g.139911533T>A | XM_014853517.2:c.1978+2T>A | 2015 | 25818843 | |||||
| 1505 | OMIA:000449-452646 | American mink | Shadow coat colour | KIT | S^h | substitution | missense | Naturally occurring variant | Not currently evaluated | NNQGG.v01 | NWR01000037.1 | g.6253028G>T | c.2374G>T | p.(D792Y) | 2022 | 35481560 | ||||
| 1725 | OMIA:001737-89462 | water buffalo | Coat colour, white spotting, KIT-related | KIT | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | UOA_WB_1 | 7 | NC_037551.1:47207784A>T | NM_001290952.1:c.2016T>A | NP_001277881.1:p.(Y672*) | 2024 | 39048931 | |||||
| 1102 | OMIA:000209-30538 | alpaca | Classic grey coat colour | KIT | substitution | missense | Naturally occurring variant | Not currently evaluated | VicPac3.2 | 2 | NW_021964157.1:g.38170962G>A | XM_031688000.1:c.391G>A | XP_031543860.1:p.G131R | published as c.376G>A and p.(G126R), coordinates in this table are based on supplementary table 4 in Tan et al. (2024) | 2019 | 31297861 | ||||
| 1152 | OMIA:002237-8090 | Japanese medaka | Few melanophore | kitlga | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | Otsuki et al. (2020): "the phenotype of fm medaka is attributable to insertion of a Tcb1-like transposon at the kitlga locus" | 2020 | 31757930 | ||||||||||
| 1556 | OMIA:000499-9544 | Rhesus monkey | Hypercholesterolaemia | LDLR | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | 19 | p.(W284*) | G>A in exon 6 in position 914 of the human cDNA resulting in p.(W284*) | 1990 | 2326270 | |||||||
| 1557 | OMIA:000499-9544 | Rhesus monkey | Hypercholesterolaemia | LDLR | substitution | missense | Naturally occurring variant | Not currently evaluated | 19 | c.245G>A | p.(C82Y) | 2023 | 37186395 | |||||||
| 1672 | OMIA:002796-9541 | crab-eating macaque | Cardiomyopathy, dilated, LMNA-related | LMNA | substitution | splicing | Base-editing | Not currently evaluated | MFA1912RKSv2 | 1 | NC_052255.1:g.93546791T>C | XM_045371898.1:c.357-2A>G | 2024 | 38559624 | ||||||
| 1046 | OMIA:001701-13146 | budgerigar | Feater colour, blue | LOC101880715 | substitution | missense | Naturally occurring variant | Not currently evaluated | 1 | NW_004848279.1:g.21369066T>C | XM_005153087.1c.1930T>C | p.(R644W) | 2017 | 28985565 | ||||||
| 1878 | OMIA:002765-7957 | goldfish | Celestial eye | lrp2a | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | 9 | g.28575379C>T | 2025 | 41226661 | ||||||||
| 1877 | OMIA:002765-7957 | goldfish | Telescope eye | lrp2a | insertion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | ASM336829v1 | 9 | 13-kBP insertion in intron 45 due to insertion of foamy-like endogenous retrovirus resulting in premature stop codon | 2020 | 32392470 | |||||||
| 1876 | OMIA:002765-7957 | goldfish | Telescope eye | lrp2a | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ASM336829v1 | 9 | NC_039251.1:g.7990395C>A | XM_026271200.1:c.13549G>T | XP_026126985.1:p.(G4517*) | published as p.G4480* | 2020 | 32392470 | ||||
| 1875 | OMIA:002765-7957 | goldfish | Telescope eye | lrp2a | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ASM336829v1 | 9 | NC_039251.1:g.8006317G>T | XM_026271200.1:c.10386C>A | XP_026126985.1:p.(Y3462*) | published as p.(Y3425*) | 2020 | 32392470 | ||||
| 605 | OMIA:001721-32536 | cheetah | Coat colour, king | LVRN | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | p.(N977Kfs*110) | 2012 | 22997338 | |||||||||
| 1348 | OMIA:002431-9694 | tiger | Pseudomelamism | LVRN | substitution | missense | Naturally occurring variant | Not currently evaluated | PanTig1.0 | A1 | c.1360C>T | p.H454Y | Sagar et al. (2021): "[Assembly PanTig1.0(GCF_000464555.1)]. . . . (Taqpep c.1360C > T); XP_007086933.1) of the protein (Taqpep p.H454Y)" | 2021 | 34518374 | |||||
| 518 | OMIA:000185-452646 | American mink | Chediak-Higashi syndrome | LYST | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | c.9468delC | 2013 | 22762706 | ||||||||||
| 1359 | OMIA:002449-94885 | corn snake | Skin colour, lavender | LYST | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.9508C>T | p.(Q3169*) | 2020 | 33020272 | ||||||||
| 249 | OMIA:000625-10141 | domestic guinea pig | Mannosidosis, alpha | Man2b1 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.679C>T | p.(R227W) | 2002 | 11959458 | ||||||||
| 1646 | OMIA:002804-9544 | Rhesus monkey | Germline mutation rate | MBD4 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | MMul10 | 2 | g.147059371del | c.984del | p.(I330Sfs*2) | ENSMMUG00000012723 | 2023 | 37984997 | ||||
| 1007 | OMIA:001199-10141 | domestic guinea pig | Brown coat colour | MC1R | e (MC1R*4) | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | Vidal (2018): "a deletion of 2760 bp, including the entire MC1R coding region" | 2018 | 30101449 | |||||||||
| 674 | OMIA:001199-30640 | gray squirrel | Melanism (black) | MC1R | E^B | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | MC1RΔ24 allele E^B ["at amino acid positions 87-94"] | 2009 | 19643815 | |||||||||
| 250 | OMIA:001199-46844 | Geoffroy's cat | Melanism (black coat) | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | p.(C125R) | 2015 | 25695801 | |||||||||
| 1328 | OMIA:000374-495946 | Eleonora's falcon | Feather colour, extended black | MC1R | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | p.(M114_V117del) | 2011 | 21696477 | |||||||||
| 1100 | OMIA:000374-57662 | red-footed booby | White plumage | MC1R | haplotype | Naturally occurring variant | Not currently evaluated | p.(M85V) + p.(R207H) | 2007 | 17602182 | ||||||||||
| 1173 | OMIA:001199-37349 | woolly mammoth | Light hair colour | MC1R | not known | missense | Naturally occurring variant | Not currently evaluated | p.(R67C) | 2006 | 16825562 | |||||||||
| 1101 | OMIA:000374-70340 | Lesser snow goose | Blue plumage | MC1R | not known | missense | Naturally occurring variant | Not currently evaluated | p.(V85M) | 2004 | 15031505 | |||||||||
| 262 | OMIA:001199-494514 | Arctic fox | Blue coat colour | MC1R | Ed | haplotype | missense | Naturally occurring variant | Not currently evaluated | p.[(G5C);(F280C)] | The blue (Ed) allele is a haplotype comprising two missense variants (p.Gly5Cys and p.Phe280Cys) (Våge et al., 2005) | 2005 | 15982782 | |||||||
| 1271 | OMIA:001199-30532 | fallow deer | Coat colour, white | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | c.143T>C | p.(L48P) | 2020 | 33213385 | ||||||||
| 1765 | OMIA:002770-51751 | ball python | Skin colour, Clown colour morph | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | 3 | c.149G>A | p.(S50N) | 2025 | 39609249 | |||||||
| 180 | OMIA:001199-9870 | reindeer | Coat colour, extension | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | c.218T>C | p.(M73T) | 2014 | 25039753 | ||||||||
| 1002 | OMIA:002156-46218 | Chinese painted quail | Feather colour, Blue Face | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | c.271G>A | p.(E92K) | 2018 | 29974967 | ||||||||
| 18 | OMIA:001494-9103 | turkey | Feather colour, dominant black | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | c.364A>T | p.(I122F) | 2010 | 20634512 | ||||||||
| 1329 | OMIA:000374-120794 | gyrfalcon | Feather colour, extended black | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | c.376A>G | p.(I126V) | 2012 | 22497627 | ||||||||
| 1733 | OMIA:001199-30532 | fallow deer | Coat colour, menil | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | c.714G>A | p.(G236D) | 2024 | 39202415 | ||||||||
| 1006 | OMIA:001199-10141 | domestic guinea pig | Brown coat colour | MC1R | e (MC1R*2) | substitution | missense | Naturally occurring variant | Not currently evaluated | c.749T>C | p.(L250Q) | 2018 | 30101449 | |||||||
| 181 | OMIA:001199-9870 | reindeer | Coat colour, extension | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | c.839T>G | p.(F280C) | 2014 | 25039753 | ||||||||
| 1003 | OMIA:002155-46218 | Chinese painted quail | Feather colour, Red Breasted | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | c.872C>T | p.(P292L) | 2018 | 29974967 | ||||||||
| 1346 | OMIA:001199-37190 | antarctic fur seal | Hypopigmentation (blond) | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | c.872C>T | p.(S291F) | 2016 | 27547348 | ||||||||
| 19 | OMIA:001494-9103 | turkey | Feather colour, black-wing bronze | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | c.887C>T | p.(A296V) | 2010 | 20634512 | ||||||||
| 1009 | OMIA:001199-9838 | Arabian camel | White coat colour | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | c.901C>T | p.(R301C) | KU179867; c.901C>T; p.R301C | 2018 | 29893870 | |||||||
| 328 | OMIA:001494-9103 | turkey | Bronze feathers | MC1R | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.96G>A | 2010 | 20634512 | |||||||||
| 256 | OMIA:001435-93934 | Japanese quail | Feather colour, extended brown | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | c.?G>A | p.(E92K) | 2006 | 16734695 | ||||||||
| 1848 | OMIA:001199-37699 | marsupial mole | Coat colour, wildtype | MC1R | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | reference sequence | the normal cream coat colour of marsupial moles is likley due to an MC1R in-frame stop codon at position 160 | 2025 | 41119986 | |||||||||
| 996 | OMIA:001199-9793 | ass (donkey) | Âne de Provence, France (Ass) Âne des Pyrénées, France (Ass) Âne normand, France (Ass) Miniature, United States of America (Ass) | Coat colour, red | MC1R | e | substitution | missense | Naturally occurring variant | Not currently evaluated | ASM1607732v2 | 28 | NC_052204.1:g.63570188T>C | XM_014836533.2:c.629T>C | XP_014692019.1:p.(M210T) | 2014 | 25155046 | |||
| 1896 | OMIA:001199-36239 | least weasel | Coat colour, winter-brown | MC1R | delins, small (<=20) | missense | Naturally occurring variant | Not currently evaluated | mMusNiv2.hap1.1 | scaffold 337 | c.301_302delinsAA | p.(L101K) | 2026 | 41957296 | ||||||
| 1741 | OMIA:000374-56313 | barn owl | Feather colour, rufous | MC1R | R | substitution | missense | Naturally occurring variant | Not currently evaluated | T.alba_DEE_v4.0 | Super-scaffold 26 | NW_024881300.1:g.22522039G>A | c.376G>A | p.(V126I) | valine allele is associated with whiter plumage colorations, whereas the isoleucine allele is associated to redder plumage (rufous) coloration | 2015 | 25857339 | Genomic coordinates as reported by Cumer et al. 2024 (PMID:38196365) | ||
| 115 | OMIA:001199-9627 | red fox | Coat colour, extension | MC1R | E^A | substitution | missense | Naturally occurring variant | Not currently evaluated | VulVul2.2 | NW_020356486.1 | g.6101019T>C | c.373T>C | p.(C125R) | XM_026005028.1; XP_025860813.1 | 1997 | 9054949 | |||
| 1287 | OMIA:002309-9646 | giant panda | Cataract | MIP | substitution | missense | Naturally occurring variant | Not currently evaluated | c.686G>A | p.(S229N) | 2021 | 33530927 | ||||||||
| 503 | OMIA:000915-93934 | Japanese quail | Feather colour, silver | MITF | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | "a two-base deletion resulting in premature termination of the polypeptide in the region following the zipper region" = 2 bp deletion in exon 11 | 1998 | 9576828 | |||||||||
| 505 | OMIA:000755-93934 | Japanese quail | Osteopetrosis | MITF | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | same MITF variant as for silver, as reported in 1998 | 2001 | 11169846 | ||||||||||
| 385 | OMIA:001401-10036 | golden hamster | Waardenburg syndrome, type 2A | MITF | substitution | splicing | Naturally occurring variant | Not currently evaluated | A T>A base substitution in intron 6 of MITF leads to the skipping of exon 7 and a premature termination. | 2003 | 12871913 | |||||||||
| 1727 | OMIA:002679-8839 | Mallard | White Pekin (Duck (domestic)) | Feather colour, white, MITF-related | MITF | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 13 | intronic insertion of a 6634bp retrotransposon | 2018 | 30018292 | ||||||||
| 1205 | OMIA:001680-452646 | American mink | Hedlund | MITF | h | substitution | splicing | Naturally occurring variant | Not currently evaluated | MusPutFur1.0.86 | c.33+1G>A | GL896899.1:18635719 G/A (MITF-M C.33 + 1 G > A (Manakhov et al., 2017) | 2019 | 30872653 | ||||||
| 409 | OMIA:000214-89462 | water buffalo | Swamp buffalo (Buffalo) | White spotting | MITF | substitution | splicing | Naturally occurring variant | Not currently evaluated | UOA_WB_1 | 21 | NC_037565.1:g.31613452A>T | XM_025273060.1:c.1179+2T>A | Published as c.840+2T>A, coordinates in the table have been updated to reflect a recent reference genome. | 2015 | 26417640 | ||||
| 341 | OMIA:000214-89462 | water buffalo | Swamp buffalo (Buffalo) | White spotting | MITF | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | UOA_WB_1 | 21 | NC_037565.1:g.31637770G>A | XM_025273060.1:c.649C>T | XP_025128845.1:p.(R217*) | Published as c.328C>T , p.(R110*), coordinates in the table have been updated to reflect a recent reference genome. |
2015 | 26417640 | |||
| 1209 | OMIA:001654-8932 | rock pigeon | Almond | MLANA | st | repeat variation | Naturally occurring variant | Not currently evaluated | "The CNV captures a 77-kb segment of the reference genome (ScoHet5_227: 5,181,467–5,259,256), with an additional increase in coverage in a nested 25-kb segment (ScoHet5_227: 5,201,091–5,226,635). Read-depth analysis confirmed 7 copies of the outer 77-kb segment and 14 copies of the inner 25-kb segment in the genomes of female (ZStW) Almond pigeons, which have an St locus on only one chromosome. We used PCR to amplify across the outer and inner CNV breakpoints of Almond pigeons and determined that the CNV consists of tandem repeats of the 77-kb and nested 25-kb segments (Fig 3)." (Bruders et al., 2020) | 2020 | 32433666 | |||||||||
| 1014 | OMIA:002145-9544 | Rhesus monkey | Colorectal cancer, MLH1-related | MLH1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | 2 | c.1029C<G | p.(Y343*) | Dray et al. (2018): "a de novo stop codon in the coding region of MLH1. This de novo stop codon occurs in exon 11 out of 19 in the MLH1 gene, and thus would produce a dramatically truncated and possibly non-functional protein". Ozirmak Lermi et al. (2022) reported the c. and p. coordinates of this variant. | 2018 | 30108684 | ||||||
| 1013 | OMIA:002145-9544 | Rhesus monkey | Colorectal cancer, hereditary nonpolyposis, MLH1-related | MLH1 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | 2 | g.99561829_99561830del | Brammer et al. (2018): "a heterozygous deletion in the putative promoter region of the MLH1 gene (rheMac2: 2:99,561,829– 99,561,830; hg19: ∼3:37,034,780; c.−258_259)" | 2018 | 29490919 | ||||||||
| 653 | OMIA:001445-93934 | Japanese quail | Feather colour, lavender | MLPH | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | a large deletion in the region of the quail MLPH gene | 2002 | 12011184 | ||||||||||
| 672 | OMIA:000031-452646 | American mink | Coat colour, silver-blue | MLPH | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | deletion of exon 8 | 2013 | 23747352 | ||||||||||
| 1683 | OMIA:000031-9669 | domestic ferret | Coat colour, silver | MLPH | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | p.(S327Tfs*46) | an inversion of two nucleotides and a single nucleotide deletion in the 9th exon of MLPH | 2023 | 38189891 | ||||||||
| 1617 | OMIA:002758-51751 | ball python | Skin colour, Ghost | MLPH | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | c.4919_4923del | p.(Q350Ilefs*15) | OR035642 | 2023 | 37637270 | |||||||
| 1204 | OMIA:000031-452646 | American mink | Silverblue | MLPH | p | substitution | splicing | Naturally occurring variant | Not currently evaluated | MusPutFur1.0.86 | g.662639G>A | c.901+1G>A | GL896909.1:662639 G/A (MLPH C.901 + 1 G > A) (Manakhov et al., 2019) | 2019 | 30872653 | |||||
| 1561 | OMIA:001445-9135 | common canary | Feather colour, Opal / Mogno | MLPH | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | NW_022042652.1 | g.66493407_66493413del | p.(A237fs) | XP_009086443.1 | 2023 | 37194440 | ||||||
| 1560 | OMIA:001445-9135 | common canary | Feather colour, Onyx | MLPH | substitution | missense | Naturally occurring variant | Not currently evaluated | NW_022042652.1 | g.66497548C>T | p.(R111K) | XM_009088195.3; XP_009086443.1 | 2023 | 37194440 | ||||||
| 1015 | OMIA:002160-9544 | Rhesus monkey | Colorectal cancer, hereditary nonpolyposis, MSH6-related | MSH6 | substitution | missense | Naturally occurring variant | Not currently evaluated | Dray et al. (2018): "a heterozygous missense mutation in MSH6 that has a CADD score of 22.8, indicating that it would be among the <1% most deleterious mutations possible in the human genome (if that variant occurred in the human MSH6 gene" | 2018 | 30108684 | |||||||||
| 519 | OMIA:001342-8790 | emu | Mucopolysaccharidosis IIIB | NAGLU | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | c.1098_1099delGG | 2001 | 11414757 | ||||||||||
| 1064 | OMIA:002189-8932 | rock pigeon | Barless | NDP | c | not known | start-lost | Naturally occurring variant | Not currently evaluated | Cliv_1.0 | Vickrey et al. (2018): "a nonsynonymous protein-coding change at the start codon of NDP". | 2018 | 30014848 | |||||||
| 316 | OMIA:000545-93934 | Japanese quail | Hypotrophic axonopathy | NEFL | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.352C>T | p.(Q114*) | 1993 | 8468353 | ||||||||
| 865 | OMIA:002130-94885 | corn snake | Coat colour, oculocutaneous albinism, OCA2-related | OCA2 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | LTR retrotransposon in the 11th intron | 2015 | 26597053 | ||||||||||
| 1602 | OMIA:002130-9544 | Rhesus monkey | Coat colour, oculocutaneous albinism | OCA2 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.2363C>T | p.(S788L) | 2020 | 32259106 | ||||||||
| 1776 | OMIA:002130-8084 | green swordtail | Oculocutaneous albinism, OCA2-related | oca2 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | Xiphophorus_hellerii-4.1 | 9 | approximate 480 bp insertion in the oca2 gene which introduces a premature stop codon | 2025 | 39896652 | ||||||||
| 1715 | OMIA:002871-9544 | Rhesus monkey | Optic atrophy | OPA1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Mmul_10 | 2 | NC_041755.1:g.4364931C>A | XM_015132523.2:c.22G>T | XP_014988009.1:p.(A8S) | 2024 | 38969634 | |||||
| 1740 | OMIA:002889-481883 | Leopard gecko | Skin colour, Mack Super Snow morph | PAX7 | mss | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | MPM_Emac_v1.0 | 17 | NC_072806.1:g.1828552_1828564del | 13-nucleotide deletion spans the last six nucleotides of exon 4 and the first seven nucleotides of intron 4 | 2024 | 38976731 | ||||||
| 1022 | OMIA:002163-9544 | Rhesus monkey | Cone dystrophy 4, PDE6C-related | PDE6C | substitution | missense | Naturally occurring variant | Not currently evaluated | Mmul_8.0.1 | 9 | p.(R565Q) | 2019 | 30667376 | |||||||
| 1212 | OMIA:002270-8932 | rock pigeon | Feathered shank | PITX1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | "a 44-kb deletion (from 6.719–6.763 Mb)" (Domyan et al., 2016) | 2016 | 26977633 | ||||||||||
| 1883 | OMIA:000807-9541 | crab-eating macaque | Polycystic kidney disease | PKD1 | substitution | missense | Naturally occurring variant | Not currently evaluated | XM_015442355.1:c.1144G>C | p.(E382Q) | 2023 | 36876010 | ||||||||
| 1671 | OMIA:001701-60466 | yellow-collared lovebird | Feather colour, blue | PKS | substitution | missense | Naturally occurring variant | Not currently evaluated | c.1930C>T | p.(R644W) | 2024 | 38528953 | ||||||||
| 1670 | OMIA:001701-60463 | Fischer's lovebird | Feather colour, blue | PKS | substitution | missense | Naturally occurring variant | Not currently evaluated | c.1930C>T | p.(R644W) | 2024 | 38528953 | ||||||||
| 1863 | OMIA:001701-9228 | Rose-ringed parakeet | Feather colour, blue | PKS | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.2005G>T | p.(E668*) | 2025 | 39820005 | ||||||||
| 1865 | OMIA:001701-232655 | Alexandrine parakeet | Feather colour, blue | PKS | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.2647A>T | p.(K883*) | 2025 | 39820005 | ||||||||
| 1864 | OMIA:001701-9228 | Rose-ringed parakeet | Feather colour, blue | PKS | substitution | missense | Naturally occurring variant | Not currently evaluated | c.334G>A | p.(G112R) | 2025 | 39820005 | ||||||||
| 1867 | OMIA:001701-176024 | Eclectus parrot | Feather colour, blue | PKS | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.5869C>T | p.(H1957*) | 2025 | 39820005 | ||||||||
| 1866 | OMIA:001701-232655 | Alexandrine parakeet | Feather colour, blue | PKS | substitution | missense | Naturally occurring variant | Not currently evaluated | c.727G>A | p.(R243K) | 2025 | 39820005 | ||||||||
| 1868 | OMIA:001701-176039 | galah | Feather colour, blue | PKS | haplotype | missense | Naturally occurring variant | Not currently evaluated | c.[1284T>C;2374A.G] | p.[(N428K;T792A)] | 2025 | 39820005 | ||||||||
| 540 | OMIA:001545-30521 | domestic yak | Coat colour, dilution | PMEL | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | c.50_52del | p.(L18del) | 2014 | 24989079 | ||||||||
| 1071 | OMIA:002191-93934 | Japanese quail | Yellowish plumage | PMEL | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | g.811370G>A | p.(W149*) | Ishishita et al. (2018): g.811370G>A (NC_029544.1); Trp149* | 2018 | 30425278 | |||||||
| 1736 | OMIA:002884-94885 | corn snake | Skin colour, Terrazzo | PMEL | tz | haplotype | splicing | Naturally occurring variant | Not currently evaluated | UNIGE_PanGut_3.0 | NW_023010713:g.[13272041A>T;13272043G>C] | XM_034412587.1:c.[1594C>G;1594+2T>A] | "a multi-nucleotide polymorphism, from ACG to TCC (Super-scaffold 85; position 13,272,041) falls at the end of exon 8 (one nucleotide – A to T) and on the donor site of intron 8 of the Premelanosome Protein (PMEL) gene (two nucleotides – CG to CC)" | 2024 | 39227572 | |||||
| 845 | OMIA:000483-30521 | domestic yak | Polled, Mongolian allele | POLLED | P[sub]M or P[sub]219ID | complex rearrangement | Naturally occurring variant | Not currently evaluated | "a complex 219-bp duplication-insertion (P219ID) beginning at 1,976,128 bp and a 7-bp deletion and 6-bp insertion (P1ID) located 621 bp upstream of this position . . . . This rearrangement results in duplication of an 11-bp motif (5'-AAAGAAGCAAA-3') that is entirely conserved among Bovidae . . . and that is also duplicated in the 80-kb duplication responsible for Friesian polledness" | 2017 | 28135247 | |||||||||
| 977 | OMIA:000380-9103 | turkey | Feathering, Z-linked | PRLR | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Turkey_5.1 | Z | g.9426018_9426022delTTGGT | p.(E726Dfs*7) | 2018 | 29566646 | ||||||
| 1507 | OMIA:000944-447135 | Bank vole | Susceptibility to atypical scrapie | PRNP | not known | missense | Naturally occurring variant | Not currently evaluated | p.(M109I) | 2022 | 35731839 | |||||||||
| 1256 | OMIA:002292-452646 | American mink | Moyle coat colour | RAB38 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | NNQGG.v01 | 1 | g.16075438_16075453del | c.574-589del | "We identified a homozygous 16-bp deletion [FNWR01000007.1:16075438–16075453del (RAB38:c.574-589del)], hereinafter referred to as RAB383del, in the Moyle sample, at the third exon of RAB38 gene. We found a homozygous 2-bp duplication NWR01000007.1:16132224_16132225dupCT (RAB38:c.20-21dup)], hereinafter referred to as RAB381dup, in the Violet sample, at the first exon of the RAB38 gene. Both mutations potentially resulted in the loss of function of RAB38 protein" (Manakhov et al., 2020) | 2020 | 32985525 | ||||||
| 1257 | OMIA:002292-452646 | American mink | Moyle coat colour | RAB38 | duplication | Naturally occurring variant | Not currently evaluated | NNQGG.v01 | 1 | g.16132224_16132225dupCT | c.20-21dup | "We identified a homozygous 16-bp deletion [FNWR01000007.1:16075438–16075453del (RAB38:c.574-589del)], hereinafter referred to as RAB383del, in the Moyle sample, at the third exon of RAB38 gene. We found a homozygous 2-bp duplication NWR01000007.1:16132224_16132225dupCT (RAB38:c.20-21dup)], hereinafter referred to as RAB381dup, in the Violet sample, at the first exon of the RAB38 gene. Both mutations potentially resulted in the loss of function of RAB38 protein" (Manakhov et al., 2020) | 2020 | 32985525 | ||||||
| 1621 | OMIA:002763-9541 | crab-eating macaque | Severe combined immunodeficiency disease | RAG1 | substitution | nonsense (stop-gain) | Base-editing | Not currently evaluated | Macaca_fascicularis_5.0 | 14 | g.30840789G>T | c.181C>T | p.(Q61*) | XM_005578172.2; XP_005578229.1 | 2023 | 37661226 | ||||
| 1099 | OMIA:002209-7950 | Atlantic herring | Adaptation to a red-shifted light environment | rho | substitution | missense | Naturally occurring variant | Not currently evaluated | p.(F261Y) | 2019 | 31451650 | |||||||||
| 1796 | OMIA:002945-8128 | Nile tilapia | Hypogonadism | rln3b | deletion, gross (>20) | Genome-editing (CRISPR-Cas9) | Not currently evaluated | >500 bp deletion | 2024 | 38729472 | ||||||||||
| 1558 | OMIA:001252-9135 | common canary | Feather colour, recessive white | SCARB1 | substitution | splicing | Naturally occurring variant | Not currently evaluated | NW_022042652.1 | g.27474120A>C | Variant in located in the splice-donor site immediately downstream of exon 4 and results in transcript isoforms. Genomic coordinates as listed by Bovo et al., 2023, PMID:37194440. | 2017 | 28465440 | |||||||
| 1427 | OMIA:002531-74940 | Chinook salmon | XY female | sdY | substitution | missense | Naturally occurring variant | Not currently evaluated | p.(I183N) | 2022 | 35100376 | |||||||||
| 651 | OMIA:000162-10036 | golden hamster | Cardiomyopathy, dilated | SGCD | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | genomic deletion was found to be located at 6.1 kb 5' upstream of the second exon of δ-SG gene, and its 5' upstream region of more than 27.4 kb, including the authentic first exon of δ-SG gene, was deleted | 1997 | 9391120 | ||||||||||
| 652 | OMIA:002211-10036 | golden hamster | Cardiomyopathy, hypertrophic | SGCD | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | a large deletion in the delta-SG gene | 1997 | 9097966 | ||||||||||
| 1298 | OMIA:002416-8932 | rock pigeon | Pearl-eye | SLC2A11B | tr | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | AKCR02000030.1 | g.1895934G>A | p.(W49X) | Andrade et al. (2021): "This mutation creates a premature STOP codon in exon 3 of the likely canonical SLC2A11B transcript." | 2021 | 33621224 | |||||
| 386 | OMIA:000370-93934 | Japanese quail | Feather colour, albinism, sex-linked, imperfect | SLC45A2 | substitution | splicing | Naturally occurring variant | Not currently evaluated | a splice-site mutation in the SLC45A2 gene: "a G>T transversion at the splice acceptor site just preceding exon 4" | 2007 | 17151254 | |||||||||
| 746 | OMIA:001821-8090 | Japanese medaka | Coat colour, albinism, oculocutaneous type IV | slc45a2 | complex rearrangement | Naturally occurring variant | Not currently evaluated | an inversion of 167 bp, an insertion of 48 bp, and a deletion of 172 bp | 2008 | 18245373 | ||||||||||
| 1641 | OMIA:000370-232655 | Alexandrine parakeet | Feather colour, yellow | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.1195G>A | p.(G399R) | 2024 | 37943814 | ||||||||
| 1643 | OMIA:000370-9228 | Rose-ringed parakeet | Feather colour, yellow or white | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.1195G>A | p.(G399R) | 2024 | 37943814 | ||||||||
| 1644 | OMIA:000370-9228 | Rose-ringed parakeet | Feather colour, yellow or white | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.1400G>T | p.(G467V) | 2024 | 37943814 | ||||||||
| 1642 | OMIA:000370-9228 | Rose-ringed parakeet | Feather colour, yellow | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.158C>T | p.(P53L) | 2024 | 37943814 | ||||||||
| 259 | OMIA:000370-93934 | Japanese quail | Feather colour, cinnamon | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.287C>A | p.(A72D) | 2007 | 17151254 | ||||||||
| 1530 | OMIA:002628-215402 | northern snakehead | Skin colour, yellow | SLC45A2 | YM | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | 19 | c.383G>A | p.(W128*) | 2023 | 36789536 | ||||||
| 1640 | OMIA:000370-232655 | Alexandrine parakeet | Feather colour, yellow | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.539T>C | p.(L180P) | 2024 | 37943814 | ||||||||
| 1639 | OMIA:000370-232645 | Plum-headed parakeet | Feather colour, yellow | SLC45A2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.73G>T | p.(R25*) | 2024 | 37943814 | ||||||||
| 254 | OMIA:000213-74535 | Bengal tiger | Coat colour, white | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | C>T | p.(A477V) | 2013 | 23707431 | ||||||||
| 1855 | OMIA:001821-9793 | ass (donkey) | Coat colour, cream dilution | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | EquAss-T2T_v2 | 10 | NC_091799.1:g.81796057C>T | XM_014831209.3:c.1601C>T | XP_014686695.1:p.(A534V) | published as c.1457C>T, p.A486V | 2025 | 41314234 | ||||
| 861 | OMIA:001821-9593 | western gorilla | Coat colour, albinism, oculocutaneous type IV | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | gorGor3.1 | 17 | g.59753498G>C | c.1552G>C | p.(G518R) | 2013 | 23721540 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||||
| 1537 | OMIA:002651-499056 | Asian vine snakes | Skin colour, yellow | SMARCE1 | substitution | missense | Naturally occurring variant | Not currently evaluated | 4 | g.43233281C>T | c.58C>T | p.(P20S) | 2023 | 36895044 | ||||||
| 1065 | OMIA:002190-8932 | rock pigeon | Recessive red | SOX10 | e^1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | Domyan et al. (2014) reported a 7.5kb deletion that spans "a conserved enhancer element that drives Sox10 expression in melanocytes" | 2014 | 24508169 | |||||||||
| 1066 | OMIA:002190-8932 | rock pigeon | Recessive red | SOX10 | e^2 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | Domyan et al. (2014) reported a 2.5kb deletion that spans "a conserved enhancer element that drives Sox10 expression in melanocytes" | 2014 | 24508169 | |||||||||
| 1438 | OMIA:002537-9541 | crab-eating macaque | Encephalopathy, STXBP1-related | STXBP1 | substitution | missense | Base-editing | Not currently evaluated | Macaca_fascicularis5.0 | 15 | g.101106196C>T | c.875G>A | p.(R292H) | XM_005582167.2; XP_005582224.1 | 2022 | 35283272 | ||||
| 670 | OMIA:001617-9694 | tiger | Sweet taste, lack | TAS1R2 | reference sequence allele | Naturally occurring variant | Not currently evaluated | "a 247-base pair microdeletion in exon 3 and stop codons in exons 4 and 6" | 2005 | 16103917 | ||||||||||
| 668 | OMIA:001617-32536 | cheetah | Sweet taste, lack | TAS1R2 | reference sequence allele | Naturally occurring variant | Not currently evaluated | "a 247-base pair microdeletion in exon 3 and stop codons in exons 4 and 6" | 2005 | 16103917 | ||||||||||
| 1122 | OMIA:002213-9447 | Ring-tailed lemur | Bitter taste | TAS2R16 | substitution | missense | Naturally occurring variant | Not currently evaluated | p.(S282L) | 2019 | 31161904 | |||||||||
| 1620 | OMIA:000240-8839 | Mallard | Crest cushion | TAS2R40 | substitution | regulatory | Naturally occurring variant | Not currently evaluated | 1 | published as variant in the 5′UTR of TAS2R40 (123272114_c. G78A) | 2023 | 37652165 | ||||||||
| 1277 | OMIA:001972-9793 | ass (donkey) | Coat colour, dun | TBX3 | D | insertion, small (<=20) | Naturally occurring variant | Not currently evaluated | ASM1607732v2 | 8 | NC_052184.1:42737976_42737977insT | Wang et al. (2020) report 'non-dun' as a "1 bp deletion (chr8:g.42742556 CT>C−) located ~18.6 kb downstream of the transcription start site of the TBX3 gene." The reference genome ASM1607732v2 represents the non-dun allele and information has been changed in the table to report the coordinates for the dun allele [05/06/2024] |
2020 | 33293529 | ||||||
| 1619 | OMIA:002761-51751 | ball python | Skin colour, piebald | TFEC | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.493C>T | p.(R165*) | Coordinates based on a Python bivittatus assembly | 2023 | 36702128 | |||||||
| 397 | OMIA:000162-9103 | turkey | Cardiomyopathy, dilated | TNNT2 | deletion, small (<=20) | splicing | Naturally occurring variant | Not currently evaluated | delGGGCTCCTC | 2002 | 11886865 | |||||||||
| 1538 | OMIA:001472-9541 | crab-eating macaque | Neuronal ceroid lipofuscinosis, 2 | TPP1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | c.42delC | p.(L15Sfs*33) | 2023 | 36918063 | ||||||||
| 1682 | OMIA:002841-30538 | alpaca | Suri (Alpaca) | Fleece variation, Suri type | TRPV3 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | VicPac3.2 | 16 | NW_021964189.1:g.4265902G>T | XM_031685167.1:c.1423G>T | XP_031541027.1:p.(E475*) | 2024 | 38365607 | ||||
| 1829 | OMIA:000202-1960652 | red-necked wallaby | Albinism, oculocutaneous | TYR | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 2022 | 35030050 | |||||||||||
| 723 | OMIA:000202-8090 | Japanese medaka | Skin colour, albinism | tyr | i1 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | a 1.9 kb fragment, corresponding to a novel transposable element (Tol1), has been inserted in exon 1 of the gene for tyrosinase | 1995 | 8552044 | |||||||||
| 1554 | OMIA:000202-8090 | Japanese medaka | Skin colour, albino (quasi-albino) | tyr | i4 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | a 4.7-kb insertion in exon 5 (Tol2-tyr) | 1996 | 8779712 | |||||||||
| 1555 | OMIA:000202-8090 | Japanese medaka | Skin colour, albino (weak) | tyr | i(b) | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | a 4.7-kb insertion in the 5' untranslated region (Tol2) | 2004 | 15016305 | |||||||||
| 1027 | OMIA:000202-9773 | humpback whale | Migaloo, the white whale | TYR | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | "(264 del C) at codon 88" | 2012 | 22140253 | ||||||||||
| 666 | OMIA:000202-9669 | domestic ferret | Coat colour, albinism | TYR | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | "deletion of exon 4" | 2007 | 17655555 | ||||||||||
| 1746 | OMIA:000202-8296 | axolotl | Skin colour, albino | TYR | deletion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | Linkage group 7 | "a 142 bp deletion of tyr a coding sequence at the end of exon 1 (extending ~3 kb in to intron 1) that results in a frame-shift and premature stop codon" (Woodcock et al., 2017) | 2017 | 28127056 | ||||||||
| 1304 | OMIA:000202-3370412 | Japanese raccoon dog | Albinism | TYR | complex rearrangement | Naturally occurring variant | Not currently evaluated | Mae et al. (2020): "the third exon was removed due to a deletion ... :two separate regions of 3.8 kb and 7.3 kb had been removed, but a segment of 0.3 kb between these two regions was retained, though was present in the reverse orientation." | 2020 | 32783776 | ||||||||||
| 1162 | OMIA:000202-9557 | hamadryas baboon | Siamese coat colour pattern | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | p.(A365T) | ENSPANT00000015629.2:c.1093G>A; A0A096MRE4:p.(Ala365Thr) [Koga et al., 2020] | 2020 | 32053406 | ||||||||
| 813 | OMIA:000202-8410 | Japanese wrinkled frog | Albinism | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | c.1127G>A | p.(G376D) | 2018 | 28674275 | ||||||||
| 814 | OMIA:000202-8409 | dark-spotted frog | Albinism | TYR | insertion, small (<=20) | Naturally occurring variant | Not currently evaluated | c.1244_1245insT | 2018 | 28674275 | ||||||||||
| 332 | OMIA:000202-452646 | American mink | Albinism | TYR | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.138T>A | p.(C46*) | 2008 | 18822100 | ||||||||
| 812 | OMIA:000202-1772025 | Rice frog | Albinism | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | c.169G>A | p.(G57R) | 2018 | 28674275 | ||||||||
| 260 | OMIA:000202-452646 | American mink | Himalayan | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | c.1835C>G | p.(H420Q) | 2009 | 19308642 | ||||||||
| 1011 | OMIA:000202-9689 | lion | White lion | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | c.260G>A | p.(R87Q) | 2013 | 24045858 | ||||||||
| 1600 | OMIA:000202-9544 | Rhesus monkey | Coat colour, oculocutaneous albinism | TYR | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | 14 | c.552C>A | p.(S184*) | 2000 | 10751629 | |||||||
| 355 | OMIA:000202-9515 | Tufted capuchin | Coat colour, albinism | TYR | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.64C>T | p.(R22*) | 2017 | 28476152 | ||||||||
| 816 | OMIA:000202-8409 | dark-spotted frog | Albinism | TYR | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | c.682_684del | p.(L228del) | 2018 | 28674275 | ||||||||
| 1004 | OMIA:000202-10141 | domestic guinea pig | Coat colour, albinism | Tyr | substitution | missense | Naturally occurring variant | Not currently evaluated | c.710A>G | p.(D237G) | PRJEB26285 | 2018 | 29947431 | |||||||
| 1599 | OMIA:000202-9544 | Rhesus monkey | Coat colour, golden | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | 14 | c.768C>G | p.(H256Q) | 2023 | 37522525 | |||||||
| 815 | OMIA:000202-8409 | dark-spotted frog | Albinism | TYR | insertion, small (<=20) | Naturally occurring variant | Not currently evaluated | c.768_769insT | 2018 | 28674275 | ||||||||||
| 1303 | OMIA:000202-31143 | Japanese ratsnake | Coat colour, oculocutaneous albinism | TYR | albino - pet trade | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.895C>T | p.(R299X) | 2018 | 30158334 | |||||||
| 1601 | OMIA:000202-9544 | Rhesus monkey | Coat colour, oculocutaneous albinism | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | 14 | c.934C>A | p.(L312I) | 2020 | 32259106 | |||||||
| 1594 | OMIA:000202-9901 | American bison | Oculocutaneous albinism type I (OCA1), TYR-related | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | 29 | g.7995584C>T | c.1114C>T | p.(G372R) | 2023 | 37481261 | ||||||
| 1789 | OMIA:000369-311895 | green‐cheeked parakeet | Feather colour, non-sex-linked lutino | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | ASM1176335v2 (GCA_011763355.2) | c.1111C>T | p.(H371Y) | 2025 | 40195888 | |||||||
| 151 | OMIA:000202-9793 | ass (donkey) | Coat colour, albinism | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | ASM1607732v2 | 20 | NC_052196.1:58132615G>C | XM_014827959.2:c.616C>G | XP_014683445.2:p.(H206D) | Published as c.604C>G, p.(H202D) - coordinates in the table were updated to reflect the recent reference genome |
2016 | 26763160 | ||||
| 1788 | OMIA:000369-60463 | Fischer's lovebird | Feather colour, non-sex-linked lutino | TYR | delins, small (<=20) | missense | Naturally occurring variant | Not currently evaluated | ASM3478289v1 (GCA_034782895.1) | c.736‐737TG>CT | p.(W246L) | 2025 | 40195888 | |||||||
| 1159 | OMIA:000202-9860 | red deer | White | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | CerEla 1.0 | 2 | c.871G>A | p.(G291R) | 2020 | 32041521 | ||||||
| 1748 | OMIA:000369-9135 | common canary | Feather colour, pearl | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | serCan2020 | 1 | NC_066313.1:g.34568603C>A | XM_009102738.4:c.134C>A | XP_009100986.1:p.(P45H) | 2024 | 39377483 | |||||
| 329 | OMIA:000202-89462 | water buffalo | Murrah (Buffalo) | Albinism | TYR | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | UOA_WB_1 | 5 | NC_037549.1:g.82063942C>T | XM_006075179.2:c.1431G>A | XP_006075241.1:p.(W477*) | 2012 | 22817390 | ||||
| 1118 | OMIA:000202-9627 | red fox | Albinism | TYR | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | VulVul2.2 | NW_020356544.1 | g.7130732dup | c.365dup | p.(N122Kfs4*) | XM_026015193.1; XP_025870978.1; published as c.365dupA | 2019 | 31246286 | ||||
| 1255 | OMIA:001249-452646 | American mink | American Palomino coat colour | TYRP1 | b^p | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | "a large insertion of approximately eight kb. The insertion most likely disrupts different elements necessary for the splicing of intron 2 of the TYRP1 gene" (Cicera et al., 2016) | 2016 | 26886941 | |||||||||
| 1597 | OMIA:001249-9544 | Rhesus monkey | Coat colour, golden | TYRP1 | substitution | missense | Naturally occurring variant | Not currently evaluated | 15 | c.1028A>G | p.(N343G) | 2023 | 37522525 | |||||||
| 1598 | OMIA:001249-9544 | Rhesus monkey | Coat colour, golden | TYRP1 | substitution | missense | Naturally occurring variant | Not currently evaluated | 15 | c.1244T>C | p.(L415P) | 2023 | 37522525 | |||||||
| 753 | OMIA:002061-345164 | Saker falcon | Feather colour, light brown | TYRP1 | haplotype | splicing | Naturally occurring variant | Not currently evaluated | c.79C>T and c.79_80insT | in exon 1, resulting in "a frameshift change and a premature stop codon at position 81 of the deduced protein sequence, which in the wild-type form contains 536 amino acids. | 2017 | 27611661 | ||||||||
| 258 | OMIA:001322-93934 | Japanese quail | Feather colour, roux | TYRP1 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.845T>C | p.(F282S) | 2007 | 18028514 | ||||||||
| 1713 | OMIA:001249-9691 | leopard | Coat colour, red | TYRP1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | XM_019415513:c.369del | XP_019271058:p.(G63Afs*6) | 2022 | 35782007 | ||||||||
| 1745 | OMIA:002817-8296 | axolotl | Skin colour, copper | TYRP1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | 6p | g.1225541490del | c.1156del | p.(G388Efs*28) | 2024 | 39333770 | ||||||
| 1518 | OMIA:001249-9643 | American black bear | Cinnamon coat colour | TYRP1 | substitution | missense | Naturally occurring variant | Not currently evaluated | HiC_scaffold_24 | g.6724152G>A | p.(R153C) | 2023 | 36528024 | |||||||
| 1791 | OMIA:001259-9228 | Rose-ringed parakeet | Feather colour, cinnamon | TYRP1 | substitution | missense | Naturally occurring variant | Not currently evaluated | P.krameri1.0 | c.691G>A | p.(E231K) | 2025 | 40195888 | |||||||
| 1790 | OMIA:001259-9228 | Rose-ringed parakeet | Feather colour, cinnamon | TYRP1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | P.krameri1.0 | c.86_95del | p.(C29fs*64) | 2025 | 40195888 |
* Variant pathogenicity for single-gene diseases as evaluated according to the Animal Variant Classification Guidelines (AVCG) by the Variant Pathogenicity Working Group of the International Society of Animal Genetics (ISAG) Animal Genetic Testing Standardization (AGTS) Standing Committee: P = pathogenic, LP = likely pathogenic, VUS = variant of unknown significance, LB = likely benign, B = benign. For more information (including details on the classification of each variant) see LINKS.
| Overall Statistics | |
|---|---|
| Total number of variants | 275 |
| Variants with genomic location | 73 (26.5% ) |
| Variants in a variant database, i.e. with rs ID | 2 (0.7%) |
| Variant Type | Count | Percent |
|---|---|---|
| complex rearrangement | 3 | 1.1% |
| deletion, gross (>20) | 22 | 8.0% |
| deletion, small (<=20) | 41 | 14.9% |
| delins, gross (>20) | 1 | 0.4% |
| delins, small (<=20) | 3 | 1.1% |
| duplication | 4 | 1.5% |
| haplotype | 15 | 5.5% |
| insertion, gross (>20) | 15 | 5.5% |
| insertion, small (<=20) | 8 | 2.9% |
| inversion | 1 | 0.4% |
| not known | 5 | 1.8% |
| reference sequence allele | 2 | 0.7% |
| repeat variation | 1 | 0.4% |
| substitution | 153 | 55.6% |
| unknown | 1 | 0.4% |
| Variant Effect | Count | Percent |
|---|---|---|
| deletion (in-frame) | 5 | 1.8% |
| frameshift | 30 | 10.9% |
| missense | 110 | 40.0% |
| nonsense (stop-gain) | 38 | 13.8% |
| regulatory | 5 | 1.8% |
| splicing | 18 | 6.5% |
| start-lost | 2 | 0.7% |
| synonymous | 1 | 0.4% |
| unknown | 66 | 24.0% |
| Year First Reported | Count | Percent |
|---|---|---|
| 1990 | 1 | 0.4% |
| 1991 | 0 | 0.0% |
| 1992 | 1 | 0.4% |
| 1993 | 1 | 0.4% |
| 1994 | 0 | 0.0% |
| 1995 | 1 | 0.4% |
| 1996 | 1 | 0.4% |
| 1997 | 5 | 1.8% |
| 1998 | 5 | 1.8% |
| 1999 | 2 | 0.7% |
| 2000 | 2 | 0.7% |
| 2001 | 3 | 1.1% |
| 2002 | 6 | 2.2% |
| 2003 | 1 | 0.4% |
| 2004 | 2 | 0.7% |
| 2005 | 3 | 1.1% |
| 2006 | 2 | 0.7% |
| 2007 | 6 | 2.2% |
| 2008 | 5 | 1.8% |
| 2009 | 9 | 3.3% |
| 2010 | 3 | 1.1% |
| 2011 | 1 | 0.4% |
| 2012 | 6 | 2.2% |
| 2013 | 8 | 2.9% |
| 2014 | 10 | 3.6% |
| 2015 | 12 | 4.4% |
| 2016 | 6 | 2.2% |
| 2017 | 14 | 5.1% |
| 2018 | 23 | 8.4% |
| 2019 | 10 | 3.6% |
| 2020 | 19 | 6.9% |
| 2021 | 8 | 2.9% |
| 2022 | 9 | 3.3% |
| 2023 | 33 | 12.0% |
| 2024 | 32 | 11.6% |
| 2025 | 24 | 8.7% |
| 2026 | 1 | 0.4% |