Search Results

Advanced search

Link to this search: https://omia.org/results/?search_type=advanced&result_type=variant&singlelocus=yes&characterised=yes

1793 variant records found

[show instead phene records]

By default, variants are sorted chronologically by year of publication, to provide a historical perspective. Readers can re-sort on any column by clicking on the column header. Click it again to sort in a descending order. To create a multiple-field sort, hold down Shift while clicking on the second, third etc relevant column headers.

WARNING! Inclusion of a variant in this table does not automatically mean that it should be used for DNA testing. Anyone contemplating the use of any of these variants for DNA testing should examine critically the relevant evidence (especially in breeds other than the breed in which the variant was first described). If it is decided to proceed, the location and orientation of the variant sequence should be checked very carefully.

Since October 2021, OMIA includes a semiautomated lift-over pipeline to facilitate updates of genomic positions to a recent reference genome position. These changes to genomic positions are not always reflected in the ‘acknowledgements’ or ‘verbal description’ fields in this table.

OMIA Variant ID OMIA Phene-Species ID(s) Species Name Breed(s) Variant Phenotype Gene Allele Variant Type Variant Effect Source of Genetic Variant AVCG Pathogenicity Classification* Reference Sequence Chr. g. or m. c. or n. p. Verbal Description EVA ID Year Published PubMed ID(s) Acknowledgements
2 OMIA:000042-9031 chicken Wisconsin hypoalpha mutant (WHAM), United States of America (Chicken) Analphalipoproteinaemia ABCA1 substitution missense Naturally occurring variant Not currently evaluated GRCg6a Z NC_006127.5:g.54877918C>T NM_204145.2:c.265G>A NP_989476.1:p.(E89K) 2002 12364545 Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool
1126 OMIA:002238-9913 taurine cattle Shorthorn (Cattle) Ichthyosis, ABCA12-related ABCA12 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 2 g.103016791A>G c.6776T>C p.(L2259P) NM_001191294.2:c.6776T>C; NP_001178223.2:p.(Leu2259Pro) rs5334475100 2019 31568573
1220 OMIA:002238-9913 taurine cattle Polled Hereford (Cattle) Ichthyosis, ABCA12-related ABCA12 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 2 g.103043495_103043496insG c.5689_5690insC p.(S1784Ifs*33) BTA 2:103043495–103043496insG; ENSBTAT00000004518.6:c.5689‐5690insC; ENSBTAP00000004518.6:p.(Ser1784Ilefs*33) (Eager et al., 2020) rs3423092881 2020 32567073
195 OMIA:002238-9913 taurine cattle Chianina (Cattle) Ichthyosis, ABCA12-related ABCA12 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.103030489T>C NM_001191294.2:c.5804A>G NP_001178223.2:p.(H1935R) previously listed in OMIA as ARS-UCD1.2:g.103025585T>C,  g. coordinates have been corrected after review of original paper and incorrectly assigned EVA rs ID has been removed [29/08/2024] 2008 18344998
1861 OMIA:002238-9685 domestic cat Domestic Shorthair (Cat) Ichthyosis, ABCA12-related ABCA12 deletion, small (<=20) frameshift Not currently evaluated F.catus_Fca126_mat1.0 C1 NC_058375.1:g.199458885del XM_019838638.2:c.6600del XP_019694197.1:p.(T2201Pfs*9) published as XM_019838638.2:c.6926delC; ABCA12:p.Pro2201fsTer9 2025 41395671
1379 OMIA:002238-9823 pig Bama Xiang Zhu, China (Pig) Ichthyosis ABCA12 substitution splicing Chemical mutagenesis (ENU) Not currently evaluated Sscrofa11.1 15 NC_010457.5:g.117250799T>C Intronic mutation IVS49-727 A>G results in splicing alteration resulting in a 132-nt insertion and a premature stop codon (Wang et al., 2019) 2019 30925591
1050 OMIA:002179-9615 dog Labrador Retriever (Dog) Stargardt disease 1 ABCA4 insertion, small (<=20) frameshift Naturally occurring variant P CanFam3.1 6 NC_006588.3:g.55146556dup NM_001003360.2:c.4176dup NP_001003360.2:p.(F1393Lfs*3) Mäkeläinen et al. (2019): "ENSCAFT00000005367 exon28 4170dupC* V1390fs" Importantly, the same authors also explain in Table S3 that "*The insertion is found in a cytosine mononucleotide-repeat region [55,146,550–55,146,556] and it is arbitrary at what position the actual insertion occurs. In the text we have denoted the insertion as c.4176insC, p.F1393Lfs*1395)." Variant information changed to reflect HGVS nomenclature 2019 30889179
607 OMIA:001402-9615 dog Border Collie (Dog) Adverse reaction to certain drugs ABCB1 insertion, small (<=20) Naturally occurring variant Not currently evaluated CanFam3.1 14 CanFam3.1 published as c.73insAAT - the allele is reflected by the reference sequence CanFam3.1 and NM_001003215.2 as reference: g.13737172_13737174; c.73_75, p.N25; causality of this variant should be reviewed 2010 21113104
469 OMIA:001402-9615 dog Australian Shepherd (Dog) Border Collie (Dog) Collie (Dog) German Shepherd Dog (Dog) Long-Haired Whippet (Dog) Miniature Australian Shepherd Dog (Dog) Old English Sheepdog (Dog) Shetland Sheepdog (Dog) Silken Windhound (Dog) Waller (Dog) White Swiss Shepherd Dog (Dog) Adverse reaction to certain drugs ABCB1 mdr1-1Delta deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 14 NC_006596.3:g.13726596_13726599del NM_001003215.2:c.228_231del NP_001003215.2:p.(D77Afs*16) 2001 11692082 Variant information initially gleaned from or confirmed by Donner et al. (2016) PLoS One 11:e0161005 and later updated to reflect HGVS nomenclature.
442 OMIA:001402-9615 dog Border Collie (Dog) Huntaway (Dog) New Zealand Heading Dog (Dog) Adverse reaction to certain drugs ABCB1 substitution regulatory Naturally occurring variant Not currently evaluated CanFam3.1 14 NC_006596.3:g.13742402A>C published as Canfam2 chr14:16692274T>G, c.-6-180T>G, possible regulatory variant associated with resistance to phenobarbital treatment in epileptic Border Collies; an association between the variant and the phenotype was not supported in a different study: PMID: 31685133. Additional breeds based on PMID:40965331 rs852787132 2011 21488961 Genomic coordinates in CanFam3.1 and EVA ID provided by Zoe Shmidt and Robert Kuhn.
1322 OMIA:001402-9685 domestic cat Balinese (Cat) Domestic Longhair (Cat) Domestic Medium Hair (Cat) Domestic Shorthair (Cat) Maine Coon (Cat) Maine Coon Polydactyl (Cat) Ragdoll (Cat) Russian Blue (Cat) Siamese (Cat) Turkish Angora (Cat) Adverse reaction to certain drugs ABCB1 deletion, small (<=20) frameshift Naturally occurring variant Out of scope F.catus_Fca126_mat1.0 A2 NC_058369.1g.91572902_91572903del NM_001171064.2:c.1930_1931del published as ABCB1:1930_1931delTC; protein product is predicted to be severely truncated (~50%) and non functional  2015 25660379 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Additional breeds reported based on PMID:34125616 and PMID:35709088. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1574 OMIA:002710-9615 dog Manchester Terrier (Dog) Cardiomyopathy, dilated, ABCC9-related ABCC9 SCDY/DCM substitution missense Naturally occurring variant LP Dog10K_Boxer_Tasha 27 NC_006609.4:g.21042635C>T XM_022410972.2:c.3557G>A XP_022266680.2:p.(R1186Q) XM_022410972.2; XP_022266680.2 2023 37239348
1499 OMIA:002589-8839 Mallard Blue eggshell ABCG2 haplotype regulatory Naturally occurring variant Not currently evaluated BGI_duck1.0 NW_004676534.1 g.[3573054A>G;3573085A>G] The BGI_duck1.0 reference genome represents the blue eggshell genotype. 2020 33186356
1477 OMIA:002561-9913 taurine cattle Deutsche Holstein Schwarzbunt, Germany (Cattle) Infertility ABHD16B substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 13 NC_037340.1:g.53957903G>A NM_001038541.2:c.652C>T NP_001033630.1:p.(Q218*) ENSBTAT00000045249.4; ENSBTAP00000055253.1 rs468948776 2020 31963602
1388 OMIA:002368-9615 dog Golden Retriever (Dog) Ichthyosis, ABHD5-related ABHD5 ICH2 deletion, small (<=20) frameshift Naturally occurring variant P CanFam3.1 23 NC_006605.3:g.2587000_2587013del XM_542689.5:c.1006_1019del XP_542689.2:p.(D336Sfs*6) 2022 34791225
1504 OMIA:002594-9823 pig N-acetyl-galactosamine intestinal concentration ABO deletion, gross (>20) Naturally occurring variant Not currently evaluated 1 2.3kb deletion encompassing exon 8 2022 35477154
1177 OMIA:001089-9542 Japanese macaque Antigen B ABO haplotype Naturally occurring variant Not currently evaluated Allele B reflects the peptide haplotype p.266Met + p.268Ala 2000 10984838
21 OMIA:001089-9544 Rhesus monkey Antigen A ABO haplotype Naturally occurring variant Not currently evaluated p.266L + p.268G Allele A is reflected in the peptide haplotype p.266Leu + p.268Gly 1998 9583803
20 OMIA:001089-9541 crab-eating macaque A antigen ABO haplotype Naturally occurring variant Not currently evaluated p.266L + p.268G Allele A is reflected in the peptide haplotype p.266Leu + p.268Gly 1998 9583803
1174 OMIA:001089-9544 Rhesus monkey Antigen B ABO haplotype Naturally occurring variant Not currently evaluated p.266M + p.268A Allele B is a reflection of the peptide haplotype p.266Met + p.268Ala 1998 9583803
1175 OMIA:001089-9541 crab-eating macaque B antigen ABO haplotype Naturally occurring variant Not currently evaluated p.266M + p.268A Allele B is a reflection of the peptide haplotype p.266Met + p.268Ala 1998 9583803
22 OMIA:001089-9579 agile gibbon Alleles A and B ABO haplotype missense Naturally occurring variant Not currently evaluated c.2178C>A and c.2185G>C Haplotype c.2178C + c.2185G is allele A; haplotype c.2178A + c.2185C is allele B 2009 19298858
23 OMIA:001089-9580 common gibbon Blood group system ABO ABO haplotype missense Naturally occurring variant Not currently evaluated c.2178C>A and c.2185G>C 2009 19298858
532 OMIA:001089-9598 chimpanzee O (lack of antigen) ABO O^del deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated c.514_522delGTGCTGGAG p.(V172-E174del) 1999 10380696
24 OMIA:001089-9598 chimpanzee O (lack of antigen) ABO O^x substitution missense Naturally occurring variant Not currently evaluated c.791A>C p.(Y264C) 1999 10380696
1497 OMIA:002585-9615 dog Cavalier King Charles Spaniel (Dog) medium-chain acyl-CoA dehydrogenase ACADM delins, gross (>20) frameshift Naturally occurring variant P UU_Cfam_GSD_1.0 6 NC_049227.1:g.71401388_71401389delinsCATAATTCTTAGACAATATTGAGAATTAAC XM_038541645.1:c.444_445delinsGTTAATTCTCAATATTGTCTAAGAATTATG XP_038397573.1:p.(T150Ifs*6) 2022 36292732
972 OMIA:002140-9615 dog German Hunting Terrier (Dog) Exercise induced metabolic myopathy ACADVL substitution nonsense (stop-gain) Naturally occurring variant P CanFam3.1 5 NC_006587.3:g.32193689C>A XM_546581.5:c.1728C>A XP_546581.3:p.(Y576*) XM_546581.5; XP_546581.3 2018 29491033
429 OMIA:001271-9913 taurine cattle Dexter (Cattle) Bulldog calf ACAN BD2 substitution regulatory Naturally occurring variant Not currently evaluated ARS-UCD1.2 21 g.20377856C>T c.-198C>T rs3423095877 2007 17952705 Variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
590 OMIA:001271-9913 taurine cattle Dexter (Cattle) Highland (Cattle) Bulldog calf ACAN BD1 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 21 g.20422104_20422105insGGCA c.2266_2267insGGCA Variant initially identified in Dexter cattle and later reported in additional breeds: PMID:26885599 2007 17952705 Variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1060 OMIA:001271-9915 indicine cattle (zebu) Miniature Zebu, United Kingdom of Great Britain and Northern Ireland (Cattle) Bulldog calf ACAN insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 21 g.20428539_20428540insC c.5688_5689insC p.(V1897fs*9) cDNA position based on transcript NM_173981.2 2018 30305023
1001 OMIA:001271-9796 domestic horse Miniature Horse (Horse) Dwarfism, ACAN-related ACAN D4 deletion, gross (>20) deletion (in-frame) Naturally occurring variant LP/P EquCab3.0 1 NC_009144.3:g.95257479_95257499del XM_005602799.2:c.7633_7653del XP_005602856.2:p.(F2545_C2551del) Genomic positions were previosuly incorreclty listed in OMIA as g.95257458_95257500del (until 10/01/2022) and g.95257480_95257500del (until 13/06/2024). Coordinates presented in the table reflect the published rs1095048839. IT is thanking Rebecca Bellone for spotting an error in the genomic coordinates which are now corrected (26/11/2024).

rs1095048839 2018 30058072
1792 OMIA:001271-9796 domestic horse Miniature Horse (Horse) Dwarfism, ACAN-related ACAN D5 substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 1 NC_009144.3:g.95258999C>T XM_005602799.2:c.7435G>A XP_005602856.2:p.(A2479T) 2023 Reference not in PubMed; see OMIA 001271-9796 for reference details
788 OMIA:001271-9796 domestic horse Miniature Horse (Horse) Shetland Pony (Horse) Dwarfism, ACAN-related ACAN D3* substitution missense Naturally occurring variant LP/P EquCab3.0 1 NC_009144.3:g.95282140C>G XM_023650286.1:c.1513G>C XP_023506054.1:p.(A505P) ENSECAT00000040213.1:c.1513G>C ENSECAP00000032890.1:p.Ala505Pro This variant was named D3* by Eberth et al. (2018) rs1095048823 2017 27942904 Variant coordinates obtained from Eberth et al. (2018) and EVA_ID link
1000 OMIA:001271-9796 domestic horse Miniature Horse (Horse) Quarter Horse (Horse) Warmblood (Horse) Dwarfism, ACAN-related ACAN D2 substitution missense Naturally occurring variant LP EquCab3.0 1 NC_009144.3:g.95284530C>T XM_023650286.1:c.1270G>A XP_023506054.1:p.(V424M) rs3091781465 2018 30058072 c. coordinates previously listed incorrectly as XP_023506054.1:c.1270C>T, updated based on feedback from Matt Gehring [05/07/2026].  Breed information updated based on PMID: 38600096
999 OMIA:001271-9796 domestic horse Miniature Horse (Horse) Shetland Pony (Horse) Dwarfism, ACAN-related ACAN D1 deletion, small (<=20) frameshift Naturally occurring variant P EquCab3.0 1 NC_009144.3:g.95291271del XM_023650281.1:c.245del XP_023506054.1:p.(K82Rfs*54) 220110: changed g.95291270del to g.95291271del based on HGVS 3'rule. ENSECAT00000040213.1:c.245del ENSECAP00000032890.1:p.Lys82ArgfsTer54 rs1095048841 2018 30058072 Breed information updated based on PMID: 38600096
323 OMIA:000702-9031 chicken Nanomelia ACAN substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated GRCg6a 10 g.13502829C>A c.4537G>T p.(E1513*) 1994 7827752 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1045 OMIA:002177-9615 dog Akita (Dog) American Akita (Dog) Amelogenesis imperfecta, ACP4-related ACPT insertion, small (<=20) frameshift Naturally occurring variant P CanFam3.1 1 NC_006583.3:g.106051997dupC XM_541473.2:c.1189dupG XP_541473.2:p.(A397Gfs) ACPT is a synonym of ACP4 2019 30877375
1419 OMIA:002226-9913 taurine cattle Brown Swiss (Cattle) Haplotype with homozygous deficiency BH34 ACSL5 BH34 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 26 NC_037353.1:g.32940521C>G NM_001075650.1:c.528C>G NP_001069118.1:p.(N176K) NM_001075650.1 rs5357452907 2021 34915862
1259 OMIA:002226-9615 dog Australian Kelpie (Dog) Intestinal lipid malabsorption ACSL5 deletion, gross (>20) Naturally occurring variant P CanFam3.1 28 NC_006610.3:g.23380074_23483377del 2020 33106515
1073 OMIA:000388-9685 domestic cat Domestic Shorthair (Cat) Fibrodysplasia ossificans progressiva ACVR1 substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 C1 NC_058375.1:g.147442389C>T XM_045033838.1:c.617G>A XP_044889773.1:p.(R206H) 2019 31007133 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
633 OMIA:001520-9615 dog Glen of Imaal Terrier (Dog) Cone-rod dystrophy 3 ADAM9 deletion, gross (>20) frameshift Naturally occurring variant P 16 "a deletion of exons 15 and 16 which alters the reading frame leading to a premature stop codon" in the ADAM9 gene 2010 20691256
43 OMIA:001870-9615 dog Beagle (Dog) Glaucoma, primary open angle ADAMTS10 substitution missense Naturally occurring variant P CanFam3.1 20 NC_006602.3:g.53096339C>T XM_022406266.1:c.1981G>A XP_022261974.1:p.(G661R) XM_849227.3; XP_854320.1 2011 21379321
101 OMIA:001870-9615 dog Norwegian Elkhound (Dog) Glaucoma, primary open angle ADAMTS10 substitution missense Naturally occurring variant P CanFam3.1 20 NC_006602.3:g.53101896C>T XM_022406266.1:c.1159G>A XP_022261974.1:p.(A387T) XM_849227.3; XP_854320.1 2014 25372548 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
685 OMIA:001976-9615 dog Basset Hound (Dog) Glaucoma, primary open angle, ADAMTS17-related ADAMTS17 deletion, small (<=20) frameshift Naturally occurring variant P CanFam3.1 3 NC_006585.3:g.40614853_40614872del XM_022416850.1:c.194_213del XP_022272558.1:p.(L68Gfs*) 2015 26474315
365 OMIA:000588-9615 dog American Toy Terrier (Dog) Chinese Crested (Dog) German Hunting Terrier (Dog) Jack Russell Terrier (Dog) Lancashire Heeler (Dog) Miniature Bull Terrier (Dog) Parson Russell Terrier (Dog) Patterdale Terrier (Dog) Rat Terrier (Dog) Sealyham Terrier (Dog) Tenterfield Terrier (Dog) Tibetan Terrier (Dog) Toy Fox Terrier (Dog) Volpino Italiano (Dog) Welsh Terrier (Dog) Wire Fox Terrier (Dog) Yorkshire Terrier (Dog) Lens luxation ADAMTS17 substitution splicing Naturally occurring variant P CanFam3.1 3 NC_006585.3:g.40782144G>A XM_022416850.1:c.1473+1G>A XM_022416850.1; additional breeds reported by PMID:22050825 and PMID:37582787 rs1152388408 2010 20375329 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
96 OMIA:001976-9615 dog Basset Fauve de Bretagne (Dog) Glaucoma, primary open angle, ADAMTS17-related ADAMTS17 substitution missense Naturally occurring variant LP/P CanFam3.1 3 NC_006585.3:g.40808345G>A XM_022416851.1:c.1552G>A XP_022272559.1:p.(G518S) XM_022416851.1; XP_022272559.1 2015 26474315 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1086 OMIA:001976-9615 dog Petit Basset Griffon Vendeen (Dog) Glaucoma, primary open angle, ADAMTS17-related ADAMTS17 inversion Naturally occurring variant P CanFam3.1 3 NC_006585.3:g.40812274_45768123inv XM_545825.4:c.1721+2668_*4831255inv Forman et al. (2015): "a 4.96 Mb inversion . . . with breakpoints in intron 12 of ADAMTS17 (chr3:40,812,274) and a downstream intergenic region (chr3:45,768,123) [Canfam3.1]… Analysis of RNAseq data revealed novel exon expression for ADAMTS17 due to cryptic splicing occurring 3’ of the exons located immediately upstream of the inversion event." 2015 26683476
942 OMIA:000588-9615 OMIA:001976-9615 dog Chinese Shar-Pei (Dog) Primary open-angle glaucoma (POAG), primary lens luxation (PLL), or both ADAMTS17 deletion, small (<=20) deletion (in-frame) Naturally occurring variant LP/P CanFam3.1 3 NC_006585.3:g.40935387_40935392del XM_014112382.2:c.3069_3074del XP_013967857.1:p.(V1024_V1025del) published as c.3070_3075delCGTGGT; p.(V1025_V1026del) 2018 29287154
486 OMIA:000328-9913 taurine cattle Belgian Blue (Cattle) Ehlers-Danlos syndrome, type VII (Dermatosparaxis) ADAMTS2 delins, small (<=20) Naturally occurring variant Not currently evaluated ARS-UCD1.2 7 g.2017035_2017051delinsAGC c.464_480delinsAGC 1999 10417273 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
1513 OMIA:000328-9615 dog Alapaha Blue Blood Bulldog (Dog) American Pit Bull Terrier (Dog) Ehlers-Danlos syndrome, type VII (Dermatosparaxis) ADAMTS2 deletion, small (<=20) frameshift Naturally occurring variant P CanFam3.1 11 NC_006593.3:g.2280117del XM_843844.4:c.10del p.(P4Rfs*175) delC 2022 36421833
1117 OMIA:000328-9615 dog Doberman Pinscher (Dog) Ehlers-Danlos syndrome, type VII (Dermatosparaxis) ADAMTS2 substitution nonsense (stop-gain) Naturally occurring variant P CanFam3.1 11 NC_006593.3:g.2408978C>T XM_843844.4:c.769C>T XP_848937.1:p.(R257*) 2019 31294848
1514 OMIA:000328-9615 dog Catahoula Leopard Dog (Dog) Ehlers-Danlos syndrome, type VII (Dermatosparaxis) ADAMTS2 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 11 NC_006593.3:g.2491238G>A XM_843844.4:c.2897G>A XP_848937.1:p.(R966H) 2022 36421833
1589 OMIA:000328-9685 domestic cat Domestic Shorthair (Cat) Ehlers-Danlos syndrome ADAMTS2 delins, small (<=20) frameshift Naturally occurring variant P F.catus_Fca126_mat1.0 A1 NC_058368.1:g.90995621dup XM_023254116.2:c.698dup XP_023109884.2:p.(S235Qfs*3) 2023 37462293
318 OMIA:000328-9940 sheep Dorper (Sheep) Ehlers-Danlos syndrome, type VII (Dermatosparaxis) ADAMTS2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 5 NC_040256.1:g.1938399G>T XM_027969213.1:c.424G>T XP_027825014.1:p.(E142*) XM_012156230:c.424G>T, XP_012011620:p.Glu142* (Joller et al., 2017) 2012 22497338 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
857 OMIA:000328-9940 sheep Dorper (Sheep) Ehlers-Danlos syndrome, type VII (Dermatosparaxis) ADAMTS2 substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 5 NC_040256.1:g.2088231G>A XP_027825015.1:c.673G>A XP_027825015.1:p.(V225M) Published as g.1862883G>A /  (V15M),  previously listed in OMIA as XM_012156230:c.805G>A, XP_012011620:p.Val269Met based on Joller et al., 2017; coordinates in this table updated to a recent reference genome [10/06/2025] 2015 25354687 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
537 OMIA:001140-9615 dog Nova Scotia Duck Tolling Retriever (Dog) Cleft lip with or without cleft palate ADAMTS20 deletion, small (<=20) frameshift Naturally occurring variant P CanFam3.1 27 NC_006609.3:g.10553479_10553480del XM_022410988.1:c.1358_1359del XP_022266696.1:p.(K453Ifs*4) published as c.1360_1361delAA and p.(K453Ifs*3); coordinates in the table have been updated to a recent reference genome and / or transcript and HGVS nomenclature 2015 25798845 Genomic position in CanFam3.1 provided by Mateo Etcheveste and Robert Kuhn.
1163 OMIA:001562-9913 taurine cattle Cikasto govedo, Slovenia (Cattle) Pulmonary hypoplasia and anasarca syndrome ADAMTS3 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 6 NC_037333.1:g.87462016G>A NM_001192797.1:c.1222C>T NP_001179726.1:p.(H408T) NM_001192797.1: c.1222C>T; NP_001179726.1: p.(His408Tyr) (Häfliger et al., 2020) rs5334475098 2020 32069517
1750 OMIA:001562-9940 sheep Persian (Sheep) Pulmonary hypoplasia with anasarca ADAMTS3 deletion, small (<=20) splicing Naturally occurring variant Not currently evaluated Oarv3.1 6 NC_019463.1:g.87124344del XM_012180125.1:c.2055+3del XP_012035515.1:p.(V680_V685del) the variant results in the activation of a cryptic splice site within exon 14 2024 39409761
60 OMIA:001509-9615 dog Beagle (Dog) Musladin-Lueke syndrome ADAMTSL2 substitution missense Naturally occurring variant LP/P CanFam3.1 9 NC_006591.3:g.49931561C>T XM_014116955.2:c.661C>T XP_013972430.1:p.(R221C) 2010 20862248 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
935 OMIA:001511-9913 taurine cattle Angus (Cattle) Contractual arachnodactyly (Fawn calf syndrome) ADAMTSL3 deletion, gross (>20) Naturally occurring variant Not currently evaluated 21 "a large (~58 kilobase pair) deletion affecting the ADAMTSL3 gene" 2014 Reference not in PubMed; see OMIA 001511-9913 for reference details
1435 OMIA:002535-9913 taurine cattle Original Swiss Brown (Cattle) Congenital cataract ADAMTSL4 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 3 NC_037330.1:g.20146737C>T NM_001101061.1:c.2327G>A NP_001094531.1:p.(R776H) NM_001101061.1; NP_001094531.1 rs5353205567 2022 35233794
466 OMIA:001577-9615 dog Curly Coated Retriever (Dog) Glycogen storage disease IIIa AGL deletion, small (<=20) frameshift Naturally occurring variant P CanFam3.1 6 NC_006588.3:g.50050457del NM_001048096.1:c.4223del NP_001041561.1:p.(K1408Sfs*6) published as c.4223delA; genomic position adjusted to HGVS 3' rule 2007 17338148 Genomic and protein coordinates in CanFam3.1 provided by Robert Kuhn
934 OMIA:002135-9913 taurine cattle Angus (Cattle) Arthrogryposis multiplex congenita, AGRN-related AGRN deletion, gross (>20) Naturally occurring variant Not currently evaluated 16 A 23,363 bp deletion "encompasses the entirety of the ISG15 ubiquitin-like modifier (ISG15) gene . . . one or both of the 5' regulatory region of the hairy and enhancer split 4 (HES4) and of the agrin (AGRN) gene and of the first two exons of the AGRN gene" (Beever and Marron, 2011) 2011 Reference not in PubMed; see OMIA 002135-9913 for reference details
233 OMIA:000662-9940 sheep Romney Marsh (Sheep) Motor neuron disease, lower AGTPBP1 substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 2 NC_040253.1:g.35795594G>C XM_015093043.2:c.2909G>C XP_014948529.2:p.(R970P) protein and cDNA positions are based on XP_014948529.2 and XM_015093043.2, respectively 2012 22588130 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
75 OMIA:001672-9615 dog Coton de Tulear (Dog) Primary hyperoxaluria type I (Oxalosis I) AGXT substitution missense Naturally occurring variant P CanFam3.1 25 NC_006607.3:g.50968854G>A XM_003639891.4:c.304G>A XP_003639939.1:p.(G102S) rs397510072 2012 22486513 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1252 OMIA:001672-9940 sheep Zwartbles (Sheep) Type 1 Primary Hyperoxaluria AGXT substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 1 NC_040252.1:g.801189C>T XM_027966918.1:c.584G>A XP_027822719.1:p.(C195Y) NC_040252.1: g.801189C>T; XM_027966918.1: c.584G>A; XP_027822719.1: p.Cys195Tyr (Letko et al., 2020) 2020 33003365
1214 OMIA:001222-9685 domestic cat Persian (Cat) Leber congenital amaurosis AIPL1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 E1 NC_058381.1:g.940554C>T XM_045044616.1:c.577C>T XP_044900551.1:p.(R193*) 2016 27030474 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1629 OMIA:002788-9913 taurine cattle Holstein Friesian (Cattle) Subfertility, AK9-related AK9 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.2 9 g.40620329A>G rs457222030 2021 34028060
1094 OMIA:002205-9615 dog Collie Rough (Dog) Recurrent inflammatory pulmonary disease AKNA deletion, small (<=20) frameshift Naturally occurring variant P CanFam3.1 11 NC_006593.3:g.68576241_68576244del XM_014117950.2:c.2717_2720delACAG XP_013973425.1:p.(D906Afs*173) 2019 31357536
1801 OMIA:002956-176072 dusky lory Feather colour, red ALDH3A2 substitution regulatory Naturally occurring variant Not currently evaluated scaffold_13:6288712T>C 2024 39480920
1240 OMIA:002250-9615 dog Saluki (Dog) Succinic Semialdehyde Dehydrogenase Deficiency ALDH5A1 substitution missense Naturally occurring variant P CanFam3.1 35 NC_006617.3:g.22572768G>A XM_014110599.2:c.866G>A XP_013966074.2:p.(G288D) XM_014110599.2: c.866G>A; XP_013966074.2: p.(Gly288Asp) (Vernau et al., 2020) 2020 32887425
1292 OMIA:002316-9685 domestic cat American Shorthair (Cat) British Longhair (Cat) British Shorthair (Cat) Devon Rex (Cat) Exotic Shorthair (Cat) Maine Coon (Cat) Munchkin (Cat) Ragdoll (Cat) Scottish Fold (Cat) Sphynx (Cat) Cardiomyopathy, hypertrophic ALMS1 substitution missense Naturally occurring variant VUS F.catus_Fca126_mat1.0 A3 NC_058370.1:g.89899157G>C XM_045054402.1:c.11647G>C XP_044910337.1:p.(G3883R) cDNA and protein positions have been predicted using Ensemble VEP based on transcript ENSFCAT00000077013.1; variant initially reported in Sphynx cats and in a later study (Akiyama et al., 2023) identified in other breeds. Turba et al., 2023 report additional variants in the vicinity that can result in allele dropout in DNA tests and indicate "the need to verify the correspondence between the [Felis_catus_9.0:}g.92439157 C variant frequency and the prevalence of HCM" due to high allele frequency of the variant in Sphynx cats in their study. Seo et al. (2024) also identified this variant frequently in  Sphynx cats but reported that the variant "was not associated with the HCM diagnosis in the studied population."
Additional breeds in which the variant has been reported are based on PMID:38371598. c. coordinates were previouly listed in OMIA based on transcript ENSFCAT00000077013.1:c.7384G>C / p.(G2462R).
rs5334475133 2021 33639992 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1834 OMIA:003011-9615 dog Chihuahua (Dog) ichthyosis, ALOXE3-related ALOXE3 substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 5 NC_049226.1:g.33136922C>T XM_038536792.1:c.1379G>A XP_038392720.1:p.(G460D) 2025 41057024
1021 OMIA:002162-9615 dog Karelian Bear Dog (Dog) Hypophosphatasia ALPL substitution missense Naturally occurring variant P CanFam3.1 2 NC_006584.3:g.77561953A>C XM_005617214.3:c.1301T>G XP_005617271.1:p.(V434G) XM_005617214.3; XP_005617271.1 2019 30700765
1486 OMIA:002162-9940 sheep Hypophosphatasia ALPL substitution missense Genome-editing (CRISPR-Cas9) Not currently evaluated Oar_rambouillet_v1.0 2 NC_040253.1:g.260716094G>C XM_027965561.1:c.1077C>G XP_027821362.1:p.(I359M) XM_027965561.1; XP_027821362.1 2018 30446691
1828 OMIA:001492-9940 sheep Merino (Sheep) Axonopathy, segmental ALS2 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UI_Ramb_v2.0 2 NC_056055.1:g.204020069-204020070del NC_056055.1:g.204020069-204020070del XP_011998058.1:p.(L1380Gfs*17) 2025 41131452
550 OMIA:002717-9685 domestic cat Burmese (Cat) Brachycephaly ALX1 deletion, small (<=20) deletion (in-frame) Naturally occurring variant P F.catus_Fca126_mat1.0 B4 NC_058374.1:g.107855022_107855033del XM_003989090.5:c.497_508del XP_003989139.1:p.(A166_T169del) published as c.496delCTCTCAGGACTG 2016 26610632 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
764 OMIA:001009-9913 taurine cattle Shorthorn (Cattle) Tibial hemimelia ALX4 deletion, gross (>20) Naturally occurring variant Not currently evaluated 15 Deletion of 45,694 bp including exon 1 of ALX4 2012 Reference not in PubMed; see OMIA 001009-9913 for reference details
763 OMIA:001009-9913 taurine cattle Galloway (Cattle) Tibial hemimelia ALX4 ALX4dup-GAU / ALX4dup-LfL duplication frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 15 NC_037342.1:g.74384919_74384938dup NM_001030304.1:c.713_732dup NP_001025475.1:p.(Q245fs) Initially reported as g.75154399_75154418dup in UMD3.1 and g.74384916_74384935dup in ARS-UCD1.2.. Updated  to current coordinates after publication of a correction by the authors (PMID: 39298916) [23/09/2024]. The variant is now identical to a variant reported by Buitkamp et al. (2023, PMID:36585373), which was previously listed as omia.variant:1516. Both variants are now merged into one entry and omia.variant:1516 is redundant. 2015 26076463 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. The same ARS-UCD1.2 location in the reverse order was included in the paper by Buitkamp et al. (2022). The allele name ALX4dup-GAU was also given by Buitkamp et al. (2022).
280 OMIA:002775-9615 dog Miniature Schnauzer (Dog) Persistent Mullerian duct syndrome AMHR2 substitution nonsense (stop-gain) Naturally occurring variant P CanFam3.1 27 NC_006609.3:g.1794738G>A XM_543632.6:c.262C>T XP_543632.4:p.(R88*) XM_543632.6; XP_543632.4; published as c.241C>T; coordinates in the table have been updated to a recent reference genome and / or transcript 2009 18723470
639 OMIA:000565-9615 dog Giant Schnauzer (Dog) Intestinal cobalamin malabsorption, AMN-related AMN deletion, gross (>20) deletion (in-frame) Naturally occurring variant P CanFam3.1 8 NC_006590.3:g.70807271_70807303del NM_001002960.1:c.1113_1145del NP_001002960.1:p.(G372_A382del) 2005 15845892 Genomic position in CanFam3.1 provided by Robert Kuhn and Mateo Etcheveste.
426 OMIA:000565-9615 dog Australian Shepherd (Dog) Intestinal cobalamin malabsorption, AMN-related AMN substitution start-lost Naturally occurring variant P ROS_Cfam_1.0 8 NC_051812.1:g.71077084G>A NM_001002960.1:c.3G>A NP_001002960.1:p.(M1?) NM_001002960.1; NP_001002960.1 2005 15845892
1677 OMIA:002838-9615 dog Cirneco dell'Etna (Dog) Cirneco oculo-neurological syndrome AMPD2 CONS deletion, small (<=20) frameshift Naturally occurring variant P UU_Cfam_GSD_1.0 6 NC_049227.1:g.42698170del XM_038541065.1:c.2131del XP_038396993.1:p.(D711Mfs12*) 2024 38397227
353 OMIA:002539-9615 dog Dalmatian (Dog) Respiratory distress syndrome ANLN substitution nonsense (stop-gain) Naturally occurring variant P CanFam3.1 14 NC_006596.3:g.47812143C>T XM_005628719.3:c.31C>T XP_005628776.1:p.(R11*) 2017 28222102 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
422 OMIA:001353-9615 dog American Staffordshire Terrier (Dog) Australian Cattle Dog (Dog) Beagle (Dog) Belgian Shepherd Dog, Malinois (Dog) Chinese Crested (Dog) German Shepherd Dog (Dog) Great Pyrenees (Dog) Labrador Retriever (Dog) Perro de Presa Canario (Dog) Siberian Husky (Dog) Platelet receptor for factor X, deficiency of ANO6 substitution splicing Naturally occurring variant P CanFam3.1 27 NC_006609.3:g.8912219C>T XM_005636953.1:c.1934+1G>A Initially reported in German Shepherds - additional breeds based on PMID: 36848397. 2015 26414452 Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool
927 OMIA:002083-9913 taurine cattle Japanese Black, Japan (Cattle) Abortion (embryonic lethality), ANXA10-related ANXA10 repeat variation Naturally occurring variant Not currently evaluated 8 "a "34-kb deleted-type" CNV "associated with embryonic mortality at 30-60 days after artificial insemination. The CNV harbors exon 2 to 6 of ANNEXIN A10 (ANXA10). . . . Western blot analysis showed that the CNV results in a null allele of ANXA10." 2016 27881083
580 OMIA:000248-9615 dog Collie (Dog) Neutropenia, cyclic AP3B1 insertion, small (<=20) frameshift Naturally occurring variant P CanFam3.1 3 NC_006585.3:g.28663129_28663130insA NM_001002974.2:c.2407_2408insA NP_001002974.1:p.(T803Nfs*5) rs1152388405 2003 12897784
286 OMIA:000001-9913 taurine cattle Blanco Orejinegro, Colombia (Cattle) Holstein Friesian (Cattle) Abortion due to a nonsense mutation in APAF1 on haplotype HH1 APAF1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 g.62810245C>T XM_015471110.2:c.1735C>T XP_015326596.1:p.(Q579*) Variant initially reported in Holstein Friesian cattle and later reported in additional breeds: PMID:34779908. Previously listed in OMIA as: p.(Q581*), c.1741C>T, updated to recent transcript information [03/09/2024] rs448942533 2016 27289157 Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1206 OMIA:001916-9615 dog Jack Russell Terrier (Dog) Familial Adenomatous Polyposis APC delins, small (<=20) Naturally occurring variant P CanFam3.1 3 NC_006585.3:g.312131_312132delinsAA XM_014111995.2:c.[462_463delinsTT] XP_013967470.1:p.(K155*) 2020 32445578 Reference assembly and genomic location kindly provided by Kyoko Yoshizaki, 17 Dec 2020
1897 OMIA:001916-9796 domestic horse Pony (Horse) Familial adenomatous polyposis APC delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated EquCab3.0 14 NC_009157.3:g.58546516dup NM_001301314.1:c.4656dup NP_001288243.1:p.(E1553Rfs*9) Published as g.58546511C>CT; p.(E1527Rfs*9); c.4578dup - coordinates in this table presented based on HGVS 3' rule and NCBI reference transcript.     2026 42038751
731 OMIA:001965-9913 taurine cattle Holstein Friesian (Cattle) Simmental (Cattle) Swiss Fleckvieh (Cattle) Holstein cholesterol deficiency APOB insertion, gross (>20) frameshift Naturally occurring variant Not currently evaluated 11 "1.3kb insertion of a transposable LTR element (ERV2-1) in the coding sequence of the APOB gene, which leads to truncated transcripts and aberrant splicing [p.Gly135ValfsX10)]" 2016 26763170 Additional breed inforamtion based on PMID: 40312951
436 OMIA:000991-9796 domestic horse Quarter Horse (Horse) Androgen insensitivity syndrome (AIS) AR substitution regulatory Naturally occurring variant LP/P EquCab3.0 X NC_009175.3:g.52728703A>G NM_001163891.1:c.1A>G  mutation in start codon for  NP_001157363.1; 2012 22095250 The genomic position in EquCab3.0 was provided by Ceara Mulvey, working under the guidance of Professor Ernie Bailey in April 2022
1143 OMIA:000991-9796 domestic horse Tennessee Walking Horse (Horse) Androgen insensitivity syndrome (AIS) AR deletion, small (<=20) frameshift Naturally occurring variant LP/P EquCab3.0 X NC_009175.3:g.52728885del NM_001163891.1:c.183del NP_001157363.1:p.(R63Gfs) published as c.183delT and p.(Ser61fs); c. and p. information in the table has been updated to HGVS nomenclature 2020 31936796 The genomic position in EquCab3.0 was provided by Ceara Mulvey, working under the guidance of Professor Ernie Bailey in April 2022
783 OMIA:000991-9796 domestic horse Warmblood (Horse) Androgen insensitivity syndrome AR deletion, gross (>20) frameshift Naturally occurring variant P EquCab3.0 X NC_009175.3:g.52808634_52808658del NM_001163891.1:c.1630_1654del the deletion is predicted to create a frameshift: "resulting in altered amino acid composition from p.543Lys and a premature stop codon 44 amino acid residues downstream in exon 3 2017 28192783
786 OMIA:000991-9796 domestic horse Thoroughbred (Horse) Androgen insensitivity syndrome AR substitution missense Naturally occurring variant P EquCab3.0 X NC_009175.3:g.52872393G>C NM_001163891.1:c.2042G>C NP_001157363.1:p.(W681S) 2016 27073903 The genomic position in EquCab3.0 was provided by Ceara Mulvey, working under the guidance of Professor Ernie Bailey in April 2022; p. coordinates obtained from Villagomez et al. (2019)
1144 OMIA:000991-9796 domestic horse Thoroughbred (Horse) Androgen insensitivity syndrome (AIS) AR substitution missense Naturally occurring variant LP EquCab3.0 X NC_009175.3:g.52878093C>T NM_001163891.1:c.2132C>T NP_001157363.1:p.(A711V) 2020 31936796
1895 OMIA:000991-9796 domestic horse Thoroughbred (Horse) Androgen insensitivity syndrome AR substitution splicing Naturally occurring variant Not currently evaluated TB-T2T X NC_091715.1:64377280T>C NM_001163891.1:c.2204+2T>C 2026 42036781
1752 OMIA:001201-9685 domestic cat Orange coat colour ARHGAP36 deletion, gross (>20) Naturally occurring variant Not currently evaluated Felis_catus_9.0 X NC_018741.3:g.110432079_110437152del Published by Toh et al. (2024) as g.109186183_109191258del based on the AnAms1.0 reference genome (Matsumoto et al., 2024).  This deletion is located within the first intron of ARHGAP36 (Toh et al., 2024). Coordinates in this table are based on a reference genome avialable in the NCBI genome data viewer. The cat sequenced for F.catus_Fca126_mat1.0 is orange - the coordinates for the breakpoints are NC_058386.1:107721951_107721952. 2024 39605675
960 OMIA:001917-9615 dog Leonberger (Dog) Saint Bernard (Dog) Polyneuropathy, ARHGEF10-related ARHGEF10 deletion, small (<=20) splicing Naturally occurring variant LP/P CanFam3.1 16 NC_006598.3:g.54349199_54349208del XM_005630036.3:c.1955_1958+6del published as c.1955_1958+6delCACGGTGAGC - eliminating the 3'-splice junction of exon 17 and creating an alternate splice site leading to a truncated protein 2014 25275565 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
780 OMIA:001334-9913 taurine cattle Swedish Red (Cattle) Sperm, short tail ARMC3 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 13 g.24024660del c.1442del p.(A451fs*26) rs797454424 2016 26923438 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
56 OMIA:000666-9615 dog Miniature Schnauzer (Dog) Mucopolysaccharidosis VI ARSB deletion, gross (>20) Naturally occurring variant P CanFam3.1 3 NC_006585.3:g.27870127_27870182del NM_001048133.1:c.-24_32del 2020 32985704 g. coordinate kindly provided by Karthik Raj 29 Oct 2020
640 OMIA:000666-9615 dog Poodle, Miniature (Dog) Mucopolysaccharidosis VI ARSB deletion, gross (>20) frameshift Naturally occurring variant P CanFam3.1 3 NC_006585.3:g.27870253_27870274del NM_001048133.1:c.103_124del NP_001041598.1:p.(A35Gfs*108) 2012 22329490 Variant information initially provided by Karthik Raj and Urs Giger
859 OMIA:000666-9615 dog Great Dane (Dog) Mucopolysaccharidosis VI ARSB substitution nonsense (stop-gain) Naturally occurring variant P CanFam3.1 3 NC_006585.3:g.27870445C>T NM_001048133.1:c.295C>T NP_001041598.1:p.(Q99*) NM_001048133.1; NP_001041598.1 2018 29157190 Variant information initially provided by Karthik Raj and Urs Giger, and confirmed by Ensembl's VEP
1258 OMIA:000666-9615 dog Miniature Pinscher (Dog) Mucopolysaccharidosis VI ARSB substitution missense Naturally occurring variant LP/P CanFam3.1 3 NC_006585.3:g.27950471G>A NM_001048133.1:c.910G>A NP_001041598.1:p.(G304R) NM_001048133.1; NP_001041598.1 2020 32985704 g. coordinate kindly provided by Karthik Raj 29 Oct 2020
1320 OMIA:000666-9685 domestic cat Siamese (Cat) Mucopolysaccharidosis VI, mild, in L476P/D520N cats ARSB substitution missense Naturally occurring variant VUS F.catus_Fca126_mat1.0 A1 NC_058368.1:g.142610129C>T NM_001142259.1:c.1558G>A NP_001135731.1:p.(D520N) D520N/D520N and L476P/D520N cats have normal growth and appearance. L476P/D520N cats have a very mild MPS VI phenotype (increased incidence of degenerative joint disease). 1998 9421472 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
132 OMIA:000666-9685 domestic cat Domestic Shorthair (Cat) Siamese (Cat) Mucopolysaccharidosis VI ARSB substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A1 NC_058368.1:g.142610260A>G NM_001142259.1:c.1427T>C NP_001135731.1:p.(L476P) rs5334475159 1996 8910299 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
67 OMIA:001503-9615 dog American Staffordshire Terrier (Dog) Lysosomal storage disease (previously called Neuronal ceroid lipofuscinosis, 4A) ARSG substitution missense Naturally occurring variant P CanFam3.1 9 NC_006591.3:g.15071276G>A XM_005624176.3:c.296G>A XP_005624233.1:p.(R99H) 2010 20679209 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1199 OMIA:000201-9925 goat Peacock Goat (Goat) Valais Grüenochte Peacock ASIP A^pc repeat variation Naturally occurring variant Not currently evaluated 13 "The ASIP allele in Peacock goats, which we propose to term “peacock” (A^pc), has a quadruplication of the same ~45 kb region having five copies in the A^b allele. It is additionally flanked by triplicated segments of 27,996 bp and 41,807 bp on the left and right side of the quadruplicated sequence (Fig 3, S4 Fig, S5 Table). The central part of the A^pc allele has exactly the same breakpoints as the A^b allele suggesting a common origin of A^b and A^pc." (Henkel et al., 2019) "63'158'171-63'203'851: 4 copies (corresponds to the CNV in the Ab allele)" (Table S5; Henkel et al., 2019) 200922: Marius picked this g. entry up as requiring attention: "g.63130175_63245658 (3 copies)". Because this will take time to sort out, I have removed it from the g. field for the time being. 2019 31841508
1200 OMIA:000201-9925 goat Bezoar (Goat) Valais Blackneck (Goat) Valais Copperneck Wild type or Bezaur ASIP A^bz reference sequence allele Naturally occurring variant Not currently evaluated 13 "The goat genome reference sequence is derived from a San Clemente goat, which has a similar coat color pattern as bezoars. The genome reference therefore supposedly represents the wildtype allele at the ASIP locus, termed “bezoar” (Abz) [8]. Bezoars and all other Swiss goat breeds did not show any CNVs at the ASIP locus." (Henkel et al., 2019) 2019 31841508
1075 OMIA:001602-93934 Japanese quail Feather colour, fawn-2/beige ASIP Y^f2 duplication Naturally occurring variant Not currently evaluated 20 Robic et al. (2019) concluded "that fawn-2 and beige are the same allele, and that it is caused by a 70,895-bp tandem duplication . . . [with breakpoints] (NC-029535 [1,371,395(or 98)–1,442,295 (or 98)]) . . . located downstream of the ITCH exon 1 and upstream of the ASIP exon e4 (5′ UTR). . . . The 70,895 bp of the duplicated region include the entire AHCY gene on one strand, and parts of the ASIP and ITCH genes on the other strand." 2019 30987584
665 OMIA:000201-10042 North American deer mouse New Hampshire (Chicken) Melanic (non-agouti) ASIP deletion, gross (>20) regulatory Naturally occurring variant Not currently evaluated "a 125-kb deletion, which includes the upstream regulatory region and exons 1 and 2 of Agouti, results in a loss of Agouti expression" 2009 19649329
1321 OMIA:002200-9915 indicine cattle (zebu) Brahman (Cattle) Nellore, India (Sheep) Darkness of hair coat ASIP delins, gross (>20) Naturally occurring variant Not currently evaluated 13 1155-bp deletion followed by an insertion of a transposable element of more than 150 bp that may impact the recruitment of ASIP non-coding exons (Trigo et al.2021) 2021 33910501
712 OMIA:000201-9913 taurine cattle Normande (Cattle) Brindle ASIP Abr insertion, gross (>20) Naturally occurring variant Not currently evaluated 13 "insertion of a full-length Bos taurus LINE element" 2006 16827753
251 OMIA:000201-61386 Kodkod Melanism (black coat) ASIP substitution missense Naturally occurring variant Not currently evaluated p.(C126Y) 2015 25695801
252 OMIA:000201-3055696 Colocolo Melanism (black coat) ASIP substitution missense Naturally occurring variant Not currently evaluated p.(R120C) 2015 25695801
1119 OMIA:000201-10141 domestic guinea pig Recessive black Asip deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated c.181_184delTTCA MH026115: c.181_184delTTCA; the deletion leads to a truncated protein of 77 amino acids due to the premature stop codon. 2019 30746725
330 OMIA:000201-10042 North American deer mouse Alaska, United States of America (North American deer mouse) Melanic (non-agouti) ASIP substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.193?>? p.(Q65*) 2009 19649329
333 OMIA:000201-9691 leopard Coat colour, black (black panther) ASIP substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.333C>A p.(C111*) 2012 23251368
1219 OMIA:000201-9858 Western roe deer Melanistic (black) ASIP substitution missense Naturally occurring variant Not currently evaluated c.33G>T p.(L11F) 2020 32545389
1587 OMIA:000201-9691 leopard Coat colour, black (black panther) ASIP substitution missense Naturally occurring variant Not currently evaluated c.353C>A p.(C113F) 2023 37440497
1666 OMIA:000201-10007 tassel-eared squirrel Coat colour, black ASIP substitution missense Naturally occurring variant Not currently evaluated c.370T>C p.(C124R) 2024 38396615
504 OMIA:001602-93934 Japanese quail Feather colour, recessive black ASIP rb deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated 20 c.373_380del "A deletion of 8 bases was found in the ASIP gene" 2008 18287406
253 OMIA:000201-61455 Asiatic golden cat Black ASIP substitution missense Naturally occurring variant Not currently evaluated c.384C>G p.(C128W) 2012 23251368
1010 OMIA:000201-9838 Arabian camel Black and dark-brown coat colour ASIP haplotype Naturally occurring variant Not currently evaluated c.[23delT;c.25G>A] KU179868; c.[23delT;c.25G>A]. As described by Almathen et al. (2018), this haplotype comprises "a 1-bp deletion (23delT/T) and a SNP (25G/A) in exon 2 of ASIP". 2018 29893870
654 OMIA:001602-93934 Japanese quail Feather colour, lethal yellow ASIP Y deletion, gross (>20) Naturally occurring variant Not currently evaluated 20 g.1463709_1604872del Nadeau et al. (2008): "a >90-kb [141162bp] deletion upstream of ASIP" 2008 18287407 The g. coordinates were provided by Robic et al. (2019)
1196 OMIA:000201-9925 goat Appenzell (Goat) Girgentana, Italy (Goat) Saanen (Goat) White or tan ASIP A^Wt repeat variation Naturally occurring variant Not currently evaluated ARS1.2 13 "CNV [copy number variation] affecting a region of less that 100 kb including the ASIP and AHCY genes" (Fontanesi et al., 2009)."spans 154,677 bp ofthe reference genome sequence and comprises the entire coding sequence ofthe ASIP, AHCYand ITCH genes. The individual copies are arranged in tandem in a head to tail orientation." (Henkel et al., 2019) 200922: moved the g. entry to here (g.63,226,824-63,381,501 (3 copies)) until it can be standardised 2009 20016133
1197 OMIA:000201-9925 goat Grisons Striped (Goat) Toggenburg (Goat) Swiss markings ASIP A^sm repeat variation Naturally occurring variant Not currently evaluated ARS1.2 13 "8 tandem copies of a 13,433 bp sequence from the 5’-flanking region of ASIP" (Henkel et al., 2019) 200922: moved g. entry to here (g.63,129,198-63,142,631 (8 copies)) until it can be fixed 2019 31841508
1198 OMIA:000201-9925 goat Chamois Coloured (Goat) St Gallen Booted Goat (Goat) Badgerface ASIP A^b repeat variation Naturally occurring variant Not currently evaluated ARS1.2 13 "a five-fold amplification of45,680 bp located ~61 kb downstream ofthe Asm amplification" (Henkel et al., 2019) 200922: move the g. entry to here (g.63,158,171-63,203,851 (5 copies)), until it can be fixed 2019 31841508
149 OMIA:000201-9793 ass (donkey) Âne de Provence, France (Ass) Âne normand, France (Ass) Dezhou, China (Ass) Miniature, United States of America (Ass) No light points ASIP NLP substitution missense Naturally occurring variant Not currently evaluated ASM1607732v2 15 NC_052191.1:g.25406489T>C XM_044748287.1:c.349T>C XP_044604222.1:p.(C117R) The Dezhou reference genome ASM1607732v2 represents the 'no light points' variant: NC_052191.1:g.25406489C

2015 25887951
1382 OMIA:000201-9615 dog Dominant yellow ASIP DY reference sequence allele Naturally occurring variant Not currently evaluated CanFam3.1 24 CanFam3.1 The reference sequence CanFam3.1 represents the dominant yellow phenotype. 2021 34385618
1386 OMIA:000201-9615 dog Black saddle ASIP BS delins, gross (>20) regulatory Naturally occurring variant Not currently evaluated CanFam3.1 24 g.23378062_23379640delins[MT319116.1:424_663] Likely causal regulatory promoter variant 2021 34385618
1385 OMIA:000201-9615 dog Black back 3 ASIP BB3 haplotype regulatory Naturally occurring variant Not currently evaluated CanFam3.1 24 g.[23353288_23353472del;23354716_23354751A[4];23377890_23378086del;23378320_23378343del;g.23378858_2 Haplotype containing a likely causal regulatory promoter variant 2021 34385618
1380 OMIA:000201-9615 dog Agouti ASIP AG haplotype regulatory Naturally occurring variant Not currently evaluated CanFam3.1 24 g.[23353288_23353472del;23354716_23354751A[4];23377890_23378086del;23378320_23378343del] Haplotype containing a likely causal regulatory promoter variant 2021 34385618
1383 OMIA:000201-9615 dog Black back 1 ASIP BB1 haplotype regulatory Naturally occurring variant Not currently evaluated CanFam3.1 24 g.[23353288_23353472del;23354716_23354751A[4];23378062_23378231delins[MT319115.1:424_674] Haplotype containing a likely causal regulatory promoter variant 2021 34385618
1384 OMIA:000201-9615 dog Black back 2 ASIP BB2 haplotype regulatory Naturally occurring variant Not currently evaluated CanFam3.1 24 g.[23353288_23353472del;23354716_23354751A[4];23378062_23379640delins[MT319116.1:424_663]] Haplotype containing a likely causal regulatory promoter variant 2021 34385618
1381 OMIA:000201-9615 dog Shaded yellow ASIP SY haplotype regulatory Naturally occurring variant Not currently evaluated CanFam3.1 24 g.[23353288_23353472del;23354716_23354751A[4]] Haplotype containing a likely causal regulatory promoter variant 2021 34385618
30 OMIA:000201-9615 dog German Shepherd Dog (Dog) Huntaway (Dog) Recessive black ASIP substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 24 NC_006606.3:g.23393552C>T NM_001007263.1:c.286C>T NP_001007264.1:p.(R96C) Additional breeds based on PMID:40965331 rs851336386 2004 15520882 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1847 OMIA:000201-9279 southeastern quoll Coat colour, melanistic ASIP deletion, gross (>20) start-lost Naturally occurring variant Not currently evaluated DasViv_v1.0 2 4.7 kb deletion encompassing the first two coding exons 2025 41119986
509 OMIA:000201-9796 domestic horse American Trotter (Horse) Arab (Horse) Belgian Draft (Horse) Clydesdale (Horse) Freiberger (Horse) Icelandic Horse (Horse) Morgan (Horse) Quarter Horse (Horse) Shetland Pony (Horse) Thoroughbred (Horse) Warmblood (Horse) Welsh Pony (Horse) Coat colour, recessive black ASIP a deletion, small (<=20) Naturally occurring variant Not currently evaluated EquCab3.0 22 NC_009165.3:g.26067463_26067473del NM_001164017.1:c.187_197del published as g.2174_2184del and c.191_201del - coordinates in the table updated to a recent reference genome. rs3091770233 2001 11353392 Coordinates in EquCab3.0 kindly provided by Haley Rutstein, working under the guidance of Professor Ernie Bailey. Breed information based on PMID: 38600096
1453 OMIA:002549-9685 domestic cat Bengal (Cat) Coat colour and pattern, charcoal ASIP A^Pben substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A3 NC_058370.1:g.24826914T>C NM_001009190.1:c.302A>G NP_001009190.1:p.(D101G) variant contributes to A^Pbe haplotype associated with charcoal colour/pattern  2014 25143047
1452 OMIA:002549-9685 domestic cat Bengal (Cat) Coat colour and pattern, charcoal ASIP A^Pben substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A3 NC_058370.1:g.24826965T>C NM_001009190.1:c.251A>G NP_001009190.1:p.(Q84R) variant contributes to A^Pbe haplotype associated with charcoal colour/pattern  2014 25143047
1450 OMIA:002549-9685 domestic cat Bengal (Cat) Coat colour and pattern, charcoal ASIP A^Pben substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A3 NC_058370.1:g.24831065A>G NM_001009190.1:c.142T>C NP_001009190.1:p.(S48P) variant contributes to A^Pbe haplotype associated with charcoal colour/pattern 2014 25143047 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
493 OMIA:000201-9685 domestic cat Coat colour, non-agouti (black) ASIP a deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A3 NC_058370.1:g.24831083_24831084del NM_001009190.1:c.123_124del NP_001009190.1:p.(M42Efs*59) rs5334475125 2003 12620197 The genomic location on Felis_catus_9.0 is based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1451 OMIA:002549-9685 domestic cat Bengal (Cat) Coat colour and pattern, charcoal ASIP A^Pben substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A3 NC_058370.1:g.24831166C>G NM_001009190.1:c.41G>C NP_001009190.1:p.(C14S) variant contributes to A^Pbe haplotype associated with charcoal colour/pattern 2014 25143047 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1734 OMIA:000201-30532 fallow deer Coat colour, black ASIP substitution splicing Naturally occurring variant Not currently evaluated GCF_033118175.1 23 NC_083703.1:g.63827550G>A XM_061127099.1:c.225+1G>A 2024 39202415
1735 OMIA:000201-30532 fallow deer Coat colour, black ASIP duplication Naturally occurring variant Not currently evaluated GCF_033118175.1 23 NC_083703.1:g.63830157_63830161dup 2024 39202415
1708 OMIA:000201-9337 common brushtail possum Coat colour, non-agouti (black) ASIP substitution missense Naturally occurring variant Not currently evaluated mTriVul1.pri 3 NC_050575.1:g.100483705C>T XM_036748710.1:c.343C>T XP_036604605.1:p.(R115C) 2024 39086822
714 OMIA:000201-9940 sheep Merino (Sheep) White fleece ASIP Wt insertion, gross (>20) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 13 a 190kb tandem duplication encompassing the ASIP gene, the neighbouring AHCY gene and the promoter for a third gene ITCH 2008 18493018
1111 OMIA:000201-9940 sheep Recessive black ASIP a deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 13 g.66475132_66475136del published as g.100_105del / D5 and predicted to result in a frame shift followed by a premature stop codon 63 amino acids downstream of the start site 2002 12354151 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1112 OMIA:000201-9940 sheep Recessive black ASIP a substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 13 NC_040264.1:g.66474980T>A NM_001134303.1:c.376T>A NP_001127775.1:p.(C126S) Published as g.5172T>A (Norris et al. 2008). cDNA and protein positions based on NM_001134303.1 and NP_001127775.1 2008 18493018 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1134 OMIA:000201-9986 rabbit Black and tan ASIP a^t deletion, gross (>20) Naturally occurring variant Not currently evaluated OryCun2.0 4 g.5455408_5466123del Letko et al. (2020): NC_013672.1:g.5,455,408_5,466,123del 2020 31729778
567 OMIA:000201-9986 rabbit New Zealand White (Rabbit) Black (non-agouti) ASIP a insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated UM_NZW_1.0 4 NC_067377.1:g.13094745_13094746insT NM_001122939.1:c.5_6insA NP_001116411.1:p.(N2Kfs21*) Reported by Letko et al. (2020): NM_001122939.1:c.5_6insA, the OryCun2.0 reference genome represents the nonagouti allele.  2010 20004240
667 OMIA:000201-9627 red fox Dark Standard Silver ASIP deletion, gross (>20) Naturally occurring variant Not currently evaluated VulVul2.2 NW_020356514.1 A 16.5-kb deletion resulting in "a 166-nt deletion in the Standard Silver fox cDNA, spanning the second exon ... .This deletion removes the start codon and entire signal peptide" 1997 9054949
1309 OMIA:002325-9685 domestic cat Encephalopathy, spongy ASPA substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 E1 NC_058381.1:g.13594036C>G XM_006939957.5:c.859G>C XP_006940019.2:p.(A287P) 2021 33779415 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
111 OMIA:002099-9615 dog German Shepherd Dog (Dog) Ichthyosis, ASPRV1-related ASPRV1 substitution missense Naturally occurring variant LP/P CanFam3.1 10 NC_006592.3:g.68587027A>G XM_014117456.1:c.1052T>C XP_013972931.1:p.(L351P) XM_014117456.1; XP_013972931.1 2017 28249031 Genomic position in CanFam3.1 provided by Robert Kuhn and Mateo Etcheveste.
1673 OMIA:002099-9615 dog Pembroke Welsh Corgi (Dog) Ichthyosis, non-epidermolytic ASPRV1 deletion, small (<=20) frameshift Naturally occurring variant VUS UU_Cfam_GSD_1.0 10 NC_049231.1:g.69888722_69888723del XM_038551592.1:c.594_595del XP_038407520.1:p.(L199Rfs*342) 2024 38549226
289 OMIA:000194-9913 taurine cattle Blanco Orejinegro, Colombia (Cattle) Brown Swiss (Cattle) Holstein Friesian (Cattle) Citrullinaemia ASS1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 11 NC_037338.1:g.100781668C>T NM_173892.4:c.256C>T NP_776317.1:p.(R86*) Variant initially identified in Holstein Friesian and later reported in additional breeds: PMID:30014197, PMID:34779908. rs5334475062 1989 2813370 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
65 OMIA:001471-9615 dog Poodle, Standard (Dog) Neonatal encephalopathy with seizures ATF2 substitution missense Naturally occurring variant LP/P CanFam3.1 36 NC_006618.3:g.19078954A>C XM_005640334.3:c.152T>G XP_005640391.1:p.(M51R) 2008 18074159 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
94 OMIA:001954-9615 dog Lagotto Romagnolo (Dog) Neurodegenerative vacuolar storage disease ATG4D substitution missense Naturally occurring variant LP/P CanFam3.1 20 NC_006602.3:g.50618958C>T XM_542069.6:c.1288G>A XP_542069.1:p.(A430T) 2015 25875846 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1067 OMIA:001552-9615 dog Australian Cattle Dog (Dog) Neuronal ceroid lipofuscinosis, 12 ATP13A2 substitution missense Naturally occurring variant LP/P CanFam3.1 2 NC_006584.3:g.81208162C>T XM_005617949.3:c.1118C>T XP_005618006.1:p.(T373I) XM_005617949.3; XP_005618006.1 2019 30956123
400 OMIA:001552-9615 dog Tibetan Terrier (Dog) Neuronal ceroid lipofuscinosis, 12 ATP13A2 deletion, small (<=20) splicing Naturally occurring variant P CanFam3.1 2 NC_006584.3:g.81210367del XM_005617949.3:c.1623del XM_005617949.3; XP_005618006.1; variant was published as c.1623delG p.P541fs*597 by Farias et al. (2011); Wöhlke et al. (2011) provided an alternate transcript position c.1620delG and proposed that the variant causes exon 16 skipping in NCL-affected Tibetan terriers. The sequence information provided by Wöhlke et al. (2011) corresponds to XM_005617949.3:c.1623del 2011 21362476 22022275
734 OMIA:002110-9615 dog Belgian Shepherd Dog (Dog) Ataxia, cerebellar, ATP1B2-related ATP1B2 insertion, gross (>20) Naturally occurring variant P CanFam3.1 5 NC_006587.3:g.32551064_32551065ins[LT796559.1:g.50_276] XM_546597.5:c.130_131ins[LT796559.1:g.50_276] "a 227 bp SINE insertion into exon 2 of the ATP1B2 gene" 2017 28620085
188 OMIA:001450-9913 OMIA:001464-9913 taurine cattle Belgian Blue (Cattle) Maas-Rijn-Ijssel (Cattle) Congenital muscular dystonia 1 ATP2A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 25 NC_037352.1:g.25933247G>A NM_001075767.1:c.1675C>T NP_001069235.1:p.(R559C) Variant is reported to cause congenital muscular dystonia 1 in Belgian Blue cattle (OMIA 001450-9913) and congenital pseudomyotonia in a Dutch improved red and white cross-bred calf (OMIA:001464_9913). rs5334475104 2008 20547455 18344998 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). 
219 OMIA:001464-9913 taurine cattle Romagnola (Cattle) Pseudomyotonia, congenital ATP2A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 25 NC_037352.1:g.25939141C>A NM_001075767.1:c.857G>T NP_001069235.1:p.(G286V) This variant was identified as part of a haplotype with the G211V variant in Romagnola cattle. Akyürek et al. (2022; PMID: 36293223) suggest that the G286V variant is likely to be benign and that the G211V is likely to be causal. rs3423529256 2012 23046865 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
218 OMIA:001464-9913 taurine cattle Romagnola (Cattle) Pseudomyotonia, congenital ATP2A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 25 NC_037352.1:g.25939366C>A NM_001075767.1:c.632G>T NP_001069235.1:p.(G211V) rs5334474971 2012 23046865 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
205 OMIA:001464-9913 taurine cattle Chianina (Cattle) Marchigiana (Cattle) Romagnola (Cattle) Pseudomyotonia, congenital ATP2A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 25 NC_037352.1:g.25940510C>T NM_001075767.1:c.491G>A NP_001069235.1:p.(R164H) Variant initially identified in Chianina cattle and later reported in additional breeds: PMID: 35717834 rs3423529241 2008 18786632 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1192 OMIA:002265-9615 dog Irish Terrier (Dog) Darier disease ATP2A2 insertion, gross (>20) frameshift Naturally occurring variant P CanFam3.1 26 NC_006608.3:g.8200944_8200945insN[(205)] NM_001003214.1:c.2098-3_2098-2insN[(205)] NP_001003214.1:p.(T700Vfs*6) Linek et al. (2020): "a heterozygous SINE insertion [~205bp] into the ATP2A2 gene, at the end of intron 14, close to the boundary of exon 15", giving rise to NP_001003214.1:p.(Thr700Valfs*6) 2020 32354065
1533 OMIA:002265-9615 dog Shih Tzu (Dog) Darier disease ATP2A2 substitution missense Naturally occurring variant LP UU_Cfam_GSD_1.0 26 NC_049247.1:g.8434781A>C NM_001003214.1:c.2425A>C NP_001003214.1:p.(N809H) 2023 36883421
107 OMIA:002608-9615 dog Labrador Retriever (Dog) Modifier of copper toxicosis ATP7A substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 X NC_006621.3:g.60279238C>T XM_005641519.2:c.980C>T XP_005641576.1:p.(T327I) rs852523339 2016 26747866 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The phenotype was renamed from 'Menkes disease' to 'Modifier of copper toxicosis' based on feedback from Tom Nagels [10/01/2023].
106 OMIA:001071-9615 dog Huntaway (Dog) Labrador Retriever (Dog) New Zealand Heading Dog (Dog) Wilson disease ATP7B substitution missense Naturally occurring variant Out of scope CanFam3.1 22 NC_006604.3:g.225112G>A XM_005633828.3:c.4151G>A XP_005633885.1:p.(R1384Q) XM_005633831.3; XP_005633888.1; variant published as c.4358G>A / p.(R1453Q) and the variant coordinates in this table have been changed to reflect recent transcript IDs; conflicting evidence in regard to causality of this variant are reported in the literature - see https://omia.org/OMIA001071/9615/ for details. Additional breeds based on PMID:40965331 rs851958524 2016 26747866 30 Dec 2020: correct genomic location provided by Angelica K Kallenberg
1347 OMIA:001071-9685 domestic cat Wilson disease ATP7B substitution missense Naturally occurring variant Out of scope F.catus_Fca126_mat1.0 A1 NC_058368.1:g.19545959C>T XM_023251165.2:c.1649C>T XP_023106933.2:p.(P550L) 2020 31687873 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1590 OMIA:001071-9685 domestic cat Domestic Longhair (Cat) Wilson disease ATP7B substitution missense Naturally occurring variant Out of scope F.catus_Fca126_mat1.0 A1 NC_058368.1:g.19573282T>A XM_023251165.1:c.3670T>A XP_023106933.2:p.(W1224R) variant heterozygous in a single affected cat  2023 37427085 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1136 OMIA:001071-9685 domestic cat Wilson disease ATP7B substitution missense Naturally occurring variant LP F.catus_Fca126_mat1.0 A1 NC_058368.1:g.19574780C>G XM_023251165.2:c.3890C>G XP_023106933.2:p.(T1297R) 2019 30561139 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1076 OMIA:001645-10036 golden hamster Black tremor Atrn insertion, gross (>20) Naturally occurring variant Not currently evaluated Kuramoto et al. (2002): "an approximately 10-kb DNA fragment, which had 557-bp direct repeats in both ends and was flanked by the identical 6-bp target duplication sequences, [that] was inserted into exon 24" 2002 11773967
348 OMIA:000487-9796 domestic horse Belgian Draft (Horse) Friesian (Horse) Warmblood (Horse) Hydrocephalus B3GALNT2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated EquCab3.0 1 NC_009144.3:g.76887901C>T XM_001491545.6:c.1423C>T XP_001491595.2:p.(Q475*) XM_001491545; XP_001491595; Ducro et al. (2015): "The nomenclature for the mutation is c.1423C>T [GenBank:XM_001491545] corresponding to p.Gln475* [GenBank:XP_001491595]". As at 25 April 2019, Ensembl's Variant Effect Predictor (VEP) gives the EquCab3 c. and p. coordinates as having not changed from the EquCab2 coordinates reported by Ducro et al. (2015). The Ensembl ref is ENSECAT00000049072 rs3429464524 2015 26452345 c. and p. variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. EquCab3 g. coordinate provided by Meredith O’Connell, working under the supervision of Professor Ernie Bailey, 24 April 2019. Breed information updated based on PMID: 38600096
439 OMIA:001885-9940 sheep Lacaune (Sheep) Fecundity, Lacaune, FecL B4GALNT2 substitution regulatory Naturally occurring variant Not currently evaluated Oar_v3.1 11 g.36938224T>A c.766+2831A>T ENSOART00000006875.1:c.766+2831A>T ENSOART00000006877.1:c.781+2831A>T rs588626728 2013 24086150
440 OMIA:001885-9940 sheep Lacaune (Sheep) Fecundity, Lacaune, FecL B4GALNT2 substitution regulatory Naturally occurring variant Not currently evaluated Oar_v3.1 11 g.37034573A>G 2013 24086150
421 OMIA:002068-9796 domestic horse Friesian (Horse) Dwarfism, Friesian B4GALT7 substitution splicing Naturally occurring variant Not currently evaluated EquCab3.0 14 NC_009157.3:g.3772591C>T XM_023617086.1:c.50G>A XP_023472854.1:p.(R17K) rs3447120064 2016 27793082 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. FN thanks Elizabeth Huffman, who updated the g. coordinates to EquCab3, working under the supervision of Professor Ernie Bailey; 23 April 2020.
1676 OMIA:002837-9646 giant panda Coat colour, brown white BACE2 deletion, gross (>20) Naturally occurring variant Not currently evaluated 1 c.176_200del Published as c.176_200delTCGCCCTGGAGCCCGCCGGCGGCGC; g.4545815_4545839del 2024 38437540
1391 OMIA:002484-9615 dog Shetland Sheepdog (Dog) Bardet-Biedl syndrome 2 BBS2 substitution missense Naturally occurring variant LP/P CanFam3.1 2 NC_006584.3:g.59693737G>C ENSCAFT00000014523.5:c.1222G>C ENSCAFP00000013435.4:p.(A408P) 2021 34828377
356 OMIA:002045-9615 dog Puli (Dog) Bardet-Biedl syndrome 4 BBS4 substitution nonsense (stop-gain) Naturally occurring variant P CanFam3.1 30 NC_006612.3:g.36063748A>T c.58A>T p.(K20*) 2017 28533336
1131 OMIA:002216-9544 Rhesus monkey Bardet-Biedl syndrome 7 BBS7 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Mmul_8.0.1 c.160delG p.(A54fs) 2019 31589838
1049 OMIA:002178-9823 pig Landrace (Pig) Large White (Pig) Yorkshire (Pig) Abortion, BBS9 and BMPER-related BBS9 deletion, gross (>20) Naturally occurring variant Not currently evaluated Sscrofa11.1 18 NC_010460.4:g.39817373_40029300del Derks et al. (2018): "a large deletion in complete LD with the SSC18 haplotype of approximately 212kb (position 39,817,373 to 40,029,300), spanning a part of the BBS9 gene ... [and reducing] expression of the downstream BMPER gene". Initially reported in Large White and later reported in other breeds (PMID:39327728).   2018 30231021
635 OMIA:001592-9615 dog Cavalier King Charles Spaniel (Dog) Episodic falling BCAN deletion, gross (>20) Naturally occurring variant P CanFam3.1 7 NC_006589.3:g.41325010_41340731delinsAAGGCC XM_005622698.1:c.-13991_466+85delinsGGCCTT a 15.7kb deletion in the BCAN gene removing the first 3 exons 2012 21821125
298 OMIA:000627-9913 taurine cattle Polled Hereford (Cattle) Maple syrup urine disease BCKDHA substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.2 18 g.50551011C>T c.148C>T p.(Q50*) cDNA position based on ENSBTAT00000021342.6 rs5334475064 1990 2303405
200 OMIA:000627-9913 taurine cattle Shorthorn (Cattle) Maple syrup urine disease BCKDHA substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 18 g.50560242C>T c.1380C>T p.(P372L) rs3423447991 1999 10425233 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1333 OMIA:001079-9940 sheep spælsau (Sheep) yellow fat BCO2 insertion, gross (>20) Naturally occurring variant Not currently evaluated 15 "insertion of a 7.9 kb endogenous Jaagsiekte Sheep Retrovirus (enJSRV) sequence in the first intron of the BCO2 gene" (Kent et al. 2021) 2021 34193038
549 OMIA:001079-9986 rabbit Flemish Giant (Rabbit) New Zealand White (Rabbit) Yellow fat BCO2 deletion, small (<=20) Naturally occurring variant Not currently evaluated 1 delAAT 2015 26002694
1375 OMIA:002466-48883 OMIA:002466-48882 OMIA:002466-87173 OMIA:002466-48884 OMIA:002466-48885 OMIA:002466-48886 OMIA:002466-1553461 medium ground-finch Beak colour, yellow BCO2 substitution synonymous Naturally occurring variant Not currently evaluated 24 g.6166878G>A p.(V?V) synonymous change 32 bp into exon 4 2021 34687609
305 OMIA:001079-9913 taurine cattle Holstein Friesian (Cattle) Yellow fat BCO2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 15 NC_037342.1:g.22552375G>A NM_001101987.2:c.306G>A NP_001095457.2:p.(W102*) UMD3.1 position is g.22877552G>A; cDNA position is based on XM_024975217.1 rs109226280 2009 19398771 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1559 OMIA:002466-9135 common canary Beak and leg colour, red BCO2 substitution missense Naturally occurring variant Not currently evaluated NW_022042652.1 g.75258192G>A p.R413H 2020 31930402 XP_009096268.1, genomic position as reported by Bovo et al. (2023) PMID:37194440
320 OMIA:001079-9940 sheep spælsau (Sheep) Yellow fat BCO2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 15 NC_040266.1:g.25024133C>T XM_012095240.3:c.196C>T XP_011950630.2:p.(Q66*) Oar_v3.1 position is g.21947481C>T rs1090867485 2010 20122251 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
737 OMIA:001554-9615 dog Finnish Lapphund (Dog) Lapponian Herder (Dog) Multifocal retinopathy 3 BEST1 cmr3 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 18 g.54470590del c.1388del p.(P463Hfs) NM_001097545.1; NP_001091014.1; published as c.1388delC; variant initially identified in Lapponian Herder and later reported in additional breeds: PMID:27525650 rs397509969 2010 21197113 Variant information and allele abbreviation gleaned from or confirmed by Donner et al. (2016) PLoS One 11:e0161005 and genomic position in CanFam3.1 and EVA ID provided by Mateo Etcheveste and Robert Kuhn.
59 OMIA:001553-9615 dog Coton de Tulear (Dog) Multifocal retinopathy 2 BEST1 cmr2 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 18 NC_006600.3:g.54476143C>T NM_001097545.1:c.482G>A NP_001091014.1:p.(G161D) NM_001097545.1; NP_001091014.1 2007 17460247 Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn.
275 OMIA:001444-9615 dog Boerboel (Dog) Bull Mastiff (Dog) English Mastiff (Dog) Great Pyrenees (Dog) Multifocal retinopathy 1 BEST1 cmr1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 18 NC_006600.3:g.54478586G>A NM_001097545.1:c.73C>T NP_001091014.1:p.(R25*) NM_001097545.1; NP_001091014.1 2007 17460247 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
398 OMIA:001660-9615 dog Great Dane (Dog) Inherited myopathy of Great Danes BIN1 substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 19 NC_006601.3:g.23522400A>G XM_014121413.2:c.786-2A>G XP_013976888.1:p.(R262_K263insASASRPFPQ) XM_014121413.2; XP_013976888.1; published as IVS10-2A>G, updated in this table to HGVS nomenclature 2013 23754947
1770 OMIA:002917-9615 dog Mixed Breed (Dog) Biliverdinuria BLVRA deletion, gross (>20) deletion (in-frame) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 18 NC_049239.1:g.6532022_6551313del XP_038418561.1:p.(K117_K296del) 2024 39766828
1771 OMIA:002917-9615 dog Mixed Breed (Dog) Biliverdinuria BLVRA deletion, gross (>20) frameshift Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 18 NC_049239.1:g.6543863_6545908 XP_038418561.1:p.(A154fs) 2024 39766828
1874 OMIA:003044-9685 domestic cat Domestic Shorthair (Cat) Osteogenesis imperfecta, BMP1-related BMP1 substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.35831890C>T XM_045055405.1:c.637G>A XP_044911340.1:p.(V213M) 2026 41562138
755 OMIA:002306-9940 sheep Tunisian Barbary (Sheep) Fecundity, Barbarine BMP15 FecX(Bar) complex rearrangement frameshift Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 X g.[56600937insG;56600945_56600947del;56600948C>A] c.[301G>T;302_304delCTA;310insC] p.(A101Cfs*113) "a composite polymorphism associating a single nucleotide substitution (c.301G > T), a 3 bp deletion (c.302_304delCTA) and a C insertion (c.310insC) in the ovine BMP15 cDNA leading to a frame shift at protein position 101" - cDNA positions based on NM_001114767 2017 28506298
244 OMIA:002306-9940 sheep Belclare (Sheep) Cambridge (Sheep) Fecundity, Belclare BMP15 FecX(B) substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 X NC_040278.1:g.56594843C>A NM_001114767.1:c.1100G>T NP_001108239.1:p.(S367I) 2004 14627550 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
238 OMIA:002306-9940 sheep Olkuska (Sheep) Fecundity, Olkuska BMP15 FecX(O) substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 X NC_040278.1:g.56594934T>G NM_001114767.1:c.1009A>C NP_001108239.1:p.(N337H) Protein and cDNA positions based on NP_001108239.1 and NM_001114767.1, respectively. 2013 23637641 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
236 OMIA:002306-9940 sheep Lacaune (Sheep) Fecundity, Lacaune BMP15 FecX(L) substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 X NC_040278.1:g.56594981C>T NM_001114767.1:c.962G>A NP_001108239.1:p.(C321Y) cDNA position based on NP_001108239.1 2007 17038554 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
237 OMIA:002306-9940 sheep Grivette (Sheep) Fecundity, Grivette BMP15 FecX(Gr) substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 X NC_040278.1:g.56594993G>A NM_001114767.1:c.950C>T NP_001108239.1:p.(T317I) protein and cDNA positions based on NP_001108239.1 and NM_001114767.1, respectively 2013 23637641 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
235 OMIA:002306-9940 sheep Romney Marsh (Sheep) Fecundity, Inverdale BMP15 FecX(I) substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 X NC_040278.1:g.56595047A>T NM_001114767.1:c.896T>A NP_001108239.1:p.(V299D) protein and cDNA positions based on NP_001108239.1 and NM_001114767.1, respectively rs398521635 2000 10888873 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
335 OMIA:002306-9940 sheep Romney Marsh (Sheep) Fecundity, Hanna BMP15 FecX(H) substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 X NC_040278.1:g.56595072G>A NM_001114767.1:c.871C>T NP_001108239.1:p.(Q291*) previously listed as c.1184C>T; protein and cDNA position based on NP_001108239.1 and NM_001114767.1, respectively rs413916687 2000 10888873
334 OMIA:002306-9940 sheep Cambridge (Sheep) Fecundity, Galway BMP15 FecX(G) substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 X NC_040278.1:g.56595225G>A NM_001114767.1:c.718C>T NP_001108239.1:p.(Q239*) rs425019156 2004 14627550
521 OMIA:002306-9940 sheep Rasa Aragonesa, Spain (Sheep) Fecundity, Rasa Aragonesa BMP15 FecX(R) deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 X NC_040278.1:g.56595467_56595483del NM_001114767.1:c.460_476del NP_001108239.1:p.(W154Nfs*55) published as c.525_541delTGGGTCCAGAAAAGCCC based on AF236079, protein and cDNA position in table based on NP_001108239.1 and NM_001114767.1, respectively 2008 18355397 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1345 OMIA:002306-9940 sheep Blanc Du Massif Central (Sheep) Noir du Velay, France (Sheep) Fecundity BMP15 FecX(N) substitution regulatory Naturally occurring variant Not currently evaluated Oar_v3.1 X g.50977717T>A 2020 32636872
1341 OMIA:002306-9940 sheep Rasa Aragonesa, Spain (Sheep) Fecundity BMP15 FecX(RA) substitution missense Naturally occurring variant Not currently evaluated Oar_v3.1 X NC_019484.1:g.50970948G>A NM_001114767.1:c.1172C>T NP_001108239.1:p.(T391I) Published as ENSOART00000010201: p.T400I - changed from NC_019484.1:g.50970948C>T to NC_019484.1:g.50970948G>A [09/06/2025]  2020 31927415
1281 OMIA:002306-9823 pig German Landrace (Pig) Infertility and increased litter size BMP15 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Sscrofa11.1 X NC_010461.5:g.44618787C>T NM_001005155.2:c.634C>T NP_001005155.2:p.(R212*) 2021 33413103
241 OMIA:000383-9940 sheep Booroola (Sheep) Small Tailed Han, China (Sheep) Fecundity, Booroola BMPR1B FecB(B) substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 6 NC_040257.1:g.34010859T>C NM_001009431.1:c.746A>G NP_001009431.1:p.(Q249R) Position on Oar_v3.1: g.29382188T>C, previously listed in OMIA as c.914A>G and p.(Q305R). c. and p. coordinates updated [10/06/2025] rs418841713 2001 11259271 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool, the genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1254 OMIA:000576-9823 pig Yorkshire (Pig) Knobbed acrosome defect BOLL deletion, gross (>20) Naturally occurring variant Not currently evaluated Sscrofa11.1 15 NC_010457.5:g.101549770_101604750del 2020 32975846
1766 OMIA:002913-9913 taurine cattle Holstein Friesian (Cattle) Cardiac malformation, BRI3BP-related BRI3BP substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 17 NC_037344.1:g.50813902C>T NM_001099087.1:c.478G>A NP_001092557.1:p.(V160I) likely de novo variant 2025 39593234
851 OMIA:002132-9615 dog German Shorthaired Pointer (Dog) Abortion (embryonic lethality), BTBD17-related BTBD17 insertion, small (<=20) Naturally occurring variant Not currently evaluated CanFam3.1 9 g.6048201_6048202insG c.85+206_85+207insG ROS_Cfam_1.0:g.6720627_6720628insG ENSCAFT00845033049.1:c.85+206_85+207insG; the homozygous variant genotype is associated with embryonic lethality in German Shorthaired Pointer, but may not be causal as the variant was observed at a high frequency in both heterozygous and homozygous form across normal dogs from multiple breeds (PMID:37582787, PMID:40965331) rs852549625 2017 29053721
981 OMIA:001991-9913 taurine cattle Nordic Red (Cattle) Stillbirth BTBD9 deletion, gross (>20) Naturally occurring variant Not currently evaluated 23 "∼525 KB deletion on Chr23:12,291,761-12,817,087 (overlapping BTBD9, GLO1 and DNAH8)" 2016 27091210
325 OMIA:001622-9031 chicken Resistance to avian sarcoma and leukosis viruses, subgroup C BTN1A1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated GRCg6a 28 g.903289G>T c.165C>A p.(C55*) rs735807319 2005 16051833 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
455 OMIA:000155-9615 dog Brittany Spaniel (Dog) C3 deficiency C3 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 20 g.53573746del c.2136del p.(F712Lfs*11) XM_038428862.1; XP_038284790.1 "a deletion of a cytosine at position 2136 (codon 712), leading to a frameshift that generates a stop codon 11 amino acids downstream" 1998 9510185
1737 OMIA:002886-9823 pig Large White (Pig) Timothy syndrome 1 CACNA1C substitution missense Genome-editing (CRISPR-Cas9) Not currently evaluated Sscrofa11.1 5 NC_010447.5:g.69316114G>A XM_021092981.1:c.1216G>A XP_020948640.1:p.(G406R) 2023 38665938
1881 OMIA:003046-9615 dog English Cocker Spaniel (Dog) Retinal atrophy, progressive, CACNA1F-related CACNA1F deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 X NC_049260.1:g.42516353del XM_038587436.1:c.4481del XP_038443364.1:(F1482Lfs*8) 2026 41882631
1660 OMIA:002819-9913 taurine cattle Holstein Friesian (Cattle) Muscle weakness CACNA1S substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 16 NC_037343.1:g.79613592C>T XM_024976574.1:c.3853G>A XP_024832342.1:p.G1285S ENSBTAT00000065901.3; ENSBTAP00000054797.3 rs3423414874 2024 38246543
1852 OMIA:003025-9913 taurine cattle Angus (Cattle) Cerebellar abiotrophy CACNA2D2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 22 NC_037349.1:g.49970603T>C XM_024983269.1:c.1183T>C XP_024839037.1:p.(C395R) 2026 41873845
1087 OMIA:002201-9913 taurine cattle Normande (Cattle) Abortion due to haplotype NH7 CAD substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 11 g.72409143T>C p.(Y452C) published as CAD g.72399397T>C; p.Tyr452Cys rs5334475092 2019 31056337 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1787 OMIA:002939-9685 domestic cat Bengal (Cat) Epileptic encephalopathy CAD substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A3 NC_058370.1:g.118599900C>T XM_011281284.3:c.6044G>A XP_011279586.1:p.(Ser2015Asn) 2025 40251393
1490 OMIA:002573-151761 yellow-crowned parrot Lewy body-like disease CADPS2 substitution missense Naturally occurring variant Not currently evaluated c.1675G>C p.(V559L) 2022 36086934
105 OMIA:001820-9615 dog Parson Russell Terrier (Dog) Ataxia, spinocerebellar CAPN1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 18 NC_006600.3:g.52009339C>T XM_540866.5:c.344G>A XP_540866.2:p.(C115Y) XM_540866.5; XP_540866.2 2013 23741357 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
1692 OMIA:002854-9615 dog Miniature Schnauzer (Dog) Immunodeficiency, susceptibility to Mycobacterium avium complex CARD9 deletion, small (<=20) deletion (in-frame) Not currently evaluated CanFam3.1 9 NC_006591.3:g.49115079_49115081del XM_844178.5:c.493_495del XP_849271.2: p.(K165del) 2024 38710903
1674 OMIA:002835-9615 dog Cavalier King Charles Spaniel (Dog) Immunodeficiency, CARMIL2-related CARMIL2 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 5 NC_006587.3:g.81801920G>A XM_022419456.1:c.871C>T XP_022275164.1:p.(R291*) NC_006587.3; XM_022419456.1; XP_022275164.1 rs3330142729 2024 38535207
49 OMIA:001138-9615 dog American Foxhound (Dog) Beagle (Dog) English Foxhound (Dog) Harrier (Dog) Poodle, Miniature (Dog) Treeing Walker Coonhound (Dog) Hypocatalasia CAT substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 18 NC_006600.3:g.33397548C>T NM_001002984.1:c.979G>A NP_001002984.1:p.(A327T) Variant initially identified in Beagle and later reported in additional breeds: PMID:29708978, PMID27525650 2000 11137458 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
516 OMIA:001416-9612 gray wolf Coat colour, dominant black CBD103 K^B deletion, small (<=20) Naturally occurring variant Not currently evaluated 3bp deletion of the CBD103 gene 2009 19197024
520 OMIA:001416-9614 coyote Coat colour, dominant black CBD103 deletion, small (<=20) Naturally occurring variant Not currently evaluated 3bp deletion of the CBD103 gene 2009 19197024
458 OMIA:001416-9615 dog Huntaway (Dog) New Zealand Heading Dog (Dog) Coat colour, dominant black CBD103 ΔG23 = K^B deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated CanFam3.1 16 g.58965449_58965451del c.231_233del p.(G78del) "a 3-base pair (bp) deletion in the second exon of CBD103, the ortholog of human DEFB103, that predicts an in-frame glycine deletion (ΔG23)". Multiple breeds, additional breeds based on PMID:40965331 rs851502010 2007 17947548 Genomic location provided by Professor Claire Wade August 2018. Allele designations taken from Ollivier et al. (2013)
1032 OMIA:002167-9913 taurine cattle Nordic Red (Cattle) Asthenospermia CCDC189 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.2 25 g.26880841C>T Touru et al. (2019): "a variant disrupting a canonical 5’ splice donor site (GCA_000003055.3:Chr25:g.27138357C>T) in CCDC189 (transcript - ID:ENSBTAT00000045037) encoding the coiled-coil domain containing protein 189." rs5334474909 2019 30975085
266 OMIA:001540-9615 dog Old English Sheepdog (Dog) Ciliary dyskinesia, primary CCDC39 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 34 NC_006616.3:g.13952270G>A XM_545213.6:c.286C>T XP_545213.3:p.(R96*) 2011 21131972 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1403 OMIA:002342-9940 sheep Blanc Du Massif Central (Sheep) Lacaune (Sheep) Ciliary dyskinesia, primary (respiratory failure) CCDC65 LDHH6 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 3 NC_040254.1:g.147207999C>A XM_004006389.4:c.521G>T XP_004006438.1:p.(E111*) XM_004006389.4; XP_004006438.1; published as NC_040254.1:g.147,207,999C>A rs1085624756 2021 35052387
1274 OMIA:001521-9615 dog Portuguese Water Dog (Dog) Progressive retinal atrophy, early onset CCDC66 EOPRA insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 20 g.33717704_33717705insT c.2262_c.2263insA p.(V747Sfs*8) 2020 33273526
574 OMIA:001521-9615 dog Schapendoes (Dog) Generalized PRA CCDC66 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 20 g.33745452_33745453insT c.521_522insA p.(N174Kfs*2) NM_001168012.1; NP_001161484.1; genomic coordinates in accordance with HGVS 3'-rule 2010 19777273 Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn.
538 OMIA:001299-9031 chicken Resistance to avian sarcoma and leukosis viruses, subgroup A CD320 deletion, small (<=20) Naturally occurring variant Not currently evaluated 28 c.502_511delCGCTCACCCC 2015 25873518
539 OMIA:001299-9031 chicken Resistance to avian sarcoma and leukosis viruses, subgroup A CD320 deletion, small (<=20) Naturally occurring variant Not currently evaluated 28 c.502_516delCGCTCACCCCGCCCC 2015 25873518
395 OMIA:001299-9031 chicken Resistance to avian sarcoma and leukosis viruses, subgroup A CD320 deletion, small (<=20) splicing Naturally occurring variant Not currently evaluated 28 c.506-515del10 2012 22171251
396 OMIA:001299-9031 chicken Resistance to avian sarcoma and leukosis viruses, subgroup A CD320 deletion, small (<=20) splicing Naturally occurring variant Not currently evaluated 28 c.507-511del5 2012 22171251
603 OMIA:001299-9031 chicken Resistance to avian sarcoma and leukosis viruses, subgroup A CD320 tva^r2 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated GRCg6a 28 NC_006115.5:g.985659_985660insCTCG NM_001044645.1:c.48_49insCTCG NP_001038110.1:p.(P18Afs) 2004 15564460 Genomic position in GRCg6a provided by Joshua Khamis.
12 OMIA:001299-9031 chicken Resistance to avian sarcoma and leukosis viruses, subgroup A CD320 tva^r substitution missense Naturally occurring variant Not currently evaluated GRCg6a 28 NC_006115.5:g.985981C>G NM_001044645.1:c.186C>G NP_001038110.1:p.(C62W) published as c.120C>G and p.(C40W); coordinates in the table have been updated to a recent reference genome and / or transcript 2004 15564460 Genomic position in GRCg6a provided by Joshua Khamis.
1340 OMIA:002386-9544 Rhesus monkey OKT4 epitope deficiency CD4 substitution missense Naturally occurring variant Not currently evaluated 11 c.C793T p.(A265W) 2021 33893743
1528 OMIA:002626-9913 taurine cattle Japanese Black, Japan (Cattle) Haplotype with homozygous deficiency JBH17, CDC45-related CDC45 substitution splicing Naturally occurring variant Not currently evaluated UMD_3.1.1 17 g.74743512G>T located in a splicing donor site at a distance of 5 bp, affecting pre-mRNA splicing 2021 33758295
1496 OMIA:002584-9615 dog Beauceron (Dog) Deafness, CDH23-related CDH23 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 4 g:22340631C>T c.700C>T p.(P234S) ON462053; XM_022417544.1; XP_022273252.1 2023 36308003 The UU_Cfam_GSD_1.0 genomic variant coordinate is: g.Chr4:23074925C>T
3 OMIA:000102-9031 chicken Sex-linked extreme dilution CDKN2A B0 haplotype Naturally occurring variant Not currently evaluated Z The B0 allele is characterised by two non-coding variants: "The first, SNP1, is within the CDKN2A (ARF) promoter region, 265 bp upstream of the transcription start site (according to GenBank AY138245), and the second, SNP2, is located at nucleotide position 385 bp in CDKN2A intron 1" 2010 20374521
1871 OMIA:001699-9031 chicken Shank colour, Inhibition of dermal melanin locus CDKN2A ID delins, gross (>20) regulatory Naturally occurring variant Not currently evaluated GRCg6a Z chrZ:78942980_78943123delinsAA 143 bp deletion coupled with a 2 bp insertion impacting exprssion of CDKN2A  2026 41496629
5 OMIA:000102-9031 chicken Sex-linked dilution CDKN2A B2 substitution missense Naturally occurring variant Not currently evaluated GRCg6a Z g.78856557G>A c.28C>T p.(R10C) rs1059941965 2010 20374521 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
4 OMIA:000102-9031 chicken Sex-linked barring CDKN2A B1 substitution missense Naturally occurring variant Not currently evaluated GRCg6a Z g.78856559A>T c.26T>A p.(V9D) rs3388417177 2010 20374521 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
863 OMIA:001890-198806 ruff Male body size/courtship behaviour CENPN inversion Naturally occurring variant Not currently evaluated "a 4.5Mb inversion on the ruff orthologue of chicken chromosomr GGA11 which, due to the well-known lethality of recombinants within an inversion, has created a supergene determining male breeding behaviour, body size and plumage colour" 2016 26569123
991 OMIA:001830-9913 taurine cattle Holstein (black and white) (Cattle) Abortion due to haplotype HH7 CENPU deletion, small (<=20) splicing Naturally occurring variant Not currently evaluated ARS-UCD1.2 27 g.15123637_15123640del Hozé et al. (2019): "Considering that CENPU is transcribed in the antisense orientation, this mutation is predicted to result in deletion of the nucleotides located at position +3 to + 6 bp after the splicing donor site of exon 11. Using cross-species nucleotide alignment, we observed that the nucleotide at position +3 is entirely conserved among vertebrates . . . , which suggests that it plays an important role in regulation of CENPU splicing. If modified after exon 11, the abnormal splicing of CENPU could cause mRNA decay or the production of a protein modified after residue 319 out of 409 AA. Based on these factors, we assumed that mutation g.14168130_14168133delTACT on chromosome 27 alters the splicing of CENPU and is embryonic lethal." 2020 31733857
964 OMIA:001502-9913 taurine cattle Montbéliarde (Cattle) Caprine-like Generalized Hypoplasia Syndrome CEP250 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.2 13 g.64710424C>T c.493C>T p.(Q165*) rs5334474991 2015 25902731 Coordinates obtained from and/or confirmed by EBI's VEP
384 OMIA:001244-9685 domestic cat Abyssinian (Cat) American Curl (Cat) American Shorthair (Cat) American Wirehair (Cat) Balinese (Cat) Bengal (Cat) Colorpoint Shorthair (Cat) Cornish Rex (Cat) Devon Rex (Cat) Donskoy (Cat) European Shorthair (Cat) Havana (Cat) Highlander (Cat) Maine Coon (Cat) Manx (Cat) Munchkin (Cat) Ocicat (Cat) Oriental Longhair (Cat) Oriental Shorthair (Cat) Peterbald (Cat) Pixiebob Longhair (Cat) Ragdoll (Cat) Scottish Fold (Cat) Siamese (Cat) Singapura (Cat) Somali (Cat) Sphynx (Cat) Tennessee Rex (Cat) Tonkinese (Cat) Retinal degeneration II CEP290 substitution splicing Naturally occurring variant P F.catus_Fca126_mat1.0 B4 NC_058374.1:g.110285757A>C XM_023256243.2:c.7584+9T>G published as IVS50 + 9T>G. The cat sequenced to generate the Felis_catus_9.0 reference genome is homozygous for the likely causal variant. The genomic and cDNA coordinates had therefore been previously listed in this table as Felis_catus_9.0:g.112522818TC>A and c.7584+9G>T. The information has been updated based on feedback from 潘旭 to reflect that the likely causal variant is c.7584+9G and that the normal allele is c.7584+9T [6/4/2023].
Variant was initially identified in the Abyssinian and Somali breeds but identified to be present in several other breeds (Pubmed:19747862; PMID:35709088)
2007 17507457 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
177 OMIA:000636-9823 pig Membranoproliferative glomerulonephritis type II CFH substitution missense Naturally occurring variant Not currently evaluated Sscrofa11.1 10 NW_018085100.1:g.2553907T>G NM_214281.2:c.3551T>G NP_999446.1:p.(I1184R) CFH is located on Chr10 in Sscrofa10.2 g.2553907T>G, but recorded as 'unplaced/NW_018085100.1' in Sscrofa11.1., published as c.3610T>G; p.(I1166R) 2002 12466119 The genomic location on Sscrofa11.1 was determined by Stephanie Shields (27/05/2020)
1479 OMIA:001794-9940 sheep Romney (Sheep) Cystic fibrosis CFTR substitution nonsense (stop-gain) Genome-editing (CRISPR-Cas9) Not currently evaluated Oar_rambouillet_v1.0 4 NC_040255.1:g.57192317C>A NM_001009781.1:c.1621G>T NP_001009781.1:p.(G541*) NM_001009781.1; NP_001009781.1; published as p.(G542X), coordinates in this table are updated to recent reference sequence 2021 34632318
1478 OMIA:001794-9940 sheep Romney (Sheep) Cystic fibrosis CFTR deletion, small (<=20) deletion (in-frame) Genome-editing (CRISPR-Cas9) Not currently evaluated Oar_rambouillet_v1.0 4 NC_040255.1:g.57218683_57218685del NM_001009781.1:c.1518_1520del NP_001009781.1:p.(F507del) NM_001009781.1; NP_001009781.1; published as p.(F508del), coordinates are updated in this table to recent reference sequence 2021 34632318
61 OMIA:002072-9615 dog Old Danish Pointing Dog (Dog) Myasthenic syndrome, congenital CHAT substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 28 NC_006610.3:g.1484906G>A XM_005637485.3:c.85G>A XP_005637542.1:p.(V29M) XM_005637485.3; XP_005637542.1 2007 17586598 20181218 Thanks to Maarten de Groot for advising FN of the genomic location of this variant.
838 OMIA:002125-9913 taurine cattle Montbéliarde (Cattle) Neurocristopathy CHD7 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 14 g.26402250_26402254del p.(K594Afs*29) 2017 28904385
1691 OMIA:002767-7957 goldfish Twin-tail chordinA substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated p.(E127*) 2014 24569511
554 OMIA:002022-9913 taurine cattle Red Dane (Cattle) Arthrogryposis multiplex congenita, CHRNB1-related CHRNB1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.27122027del NM_174516.2:c.55del NP_776941.1:p.(A19Pfs47*) Published as Chr19:27757270CG > C; CHRNB1 c.55delG; (p.Ala19Profs47*) rs5334474854 2016 27364156 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
490 OMIA:000685-9915 indicine cattle (zebu) Brahman (Cattle) Myasthenic syndrome, congenital, CHRNE-related CHRNE 470del20 deletion, small (<=20) Naturally occurring variant Not currently evaluated ARS-UCD1.2 19 g.26485848_26485867del c.470_489del Kraner et al. (2002): "a loss of 20 bp within the coding sequence of exon 5 (Fig. 2), between nucleotide 469 and 490 (nucleotide numbering referring to the cDNA sequence published under accession number X02597". These authors (and subsequent authors) call this variant "470del20". The current (2020) HGVS nomenclature is c.470_489del 200922: g. information move here (g.27119615) until standardised rs5334475050 2002 12481987 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
614 OMIA:000685-9615 dog Jack Russell Terrier (Dog) Myasthenic syndrome, congenital, due to CHRNE CHRNE insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 5 NC_006587.3:g.31705136dup XM_014113502.2:c.729dup XP_013968977.2:p.(G244Rfs*274) published as c.633_634insC, previously reported in OMIA as c.636_637insC; coordinates in the table updated to NCBI trancript IDs and in accordance to HGVS rules (3'-rule and reported as duplication) [27/08/2024] 2015 26429099
804 OMIA:000685-9615 dog Heideterrier (Dog) Smooth Fox Terrier (Dog) Myasthenic syndrome, congenital, due to CHRNE CHRNE duplication frameshift Naturally occurring variant Not currently evaluated CanFam3.1 5 NC_006587.3:g.31707450dup XM_014113502.2:c.1508dup XP_013968977.2:p.(S503Rfs*14)
published as Chr5:31,707,450_31,707,451insG, XM_014113502.1:c.1436_1437insG, XP_013968977.1:p.Ser479ArgfsTer14; in Heideterrier; information in the table updated to new transcript and in accordance with HGVS recommendations [27/08/2024]; for additional breed inforamtion see Pubmed:38853290
2017 28508416
1729 OMIA:000685-9615 dog English Springer Spaniel (Dog) Myasthenic syndrome, congenital, CHRNE-related CHRNE substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 5 NC_049226.1:chr5:31915101C>A XM_038536566.1:c.1509C>A XP_038392494.1:p.(S503R) reported in two affected dogs 2024 38853290
1664 OMIA:000698-9940 sheep Merino (Sheep) Myotonia CLCN1 substitution missense Naturally occurring variant Not currently evaluated ARS-UI_Ramb_v3.0 4 NC_056057.1:g.107930611C>T XM_004008136.5:c.844C>T XP_004008185.4:p.(P282S) rs3487175777 2024 39765607
224 OMIA:000698-9925 goat Myotonia CLCN1 substitution missense Naturally occurring variant Not currently evaluated ARS1.2 4 NC_030811.1:g.13857007C>G XM_013963554.2:c.2656G>C XP_013819008.1:p.(A886P) Previously listed in OMIA based on ENSEMBL Variant Effect Predictor: transcript ENSCHIT00000031898.1:c.2590G>C; p.(P864A); c. and p. updated based on NCBI transcript IDs [26/08/2024] rs5334475115 1996 8855341
609 OMIA:000698-9615 dog Australian Cattle Dog (Dog) Border Collie (Dog) Myotonia CLCN1 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 16 NC_006598.3:g.6344748_6344749insT NM_001003124.2:c.2647_2648insA NP_001003124.1:p.(R883Qfs*18) published as c.2665insA; p.(R889fs); coordinates in the table have been updated to a recent reference genome and / or transcript 2007 17552451
1041 OMIA:000698-9615 dog Labrador Retriever (Dog) Myotonia CLCN1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 16 NC_006598.3:g.6348929T>A NM_001003124.2:c.2275A>T NP_001003124.1:p.(R759X) published as "Chr16:6348929 T A CLCN1 ENSCAFG00000003619.3 stopgain"

2018 29934119
62 OMIA:000698-9615 dog Miniature Schnauzer (Dog) Myotonia CLCN1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 16 NC_006598.3:g.6366383G>A NM_001003124.2:c.803C>T NP_001003124.1:p.(T268M) 1999 10452529 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1364 OMIA:000698-9615 dog American Bulldog (Dog) Myotonia CLCN1 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 16 NC_006598.3:g.6369245_6369246insAGAG NM_001003124.2:c.436_437insCTCT NP_001003124.1:p.(Y146Sfs*49) 2020 33246886
1570 OMIA:000698-9615 dog Mixed Breed (Dog) Myotonia CLCN1 deletion, gross (>20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 16 NC_006598.3:g.[6367458_6367478del;6367482del;6367485A>C] NM_001003124.2:c.[703T>G;706del;710_730del] NP_001003124.1:p.[(F235V;V236fs)] published as c.[705T>G; 708del; 712_732del], coordinates in the table have been updated to the CanFam3.1 reference genome and reflect correction in PMID:37212506.
 
2023 37212506
161 OMIA:000698-9796 domestic horse New Forest Pony (Horse) Myotonia CLCN1 substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 4 NC_009147.3:g.96518592A>C XM_001915636.4:c.1775A>C XP_001915671.3:p.(D592A) c.1775A>C, Genbank acc. XM_001915636; p.D592A, Genbank acc. XP_001915671 (Wijnberg et al., 2014) rs5334475185 2012 22197188 (FN thanks Izabela De Assis Rocha, who provided genomic location in EquCab3.0 and the Genbank acc IDs, working under the supervision of Professor Ernie Bailey; 15 April 2020) Revised genomic location kindly provided by Cord Drögemüller; 21 May 2021
1573 OMIA:000698-9685 domestic cat Domestic Longhair (Cat) Myotonia CLCN1 deletion, small (<=20) frameshift Naturally occurring variant P F.catus_Fca126_mat1.0 A2 NC_058369.1:g.157186686_157186693del NM_001305027.1:c.428_433+1del NP_001291956.1:p.(L143Qfs3*) published as chrA2:15897085‐15897092 2022 35815860 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1623 OMIA:000698-9685 domestic cat Myotonia CLCN1 substitution missense Naturally occurring variant P F.catus_Fca126_mat1.0 A2 NC_058369.1:g.157195914G>C NM_001305027.1:c.991G>C NP_001291956.1:p.(A331P) 2023 37668104 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
408 OMIA:000698-9685 domestic cat Myotonia CLCN1 substitution splicing Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A2 NC_058369.1:g.157205990G>T NM_001305027.1:c.1930+1G>T 2014 25356766 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
245 OMIA:000698-9940 sheep Rasa Aragonesa, Spain (Sheep) Myotonia CLCN1 substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 4 NC_040255.1:g.115541101G>A XM_004008136.4:c.277G>A XP_004008185.4:p.(E93K) Oar_v3.1 position is g.106140081G>A published as p.Gln93Lys.  rs401726021 2015 25744800 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1365 OMIA:000698-9823 pig Myotonia CLCN1 deletion, gross (>20) Naturally occurring variant Not currently evaluated Sscrofa11.1 18 NC_010460.4:g.6912538_6916702del 2019 31666547
399 OMIA:000698-89462 water buffalo Murrah (Buffalo) Myotonia CLCN1 substitution splicing Naturally occurring variant Not currently evaluated UOA_WB_1 8 NC_037552.1:g.106762128C>T NM_001290916.1:c.396C>T abnormal splicing associated with synonymous SNP (Ser132, c.396C>T)  2013 23339992
1678 OMIA:000698-9615 dog French Bulldog (Dog) Myotonia CLCN1 duplication frameshift Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 16 NC_049237.1:g.6074128_6074135dup NM_001003124.2:c.2423_2430dup NP_001003124.1:p.(F811Lfs*39) 2024 38473107
1757 OMIA:000698-9615 dog Mixed Breed (Dog) Myotonia CLCN1 delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 16 NC_049237.1:g.[6080653T>A;6080658_6080661delinsCCCGTT] NM_001003124.2:c.[1636_1639delinsAACGGG;1644A>T] NP_001003124.1:p.(C546Nfs*5) 2024 39559538
1783 OMIA:002927-94885 corn snake Skin colour pattern, stripe CLCN2 insertion, gross (>20) frameshift Naturally occurring variant Not currently evaluated Scaffold 6 p.(G203Efs*4) insertion of a 5832-bp LTR-retrotransposon in the fifth intron of the CLCN2 gene - splicing of the retroposon results in a 397-bp insertion between exons 5 and 6 which introduces a premature stop codon after exon 5 (Montandon et al., 2025) 2025 40140900
210 OMIA:001887-9913 taurine cattle Belgian Blue (Cattle) Osteopetrosis with gingival hamartomas CLCN7 haplotype missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 25 g.[1139611G>T; 1139613A>G] c.[2248T>C;2250C>A] p.(Y750Q) 2014 24159188 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
648 OMIA:001135-9913 taurine cattle Japanese Black, Japan (Cattle) Renal dysplasia CLDN16 Type 1 deletion, gross (>20) Naturally occurring variant Not currently evaluated 1 37kb deletion of exons 1-4 2000 10810088
781 OMIA:001135-9913 taurine cattle Japanese Black, Japan (Cattle) Renal dysplasia CLDN16 Type 2 deletion, gross (>20) Naturally occurring variant Not currently evaluated 1 "a 56-kb deletion that eliminates exons 1-4 and 21-bp of exon 5" 200922: g. info moved to here (g.77528017_?) until can be standardised 2002 12047224 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
1669 OMIA:002432-9913 taurine cattle Hereford (Cattle) Retinal degeneration, CLN3-realted CLN3 delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 25 NC_037352.1:g.26043843del NM_001075174.2:c.1106del NP_001068642.2:p.(P369Rfs*8) NM_001075174.2; NP_001068642.2 rs5377951844 2024 38516801
593 OMIA:001482-9913 taurine cattle Devon (Cattle) Neuronal ceroid lipofuscinosis, 5 CLN5 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 12 g.52112732_52112733insG c.662_663insG p.(R221Gfs*6) 2006 16935476 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) 210909: after checking the genome assembly sequence, FN changed g.52461241insG to g.52461241_52461242insG; and c.662insG to c.662_663insG
541 OMIA:001482-9615 dog Golden Retriever (Dog) Neuronal ceroid lipofuscinosis, 5 CLN5 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 22 g.30574953_30574954del c.935_936del p.(E312Vfs*6) NM_001011556.1; NP_001011556.1,published as CLN5:c.934_935delAG; coordinates in the table have been updated to a recent reference genome and / or transcript 2015 25934231 Breed information obtained from Katz et al. (2017) Neurobiol Dis. doi: 10.1016/j.nbd.2017.08.017; Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn.
279 OMIA:001482-9615 dog Australian Cattle Dog (Dog) Border Collie (Dog) Neuronal ceroid lipofuscinosis, 5 CLN5 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 22 NC_006604.3:g.30574637C>T NM_001011556.1:c.619C>T NP_001011556.1:p.(Q207*) rs1152388418 2005 16033706 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool 30 Dec 2020: g. coordinate corrected, with thanks to Angelica K Kallenberg
389 OMIA:001482-9940 sheep Borderdale, New Zealand (Sheep) Neuronal ceroid lipofuscinosis, 5 CLN5 substitution splicing Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 10 NC_040261.1:g.56313269G>A NM_001082595.1:c.571+1G>A rs422165326 2008 17988881 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
68 OMIA:001443-9615 dog Australian Shepherd (Dog) Neuronal ceroid lipofuscinosis, 6 CLN6 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 30 NC_006612.3:g.32247875A>G NM_001011888.1:c.829T>C NP_001011888.1:p.(W277R) alternative coordinates: ROS_Cfam_1.0:g.32443458A>G ENSCAFT00845033654.1:c.829T>C ENSCAFP00845026347.1:p.Trp277Arg rs1152388420 2011 21234413
1703 OMIA:001443-9615 dog Mixed Breed (Dog) Neuronal ceroid lipofuscinosis, 6 CLN6 substitution splicing Naturally occurring variant Not currently evaluated Dog10K_Boxer_Tasha 30 NC_006612.4:g.32185406C>T 2024 38927597
1213 OMIA:001443-9685 domestic cat Domestic Medium Hair (Cat) Neuronal ceroid lipofuscinosis, 6 CLN6 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B3 NC_058373.1:g.37187417G>A XM_003987007.6:c.668G>A XP_003987056.1:p.(W223*) published as ENSFCAT00000025909:c.668G>A; XM_003987007.5:c.668G>A rs5334475122 2020 32518081 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
671 OMIA:001443-9940 sheep South Hampshire, New Zealand (Sheep) Neuronal ceroid lipofuscinosis CLN6 deletion, gross (>20) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 7 deletion of exon 1 2013 23338040
234 OMIA:001443-9940 sheep Merino (Sheep) Neuronal ceroid lipofuscinosis, 6 CLN6 substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 7 NC_040258.1:g.16039510G>A NM_001040289.1:c.184C>T NP_001035379.1:p.(R62C) protein and cDNA position based on NP_001035379.1 and NM_001040289.1, respectively rs399747319 2006 17046213 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1702 OMIA:001443-9615 dog Schapendoes (Dog) Neuronal ceroid lipofuscinosis, 6 CLN6 substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 30 NC_049251.1:g.32682554A>G XM_038580811.1:c.386T>C XP_038436739.1:p.(L129P) 2024 38866396
1030 OMIA:001962-9542 Japanese macaque Neuronal ceroid lipofuscinosis, 7 CLN7 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated 4 c.769delA p.(I257Lfs*36) 2018 30048804
690 OMIA:001506-9615 dog Alpine Dachsbracke (Dog) Neuronal ceroid lipofuscinosis, 8 CLN8 deletion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 37 g.30852988_30902901del c.-14679_*18669del NM_001012343.1; a homozygous deletion encompassing the entire CLN8 gene 2017 28024876 g. information obtained from Katz et al. (2017) Neurobiol Dis. doi: 10.1016/j.nbd.2017.08.017
971 OMIA:001506-9615 dog Saluki (Dog) Neuronal ceroid lipofuscinosis, 8 CLN8 insertion, small (<=20) nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 37 g.30874636dupT c.349dupT p.(E117*) "an insertion of 1 bp (T) in the CLN8 gene (Fig. S2) in a short T repeat, thereby changing the stretch of 9 T's to a stretch consisting of 10 T's. The exact position of the inserted base could obviously not be verified, given that this was an insertion of a single base in a stretch of nine repeats of the same base (CFA37:g.30874628–30874636). According to the recommended nomenclature, the T insertion was noted as a T duplication in the T farthest in the 3′ direction (g.30874636dupT; c.349dupT)" 2018 29446145
69 OMIA:001506-9615 dog English Setter (Dog) Neuronal ceroid lipofuscinosis, 8 CLN8 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 37 NC_006619.3:g.30874779T>C NM_001012343.1:c.491T>C NP_001012343.1:p.(L164P) 2005 15629147 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
338 OMIA:001506-9615 dog Australian Shepherd (Dog) German Shorthaired Pointer (Dog) Huntaway (Dog) New Zealand Heading Dog (Dog) Neuronal ceroid lipofuscinosis, 8 CLN8 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 37 NC_006619.3:g.30883950G>A NM_001012343.1:c.585G>A NP_001012343.1:p.(W195*) NM_001012343: c.585G>A (Guo et al., 2014), Additional breeds based on PMID:40965331 2014 24953404 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; confirmed by Guo et al. (2019, pages 3, 4, 5 and 6), assuming that the g. coordinate (g.30,895,648) in the abstract of Guo et al. (2019) is a typo.
431 OMIA:000119-9685 domestic cat Blood group system AB CMAH substitution regulatory Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B2 NC_058372.1:g.4640833T>C published as C-371T; the cat sequenced to create F.catus_Fca126_mat1.0 represents the T allele  2007 17553163 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1432 OMIA:000119-9685 domestic cat Blood group system AB CMAH substitution regulatory Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B2 NC_058372.1:g.4640987G>A published as G-217A, the cat sequenced to create F.catus_Fca126_mat1.0 represents the G allele 2007 17553163 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
430 OMIA:000119-9685 domestic cat Blood group system AB CMAH insertion, small (<=20) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B2 NC_058372.1:g.4641133_4641151del published as "an indel in the exon 1 5' UTR"; Delta-53; Felis_catus_9.0 represents the deletion allele: g.4934941_4934942insAACGAGCAACCGAAGCTG 2007 17553163 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1431 OMIA:000119-9685 domestic cat Blood group system AB CMAH substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B2 NC_058372.1:g.4641555C>T NM_001244985.1:c.139C>T NP_001231914.1:p.(R47C) published as c.136C>T 2014 24697343 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
118 OMIA:000119-9685 domestic cat Blood group system AB CMAH substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B2 NC_058372.1:g.4641558A>G NM_001244985.1:c.142G>A NP_001231914.1:p.(V48M) published as Felis_catus_6.2: B2:4587414G>A; c.139G>A; p.(V47M); F.catus_Fca126_mat1.0 represents the A allele while transcript NM_001244985.1 represents the G allele rs5334475157 2007 17553163 The genomic location on Felis_catus_9.0 is based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
800 OMIA:000119-9685 domestic cat 2019 TYPING PANEL CMAH substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B2 NC_058372.1:g.4641595G>T NM_001244985.1:c.179G>T NP_001231914.1:p.(G60V) rs5334475140 2016 27755584 The genomic location on Felis_catus_9.0 was based on Rodney et al. 2021 (PMID: 33785770), updated to F.catus_Fca126_mat1.0 by Bella Bartner.
801 OMIA:000119-9685 domestic cat Blood group system AB CMAH substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B2 NC_058372.1:g.4641603A>G NM_001244985.1:c.187A>G NP_001231914.1:p.(I63V) 2016 27755584 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
119 OMIA:000119-9685 domestic cat 2019 TYPING PANEL CMAH substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B2 NC_058372.1:g.4644950A>T NM_001244985.1:c.268T>A NP_001231914.1:p.(Y90N) published as c.265T>A (2007); revised designation of c.268T>A was reported by Kehl et al. (2019);  F.catus_Fca126_mat1.0 represents the A allele while transcript NM_001244985.1 represents the T allele. rs5334475138 2007 17553163 The genomic location on Felis_catus_9.0 is based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1446 OMIA:000119-9685 domestic cat Blood group system AB CMAH substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B2 NC_058372.1:g.4653784C>A NM_001244985.1:c.327A>C NP_001231914.1:p.(E109D) published as c.327A>C; variant is reported to be not causal for blood type B, but may impact Neu5GC levels (Omi et al.,2016). The Felis_catus_9.0 and F.catus_Fca126_mat1.0 reference genomes represent the C allele, while transcript NM_001244985.1 represents the A allele.


2016 27171395 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
799 OMIA:000119-9685 domestic cat Ragdoll (Cat) 2019 TYPING PANEL CMAH substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B2 NC_058372.1:g.4653821.C>T NM_001244985.1:c.364C>T NP_001231914.1:p.(P122S) rs5334475151 2016 27171395 The genomic location on Felis_catus_9.0 is based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1413 OMIA:000119-9685 domestic cat Blood group system AB CMAH substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B2 NC_058372.1:g.4659871G>A NM_001244985.1:c.773G>A NP_001231914.1:p.(R258Q) 2021 34589535 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1430 OMIA:000119-9685 domestic cat Blood group system AB CMAH deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B2 NC_058372.1:g.4661662del NM_001244985.1:c.933del NP_001231914.1:p.(A312Hfs*6) 2018 30235335 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1062 OMIA:000119-9685 domestic cat Ragdoll (Cat) 2019 TYPING PANEL CMAH deletion, small (<=20) nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B2 NC_058372.1:g.4685206del NM_001244985.1:c.1322del NP_001231914.1:p.(L441*) published as c.1322delT 2018 30235335 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
120 OMIA:000119-9685 domestic cat Blood group system AB CMAH substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B2 NC_058372.1:g.4692013A>G NM_001244985.1:c.1603G>A NP_001231914.1:p.(D535N) published as c.1600G>A; p.(D534N); F.catus_Fca126_mat1.0 represents the A allele while NM_001244985.1 represents the G allele rs5334475141 2007 17553163 The genomic location on Felis_catus_9.0 is based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
547 OMIA:001977-9615 dog Shetland Sheepdog (Dog) Progressive retinal atrophy, due to CNGA1 mutations CNGA1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 13 g.43831897_43831900del c.1752_1755del p.(T585Sfs*7) NM_001003222.1; published as c.1752_1755delAACT 2015 26202106 Genomic and protein coordinates in CanFam3.1 provided by Robert Kuhn
548 OMIA:001481-9615 dog Labrador Retriever (Dog) Achromatopsia-2 CNGA3 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated CanFam3.1 10 g.44234198_44234200del c.1931_1933del p.(V644del) NM_001301112.1; published as c.1931_1933delTGG rs852784090 2015 26407004 Genomic coordinates in CanFam3.1 and EVA ID provided by Robert Kuhn
97 OMIA:001481-9615 dog German Shepherd Dog (Dog) Achromatopsia-2 CNGA3 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 10 NC_006592.3:g.44234861G>A NM_001301112.1:c.1270C>T NP_001288041.1:p.(R424W) Changed from NC_006592.3:g.44234861C>T to NC_006592.3:g.44234861G>A [09/06/2025] 2015 26407004 Genomic position in CanFam3.1 provided by Mateo Etcheveste.
1016 OMIA:001481-9940 sheep Awassi (Sheep) Achromatopsia-2 (day blindness) CNGA3 substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 3 NC_040254.1:g.108958871C>T XM_027965914.1:c.1618G>A XP_027821715.1:p.(G540S) 2017 28282490 Genomic coordinate on Oar_v4.0 (g.102602387G>A) kindly provided by Eyal Seroussi via Elisha Gootwine. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries.
317 OMIA:001481-9940 sheep Awassi (Sheep) Achromatopsia-2 (day blindness) CNGA3 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oori1 scaffold00739 3 g.263324C>T c.706C>T p.(R236*) In a pers. comm. to FN via Elisha Gootwine, Eyal Seroussi advises that the Oar_v4.0 assembly has errors in the region of of this mutation, such that it cannot be mapped onto that assembly. It can, however, be mapped on to the Ovis aries musimon sequence: "Exon 8 mutation is at position 263,324 in Ovis aries musimon unplaced genomic scaffold, alternate assembly Oori1 scaffold00739 (Sequence ID: NW_011942977.1 Length: 1056687)" 2010 19874885
918 OMIA:002723-9615 dog Papillon (Dog) Phalène (Dog) Progressive retinal atrophy CNGB1 delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 2 g.58622673_58622675delinsCTAGCTAC c.2387_2389delinsCTAGCTAC p.(Y796Sfs*7) NM_001284462.1; NP_001271391.1; published as c.2685delA2687_2688insTAGCTA and p.(Y889Sfs*5); coordinates in the table have been updated to a recent reference genome and / or transcript and updated to HGVS recommendations rs1152388403 2013 24015210
631 OMIA:001365-9615 dog Alaskan Malamute (Dog) Miniature Australian Shepherd Dog (Dog) Achromatopsia (cone degeneration, hemeralopia), AMAL CNGB3 cd^AMAL deletion, gross (>20) Naturally occurring variant Not currently evaluated 29 "deletion removing all exons of canine CNGB3" 2002 12140185
1400 OMIA:001365-9913 taurine cattle Brown Swiss (Cattle) Original Swiss Brown (Cattle) Achromatopsia CNGB3 OH1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 14 NC_037341.1:g.76011964G>A XM_015474554.2:c.751G>A XP_015330040.2:p.(D251N) XM_015474554.2: c.751G>A, XP_015330040.2: p.Asp251Asn ENSBTAT00000065296.2:c.751G>A ENSBTAP00000054173.2:p.Asp251Asn rs716218235 2021 34830323
27 OMIA:001365-9615 dog German Shorthaired Pointer (Dog) Achromatopsia (cone degeneration, hemeralopia), GSPT CNGB3 cd^GSPT substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 29 NC_006611.3:g.32837065C>T NM_001003030.1:c.784G>A NP_001003030.1:p.(D262N) 2002 12140185 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool 30 Dec 2020 Chromosome corrected, thanks to Angelica K Kallenberg
1502 OMIA:002591-9615 dog Dalmatian (Dog) Lysosomal storage disease, CNP-related CNP deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Dog10K_Boxer_Tasha 9 g.20350240del c.1107del p.(K370Nfs*11) ENSCAFT00000102206 2022 35447247
1680 OMIA:002591-9615 dog Weimaraner (Dog) Lysosomal storage disease, CNP-related CNP substitution missense Naturally occurring variant Not currently evaluated Dog10K_Boxer_Tasha 9 NC_006591.4:g.20355460G>A XM_844467.6:c.125C>T XP_849560.2:p.(T42M) XM_844467.6; XP_849560.2; NC_006591.4 2024 38397235
1273 OMIA:002301-9615 dog Great Dane (Dog) Labrador Retriever (Dog) Leonberger (Dog) New Zealand Heading Dog (Dog) Pyrenean Shepherd (Dog) Saint Bernard (Dog) Laryngeal paralysis and polyneuropathy CNTNAP1 LPPN3 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 9 NC_006591.3:g.20298261C>T XM_548083.6:c.2810G>A XP_548083.3:p.(G937E) XM_548083.6:c.2810G>A; XP_548083.3:p.Gly937Glu; variant initially identified in Labrador Retriever, Leonberger and Saint Bernard and later reported in a Pyrenean Shepherd (PMID:37582787) and Great Danes (PMID:40622077) rs24587752 2020 33261176
172 OMIA:001718-9823 pig Yorkshire (Pig) Dwarfism, Schmid metaphyseal chondrodysplasia COL10A1 substitution missense Naturally occurring variant Not currently evaluated Sscrofa11.1 1 NC_010443.5:g.81767089C>T NM_001005153.1:c.1768G>A NP_001005153.1:p.(G590R) rs5334475171 2000 11130976 The genomic and CDS position was determined by Stephanie Shields and the effect was confirmed with Ensembl VEP (27/05/2020)
1795 OMIA:001718-8090 Japanese medaka Skeletal defects, col10a1a-related col10a1a deletion, small (<=20) frameshift Genome-editing (CRISPR-Cas9) Not currently evaluated p.(C633fs) 5 base pair deletion 2024 38510140
1657 OMIA:002811-9615 dog Old English Sheepdog (Dog) Multiocular defect COL11A1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 6 g.47611886T>C c.1775T>C p.(F1592S) 2023 38153936
78 OMIA:001772-9615 dog Labrador Retriever (Dog) Skeletal dysplasia 2 (SD2) COL11A2 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 12 NC_006594.3:g.2652874C>G XM_538855.5:c.143G>C XP_538855.2:p.(R48P) ROS_Cfam_1.0:g.2983602C>G ENSCAFT00845034709.1:c.143G>C ENSCAFP00845027184.1:p.Arg48Pro rs851399084 2013 23527306 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1634 OMIA:002793-9685 domestic cat American Shorthair (Cat) Epidermolysis bullosa, junctional, COL17A1-related COL17A1 deletion, small (<=20) splicing Naturally occurring variant P F.catus_Fca126_mat1.0 D2 NC_058378.1:g.62124169del XM_006938156.5:c.3019+1del  variant reported in a single affected cat 2023 37895184
1635 OMIA:002793-9685 domestic cat European Shorthair (Cat) Epidermolysis bullosa, junctional, COL17A1-related COL17A1 substitution splicing Naturally occurring variant LP F.catus_Fca126_mat1.0 D2 NC_058378.1:g.62149308C>T XM_006938156.5:c.769+5G>A XP_006938218.3:p.(V257Gfs*82) variant described in a single affected cat 2023 37895184
1873 OMIA:002793-9685 domestic cat Domestic Shorthair (Cat) Epidermolysis bullosa, junctional, COL17A1-related COL17A1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 D2 NC_058378.1:g.62154566_62154567del XM_006938156.5:c.414_415del XP_006938218.3:p.(S141fs) Published as chrD2:62154563, a 2-bp deletion in exon 7 / COL17A1:c.415–416. Information in this table has been updated to a recent reference genome and the HGVS 3' rule. Variant reported in a single affected cat. 2026 41588668
839 OMIA:002127-9913 taurine cattle Simmental (Cattle) Osteogenesis imperfecta, type II, COL1A1-related COL1A1 delins, small (<=20) delins (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.2 19 g.36470764_36470767delinsT c.3145_3148delinsT p.(A1049_P1050delinsS) UMD3.1 position is g.37101299_37101302delinsT; cDNA position based on ENSBTAT00000017420.4 rs876049195 2017 28904385 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1031 OMIA:002127-9913 taurine cattle Red Angus (Cattle) Osteogenesis imperfecta, type II, COL1A1-related COL1A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.36463798G>A NM_001034039.2:c.1063G>A NP_001029211.1:p.(G355S) Petersen et al. (2019): "PolyPhen-2 predicted the mutation to be “probably damaging” with a score of 1.000 (sensitivity 0.00; specificity 1.00). Similarly, PROVEAN prediction classified the variant as “Deleterious” with a score of − 4.615, exceeding both the default (− 2.5) and stringent (− 4.1) thresholds for this classification." The genomic coordinate in the UMD3.1 assembly is g.37094333G>A (Petersen et al., 2019). The coding sequence coordinates are c.1063G>A (ENSBTAT00000017420.4) (Petersen, pers. comm.) rs3423092630 2019 30788588
1289 OMIA:002127-9913 taurine cattle Holstein (black and white) (Cattle) Osteogenesis imperfecta, type II, COL1A1-related COL1A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.36473359T>A NM_001034039.2:c.3917T>A NP_001029211.1:p.(V1306E) NM_001034039.2: c.3917T>A; XP_024835395.1: p.Val1306Glu (Jacinto et al., 2021) rs5334474947 2021 33672767
1698 OMIA:002127-9913 taurine cattle Normande (Cattle) Osteogenesis imperfecta, type II, COL1A1-related COL1A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.36473965G>A NM_001034039.2:c.4234G>A NP_001029211.1:p.(D1412N) 2024 38773368
1838 OMIA:002127-9940 sheep Charollais (Sheep) Osteogenesis imperfecta, type II COL1A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UI_Ramb_v2.0 11 NC_056064.1:g.36197409G>A XM_027974705.2:c.1189G>A XP_027830506.1:p.(G397S) 2025 40999323
959 OMIA:002126-9615 dog Golden Retriever (Dog) Osteogenesis imperfecta, type III, COL1A1-related COL1A1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 9 NC_006591.3:g.26193593C>G NM_001003090.1:c.1145G>C NP_001003090.1:p.(G382A) NM_001003090.1; NP_001003090.1; published as c.1276G>C, p.(G208A); coordinates in the table have been updated to a recent reference genome and / or transcript rs1152388502 2000 11147834
1837 OMIA:002112-9913 taurine cattle Stabiliser, United Kingdom of Great Britain and Northern Ireland (Cattle) Osteogenesis imperfecta COL1A2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 4 NC_037331.1:g.11792118G > A NM_174520.2:c.1156G > A NP_776945.1:p.(G386R) 2025 40999323
762 OMIA:002112-9615 dog Beagle (Dog) Osteogenesis imperfecta, COL1A2-related COL1A2 delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 14 g.(19918265_19918268delinsTGTCATTGG) c.3656_3859delinsTGTCATTGG p.(L1286Cfs*31) NM_001003187.1; NP_001003187.1; "a mutation in which nucleotides 3991-3994 ("CTAG") were replaced with "TGTCATTGG." The first seven bases of the inserted sequence were identical to nucleotides 4002-4008 of the normal canine COL1A2 sequence. The resulting frameshift changed 30 amino acids and introduced a premature stop codon." The genomic information is presented in brackets as the variant was detected in cDNA and the genomic position is predicted. Coordinates in the table have been updated to a recent reference genome and or transcripts. 2001 11393792
1114 OMIA:002112-9615 dog Lagotto Romagnolo (Dog) Osteogenesis imperfecta, COL1A2-related COL1A2 duplication duplication (in-frame) Naturally occurring variant Not currently evaluated CanFam3.1 14 g.19898279_19898281dup c.877_879dup p.(P293dup) NM_001003187.1; NP_001003187.1 2019 31468557
852 OMIA:002112-9615 dog Chow Chow (Dog) Osteogenesis imperfecta, COL1A2-related COL1A2 substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 14 NC_006596.3:g.19898487G>A NM_001003187.1:c.936+1G>A 2018 29036614
1275 OMIA:001926-9913 taurine cattle Holstein Friesian (Cattle) Bulldog calf COL2A1 deletion, gross (>20) Naturally occurring variant Not currently evaluated ARS-UCD1.2 5 g.32301911_32308589del "Sanger sequencing revealed the precise breakpoints of the heterozygous deletion from position 32 301 911 located in intron 25 to 32 308 589 located within exon 45. The 6679 bp deletion includes the entire sequence of 18 exons (26–44) plus the first 36 nucleotides of exon 45" (Jacinto et al., 2020) 2021 33316082
840 OMIA:001926-9913 taurine cattle Charolais (Cattle) Salers (Cattle) Bulldog calf COL2A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.32301746G>A NM_001001135.3:c.1799G>A NP_001001135.2:p.(G600D) previously listed in OMIA as c.1791G>A, updated to reflect recent transcript inforamtion [03/09/2024] rs5334474917 2017 28904385
1241 OMIA:001926-9913 taurine cattle Holstein Friesian (Cattle) Bulldog calf COL2A1 delins, gross (>20) Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.32303127_32306640delinsTCTGGGGAGC deletion encompassing 10 of the 54 coding exons of COL2A1 2020 32894162
842 OMIA:001926-9913 taurine cattle Holstein Friesian (Cattle) Bulldog calf COL2A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.32303739G>A NM_001001135.3:c.2158G>A NP_001001135.2:p.(G720S) rs455596159 2017 28904385 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
414 OMIA:001926-9913 taurine cattle Danish Holstein (Cattle) bulldog calf COL2A1 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.32305226G>A NM_001001135.3:c.2463+1G>A rs5334475095 2016 27296271 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
223 OMIA:001926-9913 taurine cattle Holstein Friesian (Cattle) Bulldog calf COL2A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.32307658G>A NM_001001135.3:c.2878G>A NP_001001135.2:p.(G960R) rs3423194986 2014 25017103
841 OMIA:001926-9913 taurine cattle Holstein Friesian (Cattle) Bulldog calf COL2A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.32308008G>A NM_001001135.3:c.2986G>A NP_001001135.2:p.(G996S) rs876243579 2017 28904385
1026 OMIA:001926-9913 taurine cattle Holstein Friesian (Cattle) Bulldog calf COL2A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.32308734G>A NM_001001135.3:c.3166G>A NP_001001135.2:p.(G1056S) rs5334475093 2019 30378686
1835 OMIA:001926-9913 taurine cattle Holstein Friesian (Cattle) Achondrogenesis COL2A1 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.32312706_32312717del NM_001001135.3:c.4432_4443del NP_001001135.2:p.(G1478_I1481del) 2025 40999323
1836 OMIA:001926-9940 sheep Charollais (Sheep) Achondrogenesis type II COL2A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UI_Ramb_v2.0 3 NC_056056.1:g.138610131G > A XM_042246797.1:c.2908G > A XP_042102731.1:p.(G970S) 2025 40999323
1889 OMIA:001926-9823 pig Achondrogenesis, type II COL2A1 haplotype frameshift Genome-editing (CRISPR-Cas9) Not currently evaluated Sscofa11.1 5 NC_010447.5:g.[78361637del];[78361641C>T] XM_021092611.1:c.[1744G>A];[1749del] XP_020948270.1:p.[(G582S)];[(D584fs)] 2020 32450343
278 OMIA:002618-9615 dog English Springer Spaniel (Dog) Nephropathy COL4A4 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 25 NC_006607.3:g.39893376G>A NM_001031818.1:c.2713C>T NP_001026988.1:p.(Q905*) NM_001031818.1; NP_001026988.1; published as c.2806C>T and p.(Q904*) 2012 22369189
277 OMIA:002618-9615 dog English Cocker Spaniel (Dog) Nephropathy COL4A4 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 25 NC_006607.3:g.39953906T>A NM_001031818.1:c.115A>T NP_001026988.1:p.(K39*) 2007 17552442 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
471 OMIA:001112-9615 dog Navasota (mixed breed) (Dog) Nephritis, X-linked COL4A5 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 X g.82134508_82134517del c.513_522del p.(N172Ifs) XM_005640969.3; XP_005641026.1; a 10 base pair (TAATCCAGGA) deletion in exon 9 of COL4A5 2003 12879362
276 OMIA:001112-9615 dog Samoyed (Dog) Nephritis, X-linked COL4A5 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 X NC_006621.3:g.82196868G>T NM_001002979.1:c.3079G>T NP_001002979.1:p.(G1027*) 1994 8171024 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1124 OMIA:002165-9615 dog Labrador Retriever (Dog) Ehlers-Danlos syndrome, classic type, 1 COL5A1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 9 NC_006591.3:g.50806169del XM_022423936.1:c.3038del XP_022279644.1:p.(G1013Vfs*260) XM_022423936.1; XP_022279644.1; published as c.3038delG - "variant arose by a de novo mutation event during the development of the mother." (Bauer et al., 2019) 2019 31546637
1125 OMIA:002165-9615 dog German Shepherd Dog (Dog) Mixed Breed (Dog) Ehlers-Danlos syndrome, classic type, 1 COL5A1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 9 NC_006591.3:g.50832936G>A XM_022423936.1:c.4711G>A XP_022279644.1:p.(G1571R) This variant has been independently identified by Bullock et al. (2024) with published coordinates in a different reference genome (Dog10K_Boxer_Tasha, NC_006591.4:g.50116228G>A, ENSCAFT00000031582.6:c.4105G>A, p.(Gly1369Arg)) and had previously been listed in OMIA as omia.variant:1724. Entries have been merged after helpful feedback from Dr. Anna-Lena Van de Weyer [11/08/2026].  2019 39175162 31546637
1722 OMIA:002165-9615 dog Golden Retriever (Dog) Ehlers-Danlos syndrome, classic type 1 COL5A1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Dog10K_Boxer_Tasha 9 NC_006591.4:g.50091843C>T XM_038615652.1:c.2512C>T XP_038471580.1:p.(R838*) ENSCAFT00000031582.6:c.2500C>T, p.(Arg834Ter) 2024 39175162
1719 OMIA:002165-9615 dog Mixed Breed (Dog) Ehlers-Danlos syndrome, classic type 1 COL5A1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Dog10K_Boxer_Tasha 9 NC_006591.4:g.50109824del XM_038615652.1:c.3371del XP_038471580.1:p.(E1124Lfs*364) ENSCAFT00000031582.6:c.3360del, p.(E1121Lfs*364)  2024 39175162
1721 OMIA:002165-9615 dog Dachshund, Miniature (Dog) Ehlers-Danlos syndrome, classic type 1 COL5A1 duplication frameshift Naturally occurring variant Not currently evaluated Dog10K_Boxer_Tasha 9 NC_006591.4:g.50111993dup XM_038615652.1:c.3675dup XP_038471580.1:p.(G1226Rfs*62) Published as g.50111986insC, ENSCAFT00000031582.6:c.3663_3664insC, p.(Gly1222Argfs*62). Coordinates in this table have been adjusted in accordance with the HGVS recommendations.  2024 39175162
1720 OMIA:002165-9615 dog Scottish Terrier (Dog) Ehlers-Danlos syndrome, classic type 1 COL5A1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Dog10K_Boxer_Tasha 9 NC_006591.4:g.50114284del XM_038615652.1:c.3908del XP_038471580.1:(P1303Rfs*186) Published as g.50114279delC; ENSCAFT00000031582.6:c.3891del; p.(P1299Rfs*186). Coordinates in this table have been adjusted in accordance with the HGVS 3'rule. 2024 39175162
1723 OMIA:002165-9615 dog Beagle (Dog) Ehlers-Danlos syndrome, classic type 1 COL5A1 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated Dog10K_Boxer_Tasha 9 NC_006591.4:g.50131170_50131172del XM_038615652.1:c.5320_5322del XP_038471580.1:p.(G1774del) Published as chr9:50131166delGAG, ENSCAFT00000031582.6:c.5296_5298del,  p.(Glu1766del). Coordinates in this table have been adjusted in accordance with the HGVS 3'rule. 2024 39175162
1465 OMIA:002165-9685 domestic cat Bombay (Cat) classical Ehlers-Danlos syndrome COL5A1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 D4 NC_058380.1:g.93614145T>A XM_023242950.2:c.3517A>T XP_023098718.2:p.(K1173*) published as c.3514A>T; p.(Lys1172*) 2022 35627182 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1025 OMIA:002165-9685 domestic cat Domestic Shorthair (Cat) classical Ehlers-Danlos syndrome COL5A1 deletion, small (<=20) frameshift Naturally occurring variant LP/P F.catus_Fca126_mat1.0 D4 NC_058380.1:g.93615144del XM_023242950.2c.3423del XP_023098718.2:p.(L1142Sfs*134) published as c.3420delG, HGVS 3' rule applied to g. coordinates 2018 30246406 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1466 OMIA:002165-9685 domestic cat Domestic Shorthair (Cat) classical Ehlers-Danlos syndrome COL5A1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 D4 NC_058380.1:g.93620291del XM_023242950.2:c.3069del XP_023098718.2:p.(G1024Vfs*50) published as c.3066del, p.(Gly1023Valfs*50) 2022 35627182 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1609 OMIA:002165-9685 domestic cat Domestic Medium Hair (Cat) classical Ehlers-Danlos syndrome COL5A1 substitution splicing Naturally occurring variant P F.catus_Fca126_mat1.0 D4 NC_058380.1:g.93694436T>G XM_023242950.2:c.504-2A>C r.spl published as c.501-2A>C  2023 37594181 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1464 OMIA:002165-9685 domestic cat Bengal (Cat) classical Ehlers-Danlos syndrome COL5A1 deletion, gross (>20) splicing Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 D4 NC_058380.1:g.93735408_93735429del XM_023242950.2:c.115_121+15del r.spl published as c.112_118+15del, Felis_catus_9.0 coordinates previously listed in OMIA as g.93331577_93331598del were incorrect and should have been g.93331575_93331596del (corrected with change to F.catus_Fca126_mat1.0, 22/06/2025) 2022 35627182 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1696 OMIA:002165-9685 domestic cat Maine Coon (Cat) classical Ehlers-Danlos syndrome COL5A1 deletion, gross (>20) Naturally occurring variant P F.catus_Fcat126_mat1.0 D4 NC_058380.1:g.93561989_93595728del deletion of 33740 base pairs including the last two exons of COL5A1 2024 38745376
1859 OMIA:002165-9615 dog Maltese (Dog) Ehlers-Danlos syndrome, classic type 1 COL5A1 substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 9 NC_049230.1:g.50854306G>A XM_038548863.1:c.2228G>A XP_038404791.1:p.(G743E) 2025 41472142
1263 OMIA:002295-9913 taurine cattle Holstein (black and white) (Cattle) Ehlers-Danlos syndrome, classic type, 2 COL5A2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.7331916G>T XM_024979774.1:c.2366G>T XP_024835542.1:p.(G789V) XM_024979774.1: c.2366G>T; XP_024835542.1: p.Gly789Val (Jacinto et al., 2020) rs5334475045 2020 33143196
1460 OMIA:002295-9615 dog Chihuahua (Dog) Ehlers-Danlos syndrome, classic type, 2 COL5A2 deletion, gross (>20) deletion (in-frame) Naturally occurring variant Not currently evaluated CanFam3.1 36 g.30548697_30548723del c.3388_3414del p.(Lys1130_Asp1138del) XM_005640393.3; XP_005640450.1 2022 35627319
340 OMIA:001967-9615 dog Landseer (Dog) Muscular dystrophy, Ullrich type COL6A1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 31 NC_006613.3:g.39303964G>T XM_003434001.5:c.289G>T XP_003434049.2:p.(E97*) XM_003434001.5; XP_003434049.2; previously incorrectly listed in this table as c.289C>T; p.(Q97*) - corrected 8/2/2022 2015 26438297
1184 OMIA:002260-9913 taurine cattle Holstein Friesian (Cattle) de novo mutation in an AI sire COL6A3 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 3 NC_037330.1:g.116826597G>A XM_024990262.1:c.5675C>T XP_024846030.1:p.(T1892M) Bourneuf et al. (2017) detected COL6A3 g.117453719G>A; p.T1894M as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Holstein AI bull. No information was provided on the descendants of this bull. p. coordinates have been updated to reflect recent NCBI transcript [29/08/2024]. rs5334475059 2017 28904385
1625 OMIA:002274-9615 dog American Staffordshire Terrier (Dog) Muscular dystrophy, COL6A3-related COL6A3 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 25 g.48005972del c.6398del p.(P2133Rfs*109) NM_001103215.1; NP_001096685.1; published as g.48287602CG>C in CanFam4 2023 37706358
1208 OMIA:002274-9615 dog Labrador Retriever (Dog) Muscular dystrophy, COL6A3-related COL6A3 substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 25 NC_006607.3:g.48007994C>T NM_001103215.1:c.6210+1G>A NM_001103215.1; CanFam3.1 chr25:48,007,994C > T; NM_001103215.1 c.6210 + 1G > A (Bolduc et al., 2020) 2020 32439203
1207 OMIA:002274-9615 dog Labrador Retriever (Dog) Muscular dystrophy, COL6A3-related COL6A3 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 25 NC_006607.3:g.48014962G>A NM_001103215.1:c.4726C>T NP_001096685.1:p.(R1576*) NM_001103215.1; NP_001096685.1; CanFam3.1 chr25:48,014,962G > A; NM_001103215.1 c.4726C > T, p.R1576* (Bolduc et al., 2020) 2020 32439203
292 OMIA:000341-9913 taurine cattle Rotes Höhenvieh, Germany (Cattle) Vorderwälder, Germany (Cattle) Epidermolysis bullosa, dystrophic COL7A1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.2 22 g.51301158C>T c.4762C>T p.(R1588*) rs876174537 2012 22715415 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed and some variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1276 OMIA:000341-9615 dog Basset Hound (Dog) Epidermolysis bullosa, dystrophic COL7A1 complex rearrangement frameshift Naturally occurring variant Not currently evaluated CanFam3.1 20 g.[40524302_40524308del;40524267_40524380dup] c.[2028_2034del;1993_2050+56dup] p.(V677Sfs*11) NM_001002980.1; NP_001002980.1; complex duplication event spanning parts of exon 15 and intron 15 of the COL7A1 gene, starting at position 40,524,267 and ending at 40,524,380 on chromosome 20 (CanFam3.1 assembly) (Garcia et al., 2020). 2020 33291836
357 OMIA:000341-9615 dog Central Asian Shepherd Dog (Dog) Epidermolysis bullosa, dystrophic COL7A1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 20 NC_006602.3:g.40532043C>T XM_022406202.1:c.4579C>T XP_022261910.1:p.(R1527*) 2017 28493971 Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool
38 OMIA:000341-9615 dog Golden Retriever (Dog) Epidermolysis bullosa, dystrophic COL7A1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 20 NC_006602.3:g.40538034G>A XM_022406202.1:c.5716G>A XP_022261910.1:p.(G1906S) rs1152388417 2003 12874109 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
641 OMIA:001523-9615 dog Samoyed (Dog) Oculoskeletal dysplasia 2 COL9A2 deletion, gross (>20) Naturally occurring variant Not currently evaluated 15 a 1,267 bp deletion that eliminates part of the 5’UTR, all of exon 1 and part of intron 1 2010 20686772
581 OMIA:001522-9615 dog Labrador Retriever (Dog) Oculoskeletal dysplasia 1 COL9A3 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 24 g.46653422_46653423insG c.10_11insG p.(A4Gfs*46) NM_001197171.1; NP_001184100.1; published as "a 1-base insertion (guanine) in exon 1 that changes a string of four guanines (CFA24: 49,699,847–49,699,850; CanFam2) to a string of five guanines (c.7–10insG). ... (p.A4GX46)" Goldstein et al. (2010). Information in this table has been changed in accordance to HGVS 3'rule and updated to the current reference genome. 2010 20686772
1092 OMIA:001522-9615 dog Northern Inuit Dog (Dog) Oculoskeletal dysplasia 1 COL9A3 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 24 NC_006606.3:g.46660067C>T NM_001197171.1:c.700C>T NP_001184100.1:p.(R234*) 2019 31415586
944 OMIA:001621-9685 domestic cat Devon Rex (Cat) Sphynx (Cat) Muscular dystrophy-dystroglycanopathy (limb-girdle) COLQ substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 C2 NC_058376.1:g.132511706C>T XM_003992132.4:c.1190G>A XP_003992181.2:p.(C397Y) rs869320615 2015 26327126 26374066 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
643 OMIA:001988-9615 dog Bedlington Terrier (Dog) Wilson disease, COMMD1 type COMMD1 deletion, gross (>20) Naturally occurring variant Not currently evaluated 10 deletion "breakpoints were positioned at 65.3091 and 65.3489 Mb of dog chromosome 10, in intron 1 and intron 2 of COMMD1 respectively, a deletion of 39.7 kb" 2005 16293123
1545 OMIA:002667-9031 chicken Feather colour, Inhibitor of gold COMTD1 IG insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated GRCg6a 6 g.15675521_15675522insCT c.747_748insCT p.(Q250fs) XM_015288295.1; XP_015143781.1 2023 37068079
215 OMIA:001529-9913 taurine cattle Holstein Friesian (Cattle) Dominant red COPA DR^DR substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 3 NC_037330.1:g.9361962C>T NM_001105645.1:c.478C>T NP_001099115.1:p.(R160C) rs3423151160 2017 28904385 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1506 OMIA:001274-452646 American mink Coat colour, black crystal COPA substitution missense Naturally occurring variant Not currently evaluated NNQGG.v01 FNWR01000261.1 g.4876673G>A c.478C>T p.(R160C) 2022 35729186
1012 OMIA:002159-9694 tiger Golden tiger CORIN substitution missense Naturally occurring variant Not currently evaluated c.1759C>T p.(H587Y) 2017 28281538
1456 OMIA:002159-9685 domestic cat Siberian (Cat) Extreme sunshine (Siberian recessive extreme wideband) CORIN vwb^eSIB substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.165054640G>A XM_019829551.3:c.839G>A XP_019685110.2:p.(C280Y) reported as Genbank ID ON355336 2022 35574714 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1313 OMIA:002159-9685 domestic cat Siberian (Cat) Sunshine (golden) CORIN vwb^SIB substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.165124736C>T XM_019829551.3:c.2383C>T XP_019685110.2:p.(R795C) 2021 33970502 Genomic position in Felis_catus_9.0 provided by Joshua Khamis. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1463 OMIA:002159-9685 domestic cat British Shorthair (Cat) Copper (British recessive wideband) CORIN vwb^BSH substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.165124778C>T XM_019829551.3:c.2425C>T XP_019685110.2:p.(R809*) 2022 35703390 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1807 OMIA:001403-9986 rabbit Chronic pancreatitis, susceptibility to CPA1 substitution missense Base-editing Not currently evaluated OryCun2.0 7 NC_013675.1:g.14267750A>G XM_008258192.2:c.580T>C XP_008256414.1:p.(S194P) published as p.(S282P) based on human coordinates 2025 40383969
358 OMIA:002111-9913 taurine cattle Holstein (red and white) (Cattle) Cataract, recessive, CPAMD8-related CPAMD8 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 7 NC_037334.1:g.6073556C>T XM_015471929.2:c.220C>T XP_015327415.2:p.(Q74*) rs5334474964 2017 28683140
1418 OMIA:002519-9913 taurine cattle Brown Swiss (Cattle) Haplotype with homozygous deficiency BH24 CPT1C BH24 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 18 NC_037345.1:g.56098048G>A XM_002695120.5:c.158G>A XP_002695166.2:p.(G53D) XM_002695120.5 rs719328437 2021 34915862
1428 OMIA:002533-9685 domestic cat Domestic Shorthair (Cat) Osteogenesis imperfecta CREB3L1 deletion, small (<=20) frameshift Naturally occurring variant LP/P F.catus_Fca126_mat1.0 D1 NC_058377.1:g.98384181_98384182del XM_003993204.5:c.370_371del XP_003993253.2:p.(C124Lfs) published as c.370_371delTG 2022 35168412 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
916 OMIA:000881-9685 domestic cat Abyssinian (Cat) Rod-cone dysplasia CRX Rdy deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 E2 NC_058382.1:g.9492897del XM_045045412.1:c.546del XP_044901347.1:p.(P185Lfs*2) published as CRX: n.546delC; in the Felis_catus_9.0 assembly the CRX gene is duplicated and genomic coordinates in this table are given for a more recent reference genome 2010 20053974
1491 OMIA:001643-10036 golden hamster duper Cry1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated c.578del p.(P193fs) published as c.578delC 2022 35471909
1176 OMIA:000168-10141 domestic guinea pig Cataract Cryz deletion, gross (>20) splicing Naturally occurring variant Not currently evaluated "a 102-bp deletion towards the 3' end of the coding region. This deletion does not interfere with the reading frame but results in a protein 34 amino acids shorter." (Rodriguez et al., 1992) 1992 1390943
692 OMIA:000852-9925 goat Casein, alpha-S1, reduced concentration CSN1S1 insertion, gross (>20) Naturally occurring variant Not currently evaluated 6 "a 457-bp insertion within exon 19 (last untranslated exon). This insert is a truncated long interspersed repeated element (LINE) containing part of the ORF-2, the 3' UTR and the poly(A) tail of the original retroposon." 1994 7926797
907 OMIA:001623-9925 goat Casein, alpha-S2, absence CSN1S2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS1.2 6 NC_030813.1:g.86085134G>A NM_001285585.1:c.374G>A NP_001272514.1:p.W125* published as as AJ131465 c.763G>A and p.(T110*), publication identifies that the codon changed is 'TGG' coding for tryptophan (W) - information in the table updated to recent transcript [04/10/2024] rs268293093 2001 11419340 The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries
220 OMIA:002033-9913 taurine cattle A2 milk CSN2 A2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 6 g.85451298T>G c.245A>C p.(H82P) Note that cattle cannot be genotyped for the A2 allele solely on the basis of the c.245A>C variant because this variant is common to 4 other alleles; see Table 2 of Caroli et al. (2009) J. Dairy Sci. 92, 5335-5352 (Matt McClure, pers. comm.) rs43703011 2013 23102962 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1312 OMIA:001424-9925 goat Absence of β‐casein CSN2 CSN2^0 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS1.2 6 NC_030813.1:g.86008404del XM_013964699.2:c.295del XP_013820153.1:p.I99Sfs*10 Changed from g.86008401del to g.86008404del to adhere to the HGVS 3’rule [22/01/10]' previously listed as ENSCHIT00000032661.1:c.175del ENSCHIP00000024801.1:p.Ile59SerfsTer10; update to NCBI transcript information [04/10/24]; Persuy et al. (1999): "allele CSN2^O had a one-nucleotide deletion in the 5' end of exon 7, which introduces a premature stop codon. The open reading frame of allele CSN2^O encodes a shortened polypeptide of 72 amino acids, compared to 223 amino acids for caprine pre beta-casein A." rs645737170 1999 10612234
1311 OMIA:001424-9925 goat Absence of β‐casein CSN2 CSN2^01 substitution regulatory Naturally occurring variant Not currently evaluated ARS1.2 6 NC_030813.1:g.86015651A>G Cosenza et al. (2016): "nucleotide C .... negatively affects the promoter activity of the CSN2 gene" Synonyms: dbSNP ss1245869815 rs654545998 2007 17931404 The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries
1186 OMIA:002262-9913 taurine cattle Montbéliarde (Cattle) de novo mutation in an AI sire CSNK1G2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 7 g.44265842G>C p.(D164H) Bourneuf et al. (2017) detected Chr7 CSNK1G2 g.45885860G>C; p.D164H as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Montbéliarde AI bull. No information was provided on the descendants of this bull. rs5334475073 2017 28904385
66 OMIA:001505-9615 dog American Bulldog (Dog) Neuronal ceroid lipofuscinosis, 10 CTSD substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 18 NC_006600.3:g.46013354C>T NM_001025621.1:c.597G>A NP_001020792.1:p.(M199I) 2006 16386934 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
905 OMIA:001505-9940 sheep Roslagsfår, Sweden (Sheep) Neuronal ceroid lipofuscinosis, 10 CTSD substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 21 NC_040272.1:g.51583020G>A XM_027959254.1:c.883G>A XP_027815055.1:p.(D295N) published as c.934G>A; protein and cDNA positions in this table based on XP_027815055.1 and XM_027959254.1, respectively 2000 10856224 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1517 OMIA:002607-9685 domestic cat Domestic Longhair (Cat) Pyknodysostosis CTSK substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 C1 NC_058375.1:g.105446558G>A XM_045033477.1:c.724C>T XP_044889412.1:p.(R242*) variant is reported in a single affected cat 2022 36532681 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
529 OMIA:001786-9615 dog Beagle (Dog) Intestinal cobalamin malabsorption due to CUBN mutation CUBN deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 2 NC_006584.3:g.19796293del NM_001003148.1:c.786del NP_001003148.1:p.(D262Efs*47) NM_001003148.1; NP_001003148.1; deletion C rs1152388404 2014 24164695
447 OMIA:001786-9615 dog Border Collie (Dog) New Zealand Heading Dog (Dog) Intestinal cobalamin malabsorption due to CUBN mutation CUBN deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 2 NC_006584.3:g.19974334del NM_001003148.1:c.8392del NP_001003148.1:p.(Q2798Rfs*3) NM_001003148.1; NP_001003148.1; deletion C; additional breeds based on PMID:40965331 2013 23613799
1036 OMIA:001786-9615 dog Komondor (Dog) Intestinal cobalamin malabsorption, CUBN-related CUBN substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 2 NC_006584.3:g.19981457G>A NM_001003148.1:c.8746+1G>A NM_001003148.1 2018 30591068
287 OMIA:001697-9913 taurine cattle Jersey (Cattle) Abortion due to haplotype JH1 CWC15 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 15 NC_037342.1:g.15449431C>T NM_001046399.2:c.163C>T NP_001039864.1:p.(R55*) UMD3.1 position is g.15707169C>T, cDNA and protein positions based on XM_005215764.2 rs1115118696 2013 23349982 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1700 OMIA:002131-9615 dog Mixed Breed (Dog) Methaemoglobinaemia, CYB5R3-related CYB5R3 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 10 NC_006592.3:22836975A>G NM_001048084.1:c.604A>C NP_001041549.1:p.(T202A) reported in a single dog 2020 33293645
1699 OMIA:002131-9615 dog American Pit Bull Terrier (Dog) Mixed Breed (Dog) Methaemoglobinaemia, CYB5R3-related CYB5R3 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 10 NC_006592.3:22841895G>C NM_001048084.1:c.656G>C NP_001041549.1:p.(R219P) 2020 33293645
850 OMIA:002131-9615 dog Mixed Breed (Dog) Methaemoglobinaemia, CYB5R3-related CYB5R3 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 10 NC_006592.3:g.22832963G>A NM_001048084.1:c.226G>A NP_001041549.1:p.(G76S) Published as g.22832963G>A, c.214G>A. Coordinates had been updated to 10:22,832,962G>A, c.227G>A, p.Gly76Ser based on Table 1, Jaffey et al. (2020). After review of the genome browser, coordinates were changed to g.22832963G>A, c.226G>A [09/06/2025]. Reported in a single dog. 2017 28963729 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
967 OMIA:002131-9615 dog Chihuahua (Dog) Mixed Breed (Dog) Pomeranian (Dog) Rat Terrier (Dog) Methaemoglobinaemia, CYB5R3-related CYB5R3 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 10 NC_006592.3:g.22836951A>C NM_001048084.1:c.580A>C NP_001041549.1:p.(I194L) NM_001048084.1; NP_001041549.1 2018 29356095 Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn.
1155 OMIA:002131-9685 domestic cat Domestic Shorthair (Cat) Methaemoglobinaemia, CYB5R3-related CYB5R3 substitution missense Naturally occurring variant LP/P F.catus_Fca126_mat1.0 B4 NC_058374.1:g.135602485C>T XM_045062469.1:c.547G>A XP_044918404.1:p.(G183S) published as "p.Gly209Ser amino acid change in transcript CYB5R3-202 (ENSFCAT00000056925) at position B4:137967506", c. and p. coordinates have been updated to reflect recent transcript and protein inforamtion [08/07/2025] 2019 31650629 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1548 OMIA:002131-9685 domestic cat Domestic Shorthair (Cat) Methaemoglobinaemia, CYB5R3-related CYB5R3 substitution splicing Naturally occurring variant LP/P F.catus_Fca126_mat1.0 B4 NC_058374.1:g.135605715C>T XM_045062469.1:c.226+5G>A two transcripts were observed in the cat with the splice variant resulting in two predicted protein variants: XP_044918404.1:p.(G76_Q77insERSPDPARVEPG) and XP_044918404.1:p.(V52Afs*58) 2023 37048064
1156 OMIA:002131-9685 domestic cat Domestic Shorthair (Cat) Methaemoglobinaemia, CYB5R3-related CYB5R3 substitution splicing Naturally occurring variant P F.catus_Fca126_mat1.0 B4 NC_058374.1:g.135605793C>G XM_045062469.1:c.154-1G>C published as a splice acceptor variant at c.232-1G>C in the CYB5R3-202 transcript (ENSFCAT00000056925) at position B4:137970815, c. coordinates updated to reflect recent transcript information [08/07/2025] 2019 31650629 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
629 OMIA:000017-9986 rabbit Adrenal hyperplasia, congenital CYP11A1 deletion, gross (>20) Naturally occurring variant Not currently evaluated "a large deletion mutation in the P450scc gene" 1993 7682938
1751 OMIA:000017-8128 Nile tilapia Steroid hormone-deprived sex reversal, CYP11A1-related cyp11a1 deletion, gross (>20) Genome-editing (CRISPR-Cas9) Not currently evaluated 22 bp deletion in exon 4 2024 39284885
117 OMIA:001661-9685 domestic cat Adrenal hyperplasia, congenital, due to 11-beta hydroxylase deficiency CYP11B1 substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 F2 NC_058385.1:g.81965422G>A XM_004000154.4:c.1151G>A XP_004000203.1:p.(R384Q) published as "a guanosine-to-adenosine mutation in exon 7 that results in an arginine to glutamine amino acid substitution 2012 22827537 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
720 OMIA:000452-9031 chicken Campine (Chicken) Sebright Bantams, United Kingdom of Great Britain and Northern Ireland (Chicken) Henny feathering CYP19A1 insertion, gross (>20) Naturally occurring variant Not currently evaluated GRCg6a 10 g.9683879_9683880insN[7524] The insertion is 7524bp and "contains an intact endogenous retrovirus that was not found in chickens representing 31 different breeds not showing henny feathering or in samples of the ancestral red junglefowl. The sequence shows over 99% sequence identity to the avian leukosis virus ev-1 and ev-21 strains, suggesting a recent integration. The ERV 3’LTR, containing a powerful transcriptional enhancer and core promoter with TATA box together with binding sites for EFIII and Ig/EBP inside the CYP19A1 5′ untranslated region" (Li et al., 2019) 1991 1939054 Genomic location and size of the insertion provided by Li et al. (2019)
274 OMIA:001405-9615 dog Beagle (Dog) Huntaway (Dog) New Zealand Heading Dog (Dog) Metabolizer of a cognitive enhancer CYP1A2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 30 NC_006612.3:g.37821686C>T NM_001008720.1:c.1117C>T NP_001008720.1:p.(R373*) Additional breeds based on PMID:40965331 rs852922442 2004 15564884 Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool
1251 OMIA:002288-9913 taurine cattle Hereford (Cattle) Mandibulofacial dysostosis CYP26C1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 26 g.14404993T>C c.563T>G p.(L188P) ENSBTAT00000056396.3:c.563T>G; ENSBTAP00000050244.2:p.Leu188Arg rs431913023 2020 33105751
502 OMIA:000837-9685 domestic cat Domestic Shorthair (Cat) Vitamin D-deficiency rickets, type IA CYP27B1 deletion, small (<=20) frameshift Naturally occurring variant Currently unresolved F.catus_Fca126_mat1.0 B4 NC_058374.1:g.84034173del XM_003988966.4:c.731del XP_003989015.2:p.(R244Pfs*32) published as c.731delG 2009 19138382 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
315 OMIA:000837-9685 domestic cat Siamese (Cat) Vitamin D-deficiency rickets, type IA CYP27B1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B4 NC_058374.1:g.84034267C>A XM_003988966.4:c.637G>T XP_003989015.2:p.(E213*) rs5334475145 2012 22553308 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
656 OMIA:000837-9823 pig Vitamin D-deficiency rickets, type I CYP27B1 deletion, gross (>20) Naturally occurring variant Not currently evaluated Sscrofa11.1 5 NM_213995.1:c.952_1124del the first of two deletions (173 bp or 329 bp) in the cDNA for cytochromome P450C1 (otherwise known as CYP27B1),  2003 12915218
657 OMIA:000837-9823 pig Vitamin D-deficiency rickets, type I CYP27B1 deletion, gross (>20) Naturally occurring variant Not currently evaluated Sscrofa11.1 5 NM_213995.1:c.952_1279del the second of two deletions (173 bp or 329 bp) in the cDNA for cytochromome P450C1 (otherwise known as CYP27B1) 2003 12915218
1576 OMIA:000837-9615 dog Pug (Dog) Vitamin D-deficiency rickets, type IA CYP27B1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 10 NC_049231.1:g.2182971G>T XM_038549826.1:c.261C>A XP_038405754.1:p.(Y87*) XM_038549826.1; XP_038405754.1 2023 37293695
1411 OMIA:002508-9913 taurine cattle Simmental (Cattle) Haplotype with homozygous deficiency SH8 CYP2B6 SH8 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 18 NC_037345.1:g.50296371A>T NM_001075173.1:c.938T>A NP_001068641.1:p.(I313N) NM_001075173.1 rs5352006042 2021 34944310
1137 OMIA:002221-9685 domestic cat Domestic Shorthair (Cat) Vitamin D-deficiency rickets, type Ib CYP2R1 deletion, small (<=20) frameshift Naturally occurring variant P F.catus_Fca126_mat1.0 D1 NC_058377.1:g.71033344del XM_003993015.6:c.1386del XP_003993064.1:p.(F462Lfs*20) genomic position in accordance with HGVS 3'-rule 2019 30777056 Genomic position in Felis_catus_9.0 provided by Joshua Khamis. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
52 OMIA:002684-9615 dog Australian Cattle Dog (Dog) Shetland Sheepdog (Dog) Leucodystrophy CYTB substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 M m.14474G>A c.14474G>A p.(V98M) 2006 16026996 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1743 OMIA:002894-10036 golden hamster Dcaf17 deficiency Dcaf17 deletion, small (<=20) frameshift Genome-editing (CRISPR-Cas9) Not currently evaluated BCM_Maur_2.0 NW_024429189.1:g.39589667_39589671del XM_040745545.1:c.71_75del XP_040601479.1:p.(D24Gfs*24) 2024 39239833
784 OMIA:001986-9823 pig Severe combined immunodeficiency disease, autosomal, T cell-negative, B cell-negative, NK cell-positive, with sensitivity to ionizing radiation DCLRE1C substitution splicing Naturally occurring variant Not currently evaluated Sscrofa11.1 10 NC_010452.4:g.46845535G>A XM_021063988.1:c.678+1G>A rs5334475180 2015 26320255
785 OMIA:001986-9823 pig Severe combined immunodeficiency disease, autosomal, T cell-negative, B cell-negative, NK cell-positive, with sensitivity to ionizing radiation DCLRE1C substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Sscrofa11.1 10 NC_010452.4:g.46851262G>A XM_021063988.1:c.800G>A XP_020919647.1:p.(Trp267*) rs5334475181 2015 26320255
167 OMIA:000735-9796 domestic horse Belgian Draft (Horse) Connemara Pony (Horse) Haflinger (Horse) Noric (Horse) Rocky Mountain Horse (Horse) Warmblood (Horse) Welsh Pony (Horse) Ocular squamous cell carcinoma DDB2 substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 12 NC_009155.3:g.11726667C>T XM_023654000.1:c.1013C>T XP_023509768.1:p.(T338M) The EquCab2 coordinates, obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool, are g.11608667, c.1013C>T and p.T338M rs1139682898 2017 28425625 The EquCab3 g. coordinates were provided by by Meredith O’Connell, working under the guidance of Professor Ernie Bailey, 5 March 2019. Breed information updated based on PMID: 38600096; 40218305
1624 OMIA:002582-9913 taurine cattle Japanese Black, Japan (Cattle) Hepatic fibrinogen storage disease DGKG substitution missense Genome-editing (CRISPR-Cas9) Not currently evaluated ARS-UCD1.3 1 NC_037328.1:g.81082187C>T XM_002684869.5:c.2162C>T XP_002684915.3:p.T721I XM_002684869.5; XP_002684915.3 2023 37681469
1335 OMIA:002377-8845 swan goose Lion Head (Goose (domestic)) Sichuan White, China (Goose (domestic)) Knob, basal DIO2 substitution missense Naturally occurring variant Not currently evaluated AnsCyg_PRJNA183603_v1.0 NW_013185827.1 g.642923G>A p.(P265L) 2021 34193033
565 OMIA:002095-9615 dog Rhodesian Ridgeback (Dog) Epilepsy, generalized myoclonic, with photosensitivity DIRAS1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 20 g.56474668_56474671del c.564_567del p.(D189Afs*11) XM_005633100.3; XP_005633157.1; published as DIRAS1:c.564_567delAGAC 2017 28223533 Genomic and protein coordinates in CanFam3.1 provided by Robert Kuhn
1412 OMIA:002505-9913 taurine cattle Simmental (Cattle) Haplotype with homozygous deficiency SH5 DIS3 SH5 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 12 g.47511687_47511687insT c.2032dup p.(I678Nfs*2) NP_025000110.1, XM_025000110.1 2021 34944310
1308 OMIA:001484-9685 domestic cat Abyssinian (Cat) Burmese (Cat) Maine Coon (Cat) Oriental Shorthair (Cat) Ticked DKK4 Ti^CK substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.40428846C>T XM_023252567.2:c.53C>T XP_023108335.2:p.(A18V) rs5334475164 2021 33780570 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1307 OMIA:001484-9685 domestic cat Abyssinian (Cat) Ticked DKK4 Ti^A substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.40429492G>A XM_023252567.2:c.188G>A XP_023108335.2:p.(C63Y) published as g.41621481G>A rs785541575 2021 33780570 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
914 OMIA:001354-9940 sheep Rambouillet (Sheep) Muscular hypertrophy (double muscling), Callipyge DLK1 substitution regulatory Naturally occurring variant Not currently evaluated ARS-UI_Ramb_v3.0 18 NC_056071.1:g.63330265A>G "a single A/G polymorphism located at position 103,894 of GenBank AF354168 and position 267 of the GenBank STS AF401294" (Freking et al., 2002) "the CLPG mutation, an A to G transition in a highly conserved dodecamer motif located in the 90-Kb intergenic region separating the Delta-like 1 homologue (DLK1) and Gene trap locus 2 (GTL2) genes in the eponymous imprinted domain" (Xu et al., 2015; PubMed 26474044) In relation to the Oar_v4.0/oviAri4 genome assembly, the location of the causative SNP is OAR18:g.64294536A>G (Ross Tellam, pers. comm. to FN 5 Nov 2020) rs10721113 2002 12368241 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries.
615 OMIA:002109-9913 taurine cattle Brown Swiss (Cattle) Tricho-dento-osseous-like syndrome DLX3 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 19 g.36665831_36665832insGGAGCACA c.584_585insGGAGCACAGG p.(S198Rfs*99) NM_001081622 position is g.37298375_37298376insGGAGCACA rs5334475096 2017 28670783 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
728 OMIA:001919-9615 dog Nova Scotia Duck Tolling Retriever (Dog) Cleft palate 1 DLX6 insertion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 14 g.22068082_22068083insN[2056] "2056 bp insertion [including LINE1] . . within a highly conserved region of DLX6 intron 2 at cfa14.25016716"[CanFam2.0] 2014 24699068
1395 OMIA:001081-9823 pig Duchenne muscular dystrophy DMD DMD^ex52del delins, gross (>20) Transgenesis via somatic cell nuclear transfer (SCNT) Not currently evaluated X gene targeting and somatic cell nuclear transfer was used to replace DMD exon 52 with a neomycin resistance cassette 2013 23784375
680 OMIA:001081-9615 dog German Shorthaired Pointer (Dog) Muscular dystrophy, Duchenne type DMD deletion, gross (>20) Naturally occurring variant Not currently evaluated X a "deletion encompassing the entire dystrophin [DMD] gene" 1999 10407848
536 OMIA:001081-9615 dog Cocker Spaniel (Dog) Muscular dystrophy, Duchenne type DMD deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated X deletion of four nucleotides in exon 65, with a reading frame shift predicting a premature stop codon at the site of the deletion 2012 22218699
681 OMIA:001081-9615 dog Tibetan Terrier (Dog) Muscular dystrophy, Duchenne type DMD deletion, gross (>20) Naturally occurring variant Not currently evaluated X "a large deletion of exons 8-29" 2012 22218699
729 OMIA:001081-9615 dog Labrador Retriever (Dog) Muscular dystrophy, Duchenne type DMD insertion, gross (>20) Naturally occurring variant Not currently evaluated X "184 nucleotide [pseudoexon] insertion between exon 19 and exon 20, which results in a premature stop codon at the next codon downstream of the insertion" 2007 22218699 Reference not in PubMed; see OMIA 001081-9615 for reference details
957 OMIA:001081-9615 dog Rottweiler (Dog) Muscular dystrophy, Duchenne type DMD not known nonsense (stop-gain) Naturally occurring variant Not currently evaluated X "nonsense mutation in exon 58" 1994 Reference not in PubMed; see OMIA 001081-9615 for reference details
989 OMIA:001081-9615 dog Poodle, Miniature (Dog) Muscular dystrophy, Duchenne type DMD deletion, gross (>20) Naturally occurring variant Not currently evaluated X "a >5 Mb deletion on the X chromosome, encompassing the entire DMD gene" 2018 29474464
922 OMIA:001081-9685 domestic cat Domestic Shorthair (Cat) Muscular dystrophy, Duchenne type DMD deletion, gross (>20) Naturally occurring variant P X A deletion of the muscle promoter and first exon and the Purkinje neuronal first exon of the DMD gene 1994 7881288
923 OMIA:001081-9685 domestic cat Domestic Shorthair (Cat) Muscular dystrophy, Duchenne type DMD deletion, gross (>20) Naturally occurring variant LP/P X A large deletion that "involved regions of the dystrophin gene that are poorly characterized, including the cortical neuronal promoter and its first exon and the skeletal neuronal promoter and its first exon" 2014 24446404
562 OMIA:001081-9615 dog Cavalier King Charles Spaniel (Dog) Muscular dystrophy, Duchenne type DMD deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 X g.27442996_27443002del c.6057_6063del p.(N2021Pfs) NM_001003343.1; NP_001003343.1; published as c.6051_6057delTCTCAAT based on different transcript 2016 28028563
542 OMIA:001081-9615 dog Norfolk Terrier (Dog) Muscular dystrophy, Duchenne type DMD deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 X g.27606021del c.3084delG p.(G1029Nfs*30) 2015 26401335
1249 OMIA:001081-9615 dog Jack Russell Terrier (Dog) Duchenne-type muscular dystrophy DMD deletion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 X g.27615280_27982912del c.94-10346_2807-6207del XM_005641029.1 2020 33049940
1234 OMIA:001081-9615 dog Labrador Retriever (Dog) Labrador Retriever muscular dystrophy (LRMD) DMD inversion Naturally occurring variant Not currently evaluated CanFam3.1 X g.27622834_29823788inv c.-1490357_2626-947inv XM_005641029.1 2020 32767978
1235 OMIA:001081-9615 dog Border Collie (Dog) Muscular dystrophy, Duchenne DMD deletion, small (<=20) Naturally occurring variant Not currently evaluated CanFam3.1 X g.27626466del c.2841delT 2018 29843823
750 OMIA:001081-9615 dog Japanese Spitz (Dog) Muscular dystrophy, Duchenne type DMD inversion Naturally occurring variant Not currently evaluated CanFam3.1 X g.27631972_33069482inv c.-4736051_2384-5339inv XM_005641029.1; "an inversion of a 5.4-Mb fragment of the X chromosome, with one break point (BP1) in the DMD gene . . . and a second break point (BP2) in a gene farther toward the centromere, the RPGR gene". 2015 25644216
708 OMIA:001081-9615 dog Pembroke Welsh Corgi (Dog) Muscular dystrophy, Duchenne type DMD insertion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 X g.27721607_27721608insN[(4800)] "a long interspersed repetitive element-1 (LINE-1) insertion in intron 13, which introduced a new exon containing an in-frame stop codon" 2011 20714321
1492 OMIA:001081-9615 dog Labrador Retriever (Dog) Muscular dystrophy, Duchenne type DMD duplication Naturally occurring variant Not currently evaluated CanFam3.1 X g.27851768_28247504dup Shelton et al. (2022): "chrX:27,851,768-27,852,122 bp position (Intron 7 . . .) and chrX:28,247,150-28,247,504 bp position (Intron 1 . . .)" 2022 36041985
367 OMIA:001081-9615 dog Cavalier King Charles Spaniel (Dog) Muscular dystrophy, Duchenne type DMD substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 X NC_006621.3:g.26956239C>T NM_001003343.1:c.7294+5G>T NP_001003343.1; experimentally confirmed splice defect; a single nucleotide variant in the 5'-splice site of intron 51 that results in skipping of exon 50 in mRNA transcripts and a predicted premature truncation of the translated protein. Changed from NC_006621.3:g.26956239G>A to NC_006621.3:g.26956239C>T [09/06/2025] 2010 20072625
1236 OMIA:001081-9615 dog Australian Labradoodle (Dog) Australian Labradoodle dystrophinopathy DMD substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 X NC_006621.3:g.27621845G>A NM_001003343.1:c.2668C>T NP_001003343.1:p.(R890*) NM_001003343.1; NP_001003343.1; "a C to T transition at base pair 43 in exon 21 of the dystrophin gene" (Shrader et al., 2018) 2018 30286978
366 OMIA:001081-9615 dog Golden Retriever (Dog) Muscular dystrophy, Duchenne type DMD substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 X NC_006621.3:g.27926946T>C NM_001003343.1:c.531-2A>G NM_001003343.1; a point mutation in the consensus splice acceptor site in exon 6 , such that exon 7 is skipped rs1152388423 1992 1577476
1684 OMIA:001888-9685 domestic cat Kinkalow (Cat) Muscular dystrophy, X-linked DMD substitution nonsense (stop-gain) Naturally occurring variant P F.catus_Fca126_mat1.0 X NC_058380.1:g.27099390G>A XM_045050794.1:c.8467C>T XP_044906729.1:p.(Q2823*) likely de novo mutation reported in a single cat 2024 38613437 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1667 OMIA:001888-9685 domestic cat Domestic Shorthair (Cat) Muscular dystrophy, X-linked DMD substitution nonsense (stop-gain) Naturally occurring variant P F.catus_Fca126_mat1.0 X NC_058386.1:g.27110574C>T XM_045050794.1:c.8333G>A XP_044906729.1:p.(W2778*) 2024 38415938 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1898 OMIA:001888-9685 domestic cat Domestic Shorthair (Cat) Muscular dystrophy, X-linked DMD substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 X NC_058386.1:g.27875713T>C XM_045050787.1:c.6287A>G XP_044906722.1:p.(Q2096R) Published as ENSFCTP00005038844.1:c.2207T>C (p.(Q736R) - coordinates updated in this table to NCBI transcript. Variant reported in a single cat. 2026 42072044
1656 OMIA:001081-9685 domestic cat Domestic Shorthair (Cat) Muscular dystrophy, Duchenne type DMD substitution nonsense (stop-gain) Naturally occurring variant P F.catus_Fca126_mat1.0 X NC_058386.1:g.27949145C>T XM_045050794.1:c.4849C>T XP_044906729.1:p.(Q1617*)  

2024 38180235
1531 OMIA:001888-9685 domestic cat Maine Coon (Cat) Becker muscular dystrophy DMD substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 X NC_058386.1:g.27988938G>A XM_045050787.1:c.4186C>T XP_044906722.1:p.(H1396Y) 2023 36834603
1510 OMIA:001081-9685 domestic cat Maine Coon (Cat) Muscular dystrophy, Duchenne type DMD substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 X NC_058386.1:g.28208148G>A XM_045050794.1:c.1180C>T XP_044906729.1:p.(R394*) rs7111000092 2022 36359052
1714 OMIA:001081-9615 dog Border Collie (Dog) Muscular dystrophy, X-linked DMD insertion, gross (>20) frameshift Naturally occurring variant Not currently evaluated ROS_Cfam_1.0 X NC_051843.1:g.26431863_26431864insN[162] NM_001003343.1:c.9271_9272insN[162] NP_001003343.1:p.(A3091fs*21) likely de-novo variant present in a single affected dog 2024 39152696
1457 OMIA:001888-9823 pig Becker muscular dystrophy DMD insertion, gross (>20) Naturally occurring variant Not currently evaluated Sscrofa11.1 X Aihara et al. (2022): "Analysis of dystrophin mRNA showed a 62 base pair insertion between exons 26 and 27. The insertion was derived from intron 26." 2022 35220848
179 OMIA:001685-9823 OMIA:001888-9823 pig Hampshire (Pig) Landrace (Pig) Stress syndrome DMD substitution missense Naturally occurring variant Not currently evaluated Sscrofa11.1 X NC_010461.5:g.28309227G>A XM_021079545.1:c.5872C>T XP_020935204.1:p.(R1958W) Ensembl VEP was used to identify cDNA position in transcript ENSSSCT00000089893.1, SIFT score 0.01 rs196952080 2012 22691118
1615 OMIA:001081-9615 dog Brittany Spaniel (Dog) Muscular dystrophy, Duchenne DMD insertion, gross (>20) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 X RSPYR1 retrogene insertion in intron 20; reported in a single dog; reported in a single dog 2023 37628610
1616 OMIA:001081-9615 dog French Bulldog (Dog) Muscular dystrophy, Duchenne DMD insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 X g.27774668_27774669insT c.3371_3372insA p.(F1125fs) NM_001003343.1; NP_001003343.1; published as p.(F1125*), reported in a single dog 2023 37628610
1858 OMIA:001081-9615 dog Shiba Inu (Dog) Muscular dystrophy, X-linked DMD deletion, gross (>20) deletion (in-frame) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 X NC_049260.1:28139503_28156189del NP_001003343.1:p.(V89_Q119del) "~17 kb deletion that encompasses exon 5 of DMD" 2025 41300820
1614 OMIA:001081-9615 dog Brittany Spaniel (Dog) Muscular dystrophy, Duchenne DMD substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 X NC_049260.1:g.26939052G>A NM_001003343.1:c.8059C>T NP_001003343.1:p.(Q2687*) NM_001003343.1; NP_001003343.1; reported in 2 related dogs 2023 37628610
1744 OMIA:001081-9615 dog Entlebucher Mountain Dog (Dog) Muscular dystrophy, Duchenne type DMD duplication frameshift Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 X NC_049260.1:g.27027497_27,036112dup8616 NM_001003343.1:c.7528-4048_7645+4450dup NP_001003343.1:p.(I2549Sfs*3) 2024 39307576
1916 OMIA:001081-9615 dog Jack Russell Terrier (Dog) Muscular dystrophy, Duchenne type DMD deletion, gross (>20) frameshift Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 X NC_049260.1:g.28018818_28044266del NM_001003343.1:c.650-12906_963+11013del NP_001003343.1:p. (D217Afs*5) 2026 42499298
908 OMIA:001542-9940 sheep Corriedale (Sheep) Hypophosphatemic rickets, autosomal recessive, 1 DMP1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 6 NC_040257.1:g.112910614C>T XM_012180327.3:c.433C>T XP_012035717.1:p.(R145*) Published as g.112213795C>T / c.250C>T. Protein and cDNA positions in this table are based on XP_012035717.1 and XM_012180327.3. 2011 21747952 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
321 OMIA:001715-9796 domestic horse American Trotter (Horse) Bhotia Pony, India (Horse) Chakouyi, China (Horse) French Trotter (Horse) Icelandic Horse (Horse) Kentucky Mountain Saddle, United States of America (Horse) Missouri Fox Trotting Horse (Horse) Morgan (Horse) Paso Fino (Horse) Peruvian Paso (Horse) Quarter Horse (Horse) Rocky Mountain Horse (Horse) Scandinavian Coldblood Trotter (Horse) Spiti Pony, India (Horse) Tennessee Walking Horse (Horse) Thoroughbred (Horse) Zaniskari Pony (Horse) Gaitedness DMRT3 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated EquCab3.0 23 NC_009166.3:g.22391254C>A NM_001317265.1:c.902C>A NP_001304194.1:p.(S301*) rs1150690013 2012 22932389 Breed information updated based PMID:39571791 on PMID:38600096 and PMID:37149793
1352 OMIA:002442-9823 pig Large White (Pig) Sperm flagella defect DNAH17 deletion, small (<=20) splicing Naturally occurring variant Not currently evaluated Sscrofa11.1 12 NC_010454.4:g.3556402_3556414del Nosková et al. (2021): "intronic 13-bp deletion ... causes exon skipping which results in the in-frame loss of 89 amino acids from DNAH17" rs5334475172 2021 33724408
1687 OMIA:002847-9615 dog Portuguese Water Dog (Dog) Microphthalmos with hematopoietic defects, congenital DNAJC21 insertion, gross (>20) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 4 NC_049225.1:g.74274883ins[T70]TGCTGCTTGGATT 2024 38682429
39 OMIA:001466-9615 dog Boykin Spaniel (Dog) Chesapeake Bay Retriever (Dog) Curly Coated Retriever (Dog) Labrador Retriever (Dog) Pembroke Welsh Corgi (Dog) Exercise-induced collapse DNM1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 9 NC_006591.3:g.55282762C>A NM_001131049.1:c.767G>T XP_001124521.1:p.(R256L) ROS_Cfam_1.0:g.56204742C>A ENSCAFT00845051951.1:c.767G>T ENSCAFP00845040760.1:p.Arg256Leu rs852832685 2008 18806795 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1434 OMIA:002534-9615 dog Border Collie (Dog) Centronuclear myopathy 1 DNM2 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 20 NC_006602.3:g.50423497G>A XM_005632882.3:c.1393C>T XP_005632939.1.:p.(R465W) XM_005632882.3; XP_005632939.1. 2022 35244154
125 OMIA:001776-9685 domestic cat Dihydropyrimidinase deficiency DPYS substitution missense Naturally occurring variant P F.catus_Fca126_mat1.0 F2 NC_058385.1:g.49914423C>T XM_023248231.2:c.1303G>A XP_023103999.2:p.(G435R) 2012 23430934 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1194 OMIA:002266-9615 dog Rottweiler (Dog) Hyperkeratosis, palmoplantar, DSG1-related DSG1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 7 g.58163636_58163640del c.2541_2545del p.(G848Wfs*2) NM_001002939.1; NP_001002939.1; published as c.2541_2545delGGGCT 2020 32344723
1392 OMIA:002452-9685 domestic cat Domestic Shorthair (Cat) Hair shaft dysplasia DSG4 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 D3 NC_058379.1:g.53103168del XM_019815116.2:c.76del XP_019670675.2:p.(I26Lfs*4) 2022 34878611 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1393 OMIA:002452-9685 domestic cat Domestic Shorthair (Cat) Hair shaft dysplasia DSG4 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 D3 NC_058379.1:g.53124305del XM_019815116.2:c.1777del XP_019670675.2:p.(H593Tfs*23) 2022 34878611 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1408 OMIA:002243-9913 taurine cattle Highland (Cattle) Ichthyosis, DSP-related DSP substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 23 NC_037350.1:g.47826600G>T NM_001192368.2:c.6893C>A NP_001179297.1:p.(A2298D) NM_001192368.2; NP_001179297.1 rs5385033307 2022 34996433
1710 OMIA:002243-9615 dog Poodle, Miniature (Dog) Ichthyosis, syndromic DSP deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 35 NC_049256.1:g.8804542_8804544del XM_038584124.1:c.1821_1823del XP_038440052.1:p.(N608del) de novo variant in one dog 2024 39136317
1115 OMIA:002210-9823 pig Bama Xiang Zhu, China (Pig) Congenital hypothyroidosis DUOX2 substitution missense Naturally occurring variant Not currently evaluated Sscrofa11.1 1 NC_010443.5:g.126625620A>G NM_213999.2:c.1226A>G NP_999164.2:p.(D409G) ENU mutagenesis was used to create these pigs, the mutation is located within an exonic splicing enhancer motif and causes aberrant splicing of DUOX2 transcripts (Cao et al., 2019) rs5334475175 2019 30651277
1806 OMIA:002964-9986 rabbit New Zealand White (Rabbit) Thrombocytopenia DUT substitution missense Base-editing Not currently evaluated OryCun2.0 17 NC_013685.1:g.24154696T>C XM_002717835.3:c.347A>G XP_002717881.2:p.(Y116C) Published as c.3020A>G 2025 40362420
1056 OMIA:002186-9615 dog Boston Terrier (Dog) Bulldog (Dog) French Bulldog (Dog) Screw tail DVL2 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 5 g.32195051del c.2051del p.(P684Lfs*26) XM_005619960.3; XP_005620017.1; published as g.32195043_32195044del; c.2044delC and changed to HGVS nomenclature in this table 2018 30521570
711 OMIA:000543-9913 taurine cattle Danish Holstein (Cattle) Anhidrotic ectodermal dysplasia EDA HED6 insertion, gross (>20) frameshift Naturally occurring variant Not currently evaluated X "a LINE1-derived pseudoexon between EDA exons 1 and 2. The 161-bp-long pseudoexon introduces a shift in reading frame and a premature stop codon early in EDA exon 2" 2011 22034998 Allele id was copied from Table 1 of Capuzzello et al. (2022)
1739 OMIA:000543-103695 central bearded dragon Scaleless EDA Sca deletion, gross (>20) deletion (in-frame) Naturally occurring variant Not currently evaluated "in-frame deletion of 14 amino acids in a highly conserved tumor necrosis factor (TNF) motif of the EDA protein" 2016 28439533
645 OMIA:000543-9913 taurine cattle Deutsche Holstein Schwarzbunt, Germany (Cattle) Anhidrotic ectodermal dysplasia EDA HED1 deletion, gross (>20) frameshift Naturally occurring variant Not currently evaluated X c.397_502del p.(M133Vfs*111) a large deletion including exon 3 in the gene for ectodysplasin (ED1; now called EDA) 200922: g. info moved to here (g.85821470) until it can be standardised 2001 11591646 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 Allele id and p. information were copied from Table 1 of Capuzzello et al. (2022)
1120 OMIA:000543-9913 taurine cattle Holstein Friesian (Cattle) Generalized hypohidrotic ectodermal dysplasia EDA HED8 inversion Naturally occurring variant Not currently evaluated ARS-UCD1.2 X g.77174882_80737442inv Escouflaire et al. (2019): The "first breakpoint . . . [is] between positions 82,271,052 and 82,271,053 bp on chromosome X . . . The second breakpoint is situated at position 86,034,441 bp within the EDA intron 1" 2019 31533624 Allele id was copied from Table 1 of Capuzzello et al. (2022).
1293 OMIA:000543-9913 taurine cattle Red Angus-Simmental cross Hypohidrotic ectodermal dysplasia EDA HED9 deletion, gross (>20) Naturally occurring variant Not currently evaluated ARS-UCD1.2 X g.80382423_80435202del GCF_002263795.1 (O'Toole et al., 2021) 2021 33801223 Allele id was copied from Table 1 of Capuzzello et al. (2022).
1484 OMIA:000543-9913 taurine cattle British Blue x Holstein-Friesian cross Anhidrotic ectodermal dysplasia, EDA-related EDA HED10 deletion, gross (>20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 X g.80516615_80538514del c.397_502del p.(M133Vfs*111) NM_001081743.2; NP_001075212.1 2022 36068608 Allele id was copied from Table 1 of Capuzzello et al. (2022).
586 OMIA:000543-9913 taurine cattle Japanese Black, Japan (Cattle) Anhidrotic ectodermal dysplasia EDA HED7 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 X g.80802800_80802801insCCCT c.280_281insAGGG p.(G94Qfs*49) rs5334475024 2012 22497423 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Allele id was copied from Table 1 of Capuzzello et al. (2022).
1665 OMIA:000543-9913 taurine cattle Fleckvieh-Simmental, Germany (Cattle) Hypohidrotic ectodermal dysplasia, X-linked EDA substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 X g.80417567C>T c.679G>A p.(G227R) NM_001081743.2; NP_001075212.1; published as g.85716041G>A in ARS-UCD2.0 rs1114816375 2023 38275590
373 OMIA:000543-9913 taurine cattle Deutsche Holstein Schwarzbunt, Germany (Cattle) Anhidrotic ectodermal dysplasia EDA HED2 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 X NC_037357.1:g.80411671A>C NM_001081743.2:c.924+2T>G c.DNA position is based on NM_001081743.2 rs5334474632 2002 12021844 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Allele id was copied from Table 1 of Capuzzello et al. (2022)
1661 OMIA:000543-9913 taurine cattle Limousin (Cattle) Hypohidrotic ectodermal dysplasia, X-linked EDA HED11 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 X NC_037357.1:g.80411716T>C NM_001081743.2:c.881A>G NP_001075212.1:p.(E294G) NM_001081743.2; NP_001075212.1 rs439722471 2024 38252617
1295 OMIA:000543-9913 taurine cattle Holstein Friesian (Cattle) Anhidrotic ectodermal dysplasia EDA HED5 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 X NC_037357.1:g.80411795C>T NM_001081743.2:c.802G>A "a single nucleotide polymorphism (SNP) G/A at the 9th base of exon 8 [GenBank: AJ278907.1 position 30.549] ... Sequencing of the RT-PCR products revealed that the amplified fragment of the affected animals lacked ... exon 8. At the protein level, the exon skipping leads to a frameshift and consequently to a premature stop codon." (Gargani et al., 2011) 2011 21740563 Allele id and c. information were initially copied from Table 1 of Capuzzello et al. (2022), where this variant was incorreclty listed as g.80411795C>A and c.802C>A. This variant table was corrected on [13/02/2026] based on invaluable feedback from David W. Silversides who noted the error.
1294 OMIA:000543-9913 taurine cattle Red Angus-Charolais-Simmental cross Anhidrotic ectodermal dysplasia EDA HED3 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 X NC_037357.1:g.80415626G>A NM_001081743.2:c.730C>T NP_001075212.1:p.(R244*) rs5334474792 2006 17616058 Reference not in PubMed; see OMIA 000543-9913 for reference details The g. coordinate for the named reference genome assembly, together with the c. coordinate, were kindly provided by Tosso Leeb (22 March 2021). Allele id was copied from Table 1 of Capuzzello et al. (2022).
482 OMIA:000543-9913 taurine cattle Holstein Friesian (Cattle) Anhidrotic ectodermal dysplasia EDA HED4 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 X NC_037357.1:g.80803015_80803033del NM_001081743.2:c.48_66del NP_001075212.1:p.(A16S22fs*55) "a 19-bp deletion at nucleotides c.48_66 in exon 1 ... . This mutation is predicted to generate a truncated 49 aa protein." rs5334474984 2011 21410470 Allele id and p. information were copied from Table 1 of Capuzzello et al. (2022)
1458 OMIA:000543-9615 dog Mixed Breed (Dog) X-linked hypohidrotic ectodermal dysplasia EDA not known splicing Naturally occurring variant Not currently evaluated CanFam3.1 X r.385_487del p.M129fs*112 NM_001014770.2; NP_001014770.1; EDA transcript lacks 103 nucleotides encoded by exon 2, exon skipping is likely to be caused by an intronic splice variant 2016 27449516
1017 OMIA:000543-9615 dog Dachshund (Dog) X-linked hypohidrotic ectodermal dysplasia EDA deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 X g.54509504del c.842delT p.(L281Hfs*22) 2018 30276836
361 OMIA:000543-9615 dog German Shepherd Dog (Dog) Anhidrotic ectodermal dysplasia EDA substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 X NC_006621.3:g.54511433G>A NM_001014770.2:c.910-1G>A NM_001014770.2 rs1152388425 2005 16151697 Genomic coordinates in CanFam3.1 und EVA Id provided by Zoe Shmidt and Robert Kuhn.
1705 OMIA:000543-9685 domestic cat Domestic Shorthair (Cat) Hypohidrotic ectodermal dysplasia EDA substitution missense Naturally occurring variant P F.catus_Fca126_mat1.0 X NC_058386.1:g.57148944G>A XM_011291781.3:c.1042G>A XP_011290083.1:p.(A348T) reported in a single cat 2024 39062633
724 OMIA:001695-8090 Japanese medaka Reduced scale-3 edar insertion, gross (>20) Naturally occurring variant Not currently evaluated "several kb of extra sequence in the 5' UTR that . . . contains out-of-frame start codons and stop codons, [and consequently] the mutant transcript is likely to result in premature initiation and termination of translation and, as a result, the EDAR protein is not synthesized" 2001 11516953
843 OMIA:002128-9913 taurine cattle Charolais (Cattle) Anhidrotic ectodermal dysplasia, EDAR-related EDAR insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 11 g.44599876_44599877insC p.(P161Rfs*97) UMD3.1 position is g.44462236_44462237insC 2017 28904385 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1550 OMIA:002687-9940 sheep Fleece variation, wool density EDAR substitution regulatory Naturally occurring variant Not currently evaluated Oar_v4.0 3 g.61927840T>C the T allele is associated denser wool production in fine wool sheep rs408766096 2024 37137429
1869 OMIA:002887-37003 mangrove rivulus Ectodermal dysplasia, no-fin-ray edaradd nfr substitution missense Chemical mutagenesis (ENU) Not currently evaluated ASM164957v2 LH22 NC_051451.1:g.11425249C>T XM_017421743.3:c.574C>T XP_017277232.1:p.(R192C) 2025 39837941
1738 OMIA:002887-94885 corn snake Scaleless EDARADD scl deletion, small (<=20) nonsense (stop-gain) Naturally occurring variant Not currently evaluated UNIGE_PanGut_3.0 Super-Scaffold_423 NW_023010793.1:g.39572203_39572204del XM_034428296.1:c.545_546del XP_034284187.1:p.(C182*) 2023 37315141
1474 OMIA:002560-9913 taurine cattle Lidia, Spain (Cattle) Growth and respiratory lethal syndrome EDN2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 3 g.104701617G>A c.149G>A p.(C50Y) ENSBTAG00000021434; ENSBTAT00000028571.3 2022 35912509
722 OMIA:001671-9031 chicken Bohuslän - Dals svarthöna, Sweden (Chicken) Chinese Xingyi bantam, China (Chicken) Dulong chicken, China (Chicken) Emei Black, China (Chicken) Guangxi Black-bone chicken, China (Chicken) H'mong, Viet Nam (Chicken) Jiuyuan Black, China (Chicken) Kadaknath, India (Chicken) Kedu, Indonesia (Chicken) Luning, China (Chicken) Miyi, China (Chicken) Muchuan Silkies Black, China (Chicken) Nunukan, Indonesia (Chicken) Pengxian Buff, China (Chicken) Piao chicken, China (Chicken) Qiandongnan Xiao Xiang, China (Chicken) Silkie (Chicken) Sumatra (Chicken) Taliu Black-bone chicken, China (Chicken) Tibetan, China (Chicken) Weining, China (Chicken) Wuding, China (Chicken) Wuliangshang Black –bone chicken, China (Chicken) Wumeng Silkies, China (Chicken) Xichuan black-bone chicken, China (Chicken) Xishuangbanna Fighting, China (Chicken) Yeonsan Ogye, Republic of Korea (Chicken) Yimeng Blue, China (Chicken) Silky/Silkie pigmentation (Fibromelanosis) EDN3 FM complex rearrangement Naturally occurring variant Not currently evaluated 20 The FM mutation was initially reported as "the duplication of two genomic regions, each larger than 100 kb and separated by 417 kb on wild-type [GGA20] chromosomes". Ma et al. (2025, PMID: 40102581) report additional breeds and provide more detailed information: "The FM allele constitutes a truly complex structural variant involving two large duplications (127.4 kb and 170.5 kb), an inversion and translocation of the 170.5 duplication and with a 412.5 kb non-duplicated intervening region." 2011 22216010
1747 OMIA:002901-8296 axolotl Skin colour, white EDN3 d not known Not currently evaluated cDNA from animals with the white phenotype lack exon 2 2017 28127056
760 OMIA:002164-9925 goat Coat colour, white spotting, EDNRA-related EDNRA repeat variation Naturally occurring variant Not currently evaluated 17 "a 1Mb copy number variant (CNV) harboring 5 genes including EDNRA. The analysis of 358 Boer goats revealed 3 alleles with one, two, and three copies of this CNV. The copy number is correlated with the degree of white spotting in goats" 2016 27329507
160 OMIA:000629-9796 domestic horse American Paint (Horse) Miniature Horse (Horse) Quarter Horse (Horse) Thoroughbred (Horse) Megacolon EDNRB frame overo delins, small (<=20) missense Naturally occurring variant Not currently evaluated EquCab3.0 17 NC_009160.3:g.50503041_50503042delinsCT NM_001081837.2:c.353_354delinsAG NP_001075306.2:p.(I118K) NM_001081837.2; NP_001075306.2 1998 9530628
930 OMIA:001765-9940 sheep West African Dwarf (Sheep) Waardenburg syndrome, type 4A EDNRB deletion, gross (>20) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 10 "a deletion of about 110 kb on sheep chromosome [OAR]10, comprising the entire EDNRB gene" 2012 23300849
1632 OMIA:000375-8932 rock pigeon Piebald EDNRB2 Group 4 duplication Naturally occurring variant Not currently evaluated tandem duplication of a 37-kb region spanning from intron 1 of VAMP7 to just 5’ of EDNRB2 2023 37546953
1631 OMIA:000375-8932 rock pigeon Piebald EDNRB2 Group2 substitution missense Naturally occurring variant Not currently evaluated p.(A42E) 2023 37546953
1630 OMIA:000375-8932 rock pigeon Piebald EDNRB2 Group1 substitution missense Naturally occurring variant Not currently evaluated p.(R290C) 2023 37546953
1562 OMIA:002701-51751 ball python Skin colour, EDNRB2-related EDNRB2 yellowbelly deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated c.1646del OP589186.1; 1-bp deletion introduces a frameshift, which removes or alters three of the seven transmembrane helices 2023 37191439
1563 OMIA:002701-51751 ball python Skin colour, EDNRB2-related EDNRB2 yellowbelly deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated c.1747_1763del OP589186.1; "17-bp deletion introduces a frameshift into the transcript, which removes or alters two of the seven transmembrane helices" 2023 37191439
1564 OMIA:002701-51751 ball python Skin colour, EDNRB2-related EDNRB2 specter substitution missense Naturally occurring variant Not currently evaluated c.2601G>C p.(R315P) OP589186.1 2023 37191439
1567 OMIA:002701-51751 ball python Skin colour, EDNRB2-related EDNRB2 asphalt substitution splicing Naturally occurring variant Not currently evaluated c.3118G>A OP589186.1; G-to-A substitution in the sixth splice donor for the sixth intron 2023 37191439
1565 OMIA:002701-51751 ball python Skin colour, EDNRB2-related EDNRB2 spark substitution missense Naturally occurring variant Not currently evaluated c.481G>C p.(L152F) OP589186.1 2023 37191439
1566 OMIA:002701-51751 ball python Skin colour, EDNRB2-related EDNRB2 gravel substitution splicing Naturally occurring variant Not currently evaluated c.499G>A OP589186.1; G-to-A substitution at the splice donor for the first intron 2023 37191439
257 OMIA:000375-93934 Japanese quail Feather colour, panda/dotted white EDNRB2 substitution missense Naturally occurring variant Not currently evaluated c.995G>A p.(R332H) 2007 17313575
1633 OMIA:001252-8932 rock pigeon Recessive white and bull eye EDNRB2 substitution missense Naturally occurring variant Not currently evaluated 4A g.11167700C>T c.766G>A p.(E256K) 2023 37546953
1773 OMIA:000375-9049 Indian peafowl Feather colour, white EDNRB2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated 4 g.12583552G>A p.(W206*) 2025 39965774
1164 OMIA:001252-8843 domestic goose Gang, China (Goose (domestic)) Feather colour, recessive white EDNRB2 insertion, small (<=20) Naturally occurring variant Not currently evaluated AnsCyg_PRJNA183603_v1.0 NW_013185915.1:g.750748_750735insCACAGGTGAGCTCT 2020 32066369
16 OMIA:001904-9031 chicken Feather colour, recessive white EDNRB2 mo^w substitution missense Naturally occurring variant Not currently evaluated GRCg6a 4 g.11164302G>T c.731G>T p.(C244F) NM_204120.1; NP_989451.1; published as c.1008G>T and p.(C244F); coordinates in the table have been updated to a recent reference genome and / or transcript 2014 24466053 Genomic position in GRCg6a provided by Joshua Khamis.
17 OMIA:001904-9031 chicken Feather colour, mottled EDNRB2 mo substitution missense Naturally occurring variant Not currently evaluated GRCg6a 4 g.11166001G>A c.999G>A p.(R332H) NM_204120.1; NP_989451.1; published as c.1272G>A and p.(R332H); coordinates in the table have been updated to a recent reference genome and / or transcript 2014 24466053 Genomic position in GRCg6a provided by Joshua Khamis.
1808 OMIA:002353-9615 dog Weimaraner (Dog) Congenital mirror movement disorder 1 EFNB3 CMM1 duplication frameshift Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 5 NC_049226.1:g.32799629_32799630dup XM_038536724.1:c.643_644dup XP_038392652.1:p.(A216Vfs*79) 2025 40401490
1870 OMIA:003037-9913 taurine cattle Blonde d'Aquitaine (Cattle) Perinatal lethality, EGFR-related EGFR substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.2 22 g.916239C>T XP_002696936:p.(V876*) 2026 41501727
1481 OMIA:002564-9615 dog English Springer Spaniel (Dog) Dyserythropoietic anemia and myopathy syndrome (DAMS) EHBP1L1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 18 g.52123541delG c.3120delC p.(F1041Sfs*30) XM_038563927.1; XP_038419855.1 2022 36140701
1483 OMIA:002564-9615 dog Labrador Retriever (Dog) Congenital dyserythropoietic anemia and polymyopathy EHBP1L1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 18 NC_049239.1:g.52128140G>A XM_038563927.1:c.388C>T XP_038419855.1:p.(R130*) XM_038563927.1; 2022 36011338
1901 OMIA:003057-9615 dog Mixed Breed (Dog) Cerebellar cortical degeneration, granuloprival EMC1 substitution missense Naturally occurring variant Not currently evaluated Dog10K_Boxer_Tasha 2 NC_006584.4:g.75896884C>T XM_850160.5:c.2041C>T XP_855253.2:p.(R681W) 2026 42066428
1753 OMIA:002904-9913 taurine cattle Angus (Cattle) Male subfertility, EML5-related EML5 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 10 NC_037337.1:g.100310158G>A NM_001206576.1:c.4960C>T NP_001193505.1:p.(R1654W) rs380547429 2022 35478957
452 OMIA:001805-9615 dog Italian Greyhound (Dog) Amelogenesis imperfecta ENAM deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 13 g.59946493_59946497del c.1991_1995delTTTCC p.(F665Rfs*3) XM_539305.4; XP_539305.3; published as c.1991_1995delTTTCC 2013 23638899 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
1044 OMIA:001805-9615 dog Parson Russell Terrier (Dog) Amelogenesis imperfecta ENAM substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 13 NC_006595.3:g.59945218C>T XM_539305.4:c.716C>T XP_539305.3:p.(P239L) XM_539305.4; XP_539305.3 2019 30877375 Genomic coordinates in CanFam3.1 provided by Robert Kuhn and Zoe Shmidt.
759 OMIA:000296-9031 chicken Duplex comb EOMES duplication Naturally occurring variant Not currently evaluated 2 "a 20 Kb tandem duplication containing several conserved putative regulatory elements located 200 Kb upstream of the eomesodermin gene (EOMES)" 2015 25789773
1 OMIA:000240-8932 rock pigeon Crest EPHB2 cr substitution missense Naturally occurring variant Not currently evaluated c.???C>T p.(R758C) 2013 23371554
1454 OMIA:002550-9615 dog Rhodesian Ridgeback (Dog) Early onset adult deafness EPS8L2 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated UMICH_Zoey_3.1/canFam5 18 g.25868739_25868750del c.1033_1044del p.(V345_L348del) XM_038500406.1; XP_038356334.1; published as 12-bp inframe deletion in EPS8L2 (CFA18:25,868,739-25,868,751 in the UMICH_Zoey_3.1) corresponding to deletion of amino acids VHFL 2022 35385474
1161 OMIA:000483-9925 goat Polled intersex syndrome ERG PIS complex rearrangement Naturally occurring variant Not currently evaluated 1 "a deletion with a total length of 10 159 bp and an inversely inserted approximately 480 kb-sized duplicated segment of a region located approximately 21 Mb further downstream on chromosome 1 containing two genes, KCNJ15 and ERG" (Simon et al., 2020) 2020 32060960
1169 OMIA:002543-9031 chicken Cleft primary palate ESRP2 deletion, small (<=20) Naturally occurring variant Not currently evaluated GRCg6a 11 g.3284041del rs3386590816 2020 32162363
1439 OMIA:001457-9685 domestic cat Multiple acyl-CoA dehydrogenase deficiency ETFDH substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.69030128A>C NM_001290236.1:c.692T>G NP_001277165.1:p.(F231C) 2014 24142280 Thanks to Heidi Anderson for alerting OMIA to this paper; 31 March 2022. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
617 OMIA:002540-9913 taurine cattle Japanese Brown, Japan (Cattle) Chondrodysplasia EVC2 delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 6 g.103609778_103609779delinsG c.2327_2328delinsG p.(A776Gfs*22) Published as c.2054_2055delCAinsG, cDNA and protein position in this table based on ENSBTAT00000005613.6 rs5334475076 2002 12136126 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
375 OMIA:002540-9913 taurine cattle Japanese Brown, Japan (Cattle) Chondrodysplasia EVC2 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 6 NC_037333.1:g.103594013C>T NM_173927.1:c.1356C>T Variant creates a cryptic splice donor site in exon 11 which is leading to improper splicing at position c.1355 and resulting in the 56-base RNA deletion between 1355 and 1410. The deletion causes a frameshift and premature termination. rs5334475072 2002 12136126 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
534 OMIA:002540-9913 taurine cattle Tiroler Grauvieh (Cattle) Chondrodysplasia EVC2 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 6 NC_037333.1:g.103651709_103651710del NM_173927.1:c.2993_2994del NP_776352.1:p.(D998Efs*13) rs5334475061 2014 24733244 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. 210909 FN: given that the variant is a 2bp del (AC), g.103651710_103651710del needs to be changed. BLASTing with AGAGGAGCAAGAAGAC from Fig.4 indicates that it is 719 and 710 that are deleted. THus the entry is changed to g.103651709_103651710del; and AC is removed from the c. entry.
346 OMIA:002042-9913 taurine cattle Belgian Blue (Cattle) Abortion (embryonic lethality), EXOSC4 EXOSC4 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 14 NC_037341.1:g.755826G>A NM_001078086.2:c.190G>A NP_001071554.1:p.(R64*) rs3423357300 2016 27646536 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1467 OMIA:002554-9685 domestic cat Osteochondromatosis (feline leukemia virus-negative) EXT1 duplication frameshift Naturally occurring variant P F.catus_Fca126_mat1.0 F2 NC_058385.1:g.61870704dup XM_023248762.2:c.1468dup XP_023104530.1:p.(L490Pfs*31) 2022 35719100
980 OMIA:001214-9615 dog American Staffordshire Terrier (Dog) Osteochondromatosis EXT2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 18 NC_006600.3:g.45101754G>T XM_014121199.2:c.924C>A XP_013976674.1:p.(Y308*) XM_014121199.2; XP_013976674.1; published as c.969C>A and p.(Y323*); coordinates in the table have been updated to a recent reference genome and / or transcript 2018 29485212
713 OMIA:000363-9913 taurine cattle Holstein (black and white) (Cattle) Sahiwal (Cattle) Factor XI deficiency F11 insertion, gross (>20) Naturally occurring variant Not currently evaluated 27 a 76-bp insertion in exon 12 of the Factor XI gene 200922: g. and c. info moved here (g.15367048; c.1406ins76) until can be standardised 2004 15566468 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
591 OMIA:000363-9913 taurine cattle Japanese Black, Japan (Cattle) Sahiwal (Cattle) Factor XI deficiency F11 delins, small (<=20) delins (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.2 27 g.16305660delinsATATGTGCAGAATATA c.870delinsATATGTGCAGAATATA P.(F290delinsLYVQNI) rs5334474726 2005 16104386 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
702 OMIA:000363-9615 dog Kerry Blue Terrier (Dog) Factor XI deficiency F11 insertion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 16 g.44477343_44477344ins90 c.819_820ins90 NM_001135123.1 "an insertion of 90 bp (SINE) inside of coding exon 7" resulting in a "30 amino acids insertion in the A3 domain of FXI serine protease" (Tcherneva et al., 2007). 2007 Reference not in PubMed; see OMIA 000363-9615 for reference details g. and c. coordinates kindly provided by Professor Urs Giger (27 August 2022)
1472 OMIA:000363-9685 domestic cat Maine Coon (Cat) Factor XI deficiency F11 substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.17127925G>A XM_003984601.5:c.1546G>A XP_003984650.2:p.(V516M) 2022 35627175 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
533 OMIA:000364-9685 domestic cat American Shorthair (Cat) Balinese (Cat) Bengal (Cat) Cymric (Cat) Highlander (Cat) Himalayan (Cat) Maine Coon (Cat) Maine Coon Polydactyl (Cat) Manx (Cat) Minuet (Cat) Munchkin (Cat) Munchkin Longhair (Cat) Ragdoll (Cat) Savannah (Cat) Siamese (Cat) Tennessee Rex (Cat) Factor XII deficiency F12 deletion, small (<=20) frameshift Naturally occurring variant Out of scope F.catus_Fca126_mat1.0 A1 NC_058368.1:g.172794693del NM_001168212.2:c.1321del NP_001161684.2:p.(L441Cfs*119) published as c.1321delC 2015 24793828 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Additional breeds reported based on PMID:35709088. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1815 OMIA:000364-9685 domestic cat Factor XII deficiency F12 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A1 NC_058368.1:g.172795562C>T NM_001168212.2:c.1549C > T NP_001161684.2:p.(Q517*) identified in a single cat 2019 31022435
147 OMIA:000364-9685 domestic cat Balinese (Cat) Bengal (Cat) Bengal Longhair (Cat) Bombay (Cat) British Shorthair (Cat) Devon Rex (Cat) Domestic Shorthair (Cat) Donskoy (Cat) Elf (Cat) Exotic Shorthair (Cat) Highlander (Cat) Himalayan (Cat) Lykoi (Cat) Maine Coon (Cat) Maine Coon Polydactyl (Cat) Minuet (Cat) Minuet Longhair (Cat) Munchkin (Cat) Munchkin Longhair (Cat) Neva Masquerade (Cat) Oriental Longhair (Cat) Oriental Shorthair (Cat) Persian (Cat) Peterbald (Cat) Ragdoll (Cat) Savannah (Cat) Scottish Fold (Cat) Scottish Fold Longhair (Cat) Scottish Straight (Cat) Scottish Straight Longhair (Cat) Selkirk Rex (Cat) Selkirk Rex Longhair (Cat) Siamese (Cat) Siberian (Cat) Sphynx (Cat) Tennessee Rex (Cat) Turkish Angora (Cat) Factor XII deficiency F12 substitution missense Naturally occurring variant P F.catus_Fca126_mat1.0 A1 NC_058368.1:g.172795644G>C NM_001168212.2:c.1631G>C NP_001161684.2:p.(G544A) rs5334475144 2017 28392508 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Additional breeds reported based on PMID:35709088. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1532 OMIA:001818-9913 taurine cattle Japanese Black, Japan (Cattle) Japanese Brown, Japan (Cattle) Factor XIII deficiency F13A1 substitution missense Naturally occurring variant Not currently evaluated UMD_3.1.1 23 g.48649432T>C c.248T>C p.(F83S) NM_001167894.1; NP_001161366.1; reported in Japanese Brown in PMID: 1996 Reference not in PubMed; see OMIA 001818-9913 for reference details Variant was first reported by Ogawa and Iga (1996). Variant information in this table is based on supplementary table 1 by Shibutani et al. (2023).
1910 OMIA:001818-9615 dog Black and Tan Coonhound (Dog) Factor XIII deficiency F13A1 delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 35 NC_049256.1:g.7525276_7525281delinsTTGA XM_038584097.1:c.1234_1239delinsTCAA XP_038440025.1:p.(G412Sfs*7) 2026 42184124
148 OMIA:000361-9783 Asiatic elephant Factor VII deficiency F7 substitution missense Naturally occurring variant Not currently evaluated c.202A>G p.(R68G) 2017 28118558
40 OMIA:000361-9615 dog Airedale Terrier (Dog) Alaskan Husky (Dog) Alaskan Klee Kai (Dog) American Foxhound (Dog) Basset Hound (Dog) Beagle (Dog) Catahoula Leopard Dog (Dog) Dachshund, Miniature Smooth-Haired (Dog) English Foxhound (Dog) Finnish Hound (Dog) German Shorthaired Pointer (Dog) German Wirehaired Pointer (Dog) Giant Schnauzer (Dog) Harrier (Dog) Irish Water Spaniel (Dog) Japanese Spitz (Dog) Miniature Schnauzer (Dog) Papillon (Dog) Phalène (Dog) Redbone Coonhound (Dog) Scottish Deerhound (Dog) Sealyham Terrier (Dog) Welsh Springer Spaniel (Dog) Whippet (Dog) Factor VII deficiency F7 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 22 NC_006604.3:g.60578895G>A NM_001048033.1:c.407G>A NP_001041498.1:p.(G136E) 2006 16961583 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; variant initially identified in Beagle and later reported in additional breeds: PMID:17939552; PMID: 27525650; PMID:34544496; PMID:29708978
363 OMIA:000437-9615 dog Irish Setter (Dog) Miniature Schnauzer (Dog) Haemophilia A F8 inversion splicing Naturally occurring variant Not currently evaluated X intronic inversion that results in "aberrant splicing and premature termination" 2002 12008949
1038 OMIA:000437-9913 taurine cattle Fleckvieh-Simmental, Germany (Cattle) Haemophilia A F8 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 X NC_037357.1:g.36017426A>T NM_001145508.1:c.134A>T NP_001138980.1:p.(H45L) ENSBTAT00000036726.5:c.134A>T; ENSBTAP00000036581.4:p.His45Leu rs1117392179 2018 29774585
194 OMIA:000437-9913 taurine cattle Japanese Brown, Japan (Cattle) Haemophilia A F8 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 X NC_037357.1:g.36145188T>A NM_001145508.1:c.6458T>A NP_001138980.1:p.(L2153H) rs456129807 2009 19456318 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1655 OMIA:000437-9615 dog Border Collie (Dog) Haemophilia A F8 deletion, small (<=20) Naturally occurring variant Not currently evaluated CanFam3.1 X g.122956942delA c.3206delA NM_001003212.1 2023 38104983
350 OMIA:000437-9615 dog Old English Sheepdog (Dog) Haemophilia A F8 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 X NC_006621.3:g.122973422G>A NM_001003212.1:c.1786C>T NP_001003212.1:p.(R596*) 2016 27780008 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
100 OMIA:000437-9615 dog German Shepherd Dog (Dog) Haemophilia A F8 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 X NC_006621.3:g.122975611C>T NM_001003212.1:c.1700G>A NP_001003212.1:p.(C567Y) NM_001003212.1; NP_001003212.1; published as c.1643G>A & p.(C548Y); coordinates in the table have been updated to a recent reference genome and / or transcript. 2014 25040606
99 OMIA:000437-9615 dog Boxer (Dog) Haemophilia A F8 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 X NC_006621.3:g.122981181G>C NM_001003212.1:c.1469C>G NP_001003212.1:p.(P490R) NM_001003212.1; NP_001003212.1; published as c.1412C>G & p.(P471R); coordinates in the table have been updated to a recent reference genome and/ or transcript 2014 25040606
272 OMIA:000437-9615 dog German Shepherd Dog (Dog) Haemophilia A F8 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 X NC_006621.3:g.123043081C>T NM_001003212.1:c.98G>A NP_001003212.1:p.(W33*) 2011 21949058 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1767 OMIA:000437-9685 domestic cat European Shorthair (Cat) Haemophilia A F8 substitution splicing Naturally occurring variant Currently unresolved F.catus_Fca126_mat1.0 X NC_058386.1:g.126881432A>G XM_004001054.4:c.6073+2T>C g. position previously incorrectly listed in this table as NC_058380.1:g.126881432A>G - corrected to NC_058386.1 [17/09/2025] 2024 39447565 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
621 OMIA:000437-9940 sheep Weißes Alpenschaf, Switzerland (Sheep) Haemophilia A F8 delins, small (<=20) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 X NC_040278.1:g.86301507_86301516delinsTAATTAATACC NM_001172550.1:c.3107_3116delinsGGTATTAATTA The 11 bp region in exon 14 that differed between the wild-type and the hemophiliac introduced a premature stop codon 2010 19943872 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries [21/09/06]. After checking the cDNA sequence in Fig. 3 of the paper, IT updated c. coordinates from  c.3108_3117delinsGGTATTAATTA to c.3107_3116delinsGGTATTAATTA [10/06/2025]. Published as c.3107del10ins11.
1284 OMIA:000437-9615 dog Rhodesian Ridgeback (Dog) Haemophilia A F8 insertion, gross (>20) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 X g.124073876_124073877insN[221] c.4824_4825insN[221] NM_001003212.1; published as c.4824_25ins221, genomic coordinates published as chrX: 1240738676_77. After review of the position in the reference genome on the 17/7/2023 the genomic coordinates have been updated to g.124073876_124073877insN[221] in this table. 2021 33494213
1588 OMIA:000437-9615 dog Labrador Retriever (Dog) Haemophilia A F8 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 X g.124075777_124075778del c.2923_2924del p.(E975Kfs*8) NM_001003212.1; NP_001003212 2023 37438956
636 OMIA:000438-9615 dog Labrador Retriever (Dog) Haemophilia B F9 deletion, gross (>20) Naturally occurring variant Not currently evaluated X a deletion of the entire gene 1997 9394892
637 OMIA:000438-9615 dog American Pit Bull Terrier (Dog) Haemophilia B F9 deletion, gross (>20) Naturally occurring variant Not currently evaluated X Gu et al. (1999): "A large deletion mutation was found in 1 breed variant, spanning the entire 5' region of the factor IX gene extending to exon 6". 1999 10544912 Following Table 3 from Kuder et al. (2021), the breed for this variant has been changed to Pit Bull Terrier. (18th October 2021)
1039 OMIA:000438-9615 dog Hovawart (Dog) Haemophilia B F9 deletion, small (<=20) regulatory Naturally occurring variant Not currently evaluated CanFam3.1 X g.109501492del c.-73del NM_001003323.2; Brenig et al. (2019): NC_006621.3:g.109501492delC; "The deletion is located 73 bp upstream of the F9 start codon in the conserved overlapping DNA binding sites of hepatocyte nuclear factor 4alpha and androgen receptor." 2019 30846504
705 OMIA:000438-9615 dog German Wirehaired Pointer (Dog) Haemophilia B F9 insertion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 X g.109521130_109521131insN[(1500)] NM_001003323.2; published as "insert consists of a 5' truncated canine Line-1 followed by an approximately 200-bp 3' poly (A) tract, flanked by a 15-bp direct repeat"; g. coordinate of insertion obtained from Brenig et al. (2019) 2003 14722728 CanFam3.1 coordinates copied from Table 3 of Kuder et al. (2021) (18 Oct 2021)
467 OMIA:000438-9615 dog Lhasa Apso (Dog) Haemophilia B F9 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 X g.109521356_109521361delinsT c.548_553delinsT p.(R183Lfs*3) NM_001003323.2; NP_001003323.1; published as "a deletion including nucleotides 772-776 and a C-->T transition at nucleotide 777", coordinates in the table have been updated to a recent reference genome and / or transcript and to HGVS nomenclature 1996 8896410 CanFam3.1 coordinates copied from Table 3 of Kuder et al. (2021) (18 Oct 2021)
1363 OMIA:000438-9615 dog Newfoundland (Dog) Haemophilia B F9 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 X g.109531586_109531587insA c.821_822insA p.(N274Kfs*23) NM_001003323.2; NP_001003323.1 2021 34680886
704 OMIA:000438-9615 dog Airedale Terrier (Dog) Haemophilia B F9 insertion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 X g.109532012_109532013insN[(5000)] c.1247_1248insN[(5000)] NM_001003323.2; Gu et al. (1999): "An approximately 5 kb insertion disrupted exon 8 ... associated with alternative splicing between a donor site 5' and acceptor site 3' to the normal exon 8 splice junction, with introduction of a new stop codon. The resultant transcript lacked most of the factor IX catalytic domain and 3' untranslated region." 1999 10544912 CanFam3.1 coordinates copied from Table 3 of Kuder et al. (2021) (18 Oct 2021)
47 OMIA:000438-9615 dog Rhodesian Ridgeback (Dog) Haemophilia B F9 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 X NC_006621.3:g.109530868G>A NM_001003323.2:c.731G>A NP_001003323.1:p.(G244E) NM_001003323.2; NP_001003323.1; published as p.(G244E) by Mischke et al. (2011), g. and p. coordinates were copied on the 18th October 2021 from Table 3 of Kuder et al. (2021) (relating to NP_001003323.1 ) as g.109530847G>A and p.(G237E). These g. and p. positions were incorrect. After review of Figure 1 published by Mischke et al. (2011) it was confirmed that the published p. coordinates are consistent with NM_001003323.2:c.731G>A and NP_001003323.1:p.(G244E). The g. coordinates have been updated to a recent reference genome (5th April 2022) 2011 20303304 Thank you to Agustín Arasanz for identifying that the coordinates published by Kuder et al. (2021) were inconsistent with the originally published information by Mischke et al. (2011) (5th April 2022).
46 OMIA:000438-9615 dog Cairn Terrier (Dog) Haemophilia B F9 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 X NC_006621.3:g.109532018G>A NM_001003323.2:c.1253G>A NP_001003323.1:p.(G418E) NM_001003323.2; NP_001003323.1, published as p.(G379E) by Evans et al. (1989), coordinates in the table have been updated to a recent reference genome and / or transcript 1989 2481310 c. and p. coordinates updated from Kuder et al. (2021)
127 OMIA:000438-9685 domestic cat Domestic Longhair (Cat) Haemophilia B F9 substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 X NC_058386.1:g.114354785G>A NM_001009377.3:c.383G>A NP_001009377.1:p.(C128Y) published as p.(C82Y); coordinates in the table have been updated to a recent reference genome and / or transcript 2005 15822564 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
310 OMIA:000438-9685 domestic cat Haemophilia B F9 substitution nonsense (stop-gain) Naturally occurring variant P F.catus_Fca126_mat1.0 X NC_058386.1:g.114374368C>T NM_001009377.3:c.1150C>T NP_001009377.1:p.(R384*) published as p.(R338*); coordinates in the table have been updated to a recent reference genome and / or transcript 2005 15822564 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1360 OMIA:002450-9913 taurine cattle Chianina (Cattle) Ichthyosis congenita FA2H insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 18 g.2205625_2205626insG c.9dupC p.(A4Rfs*142) NM_001192455.1; NP_001179384.1 2021 34599683
752 OMIA:002032-9615 dog Border Collie (Dog) Mixed Breed (Dog) Neuropathy, sensory FAM134B inversion Naturally occurring variant Not currently evaluated CanFam3.1 4 g.80439639_86910352inv "6.47 Mb inversion was identified with breakpoints in intron 3 of FAM134B (chr4:86,910,352) and in an upstream intergenic region (chr4:80,439,639) ... … Analysis of RNAseq data revealed FAM134B was majorly disrupted by the inversion, with novel exons occurring 3′ of the final normally transcribed exon before the inversion, due to cryptic splicing." 2016 27527794
1342 OMIA:002032-9615 dog German Spitz (Dog) Mixed Breed (Dog) Neuropathy, sensory FAM134B substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 4 NC_049225.1:G.88169941C>T NM_001314111.1:c.656C>T NP_001301040.1:p.(P219L) Initially reported in a mixed breed dog, later reported in a German Spitz (PMID: 39377488). 2021 34387380
925 OMIA:001918-9615 dog Tibetan Spaniel (Dog) Tibetan Terrier (Dog) Retinal atrophy, progressive, type 3, FAM161A-related FAM161A PRA3 insertion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 10 g.61822372_61822373insN[(230)] A ~230bp insertion containing a 132bp short interspersed nuclear element (SINE), near the splice acceptor site of exon 5 CanFam2.0 coordinate published as g.64974130 2014 24705771
1706 OMIA:001918-9615 dog English Shepherd (Dog) Retinal atrophy, progressive, type 6, FAM161A-related FAM161A PRA6 insertion, gross (>20) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 10 NC_049231.1:g.63116065_63116066ins[N[210];63116051_63116065] XM_038551371.1:c.1728_1729ins[N[210];1714-1728] XP_038407299.1:p.(Q576_M577ins*50)) published as XP_005626197.1 c.17929_ins210 2024 39062732
1183 OMIA:002259-9913 taurine cattle Montbéliarde (Cattle) de novo mutation in an AI sire FAM189A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 21 g.28112913T>C p.(N192S) Bourneuf et al. (2017) detected FAM189A1 g.28644665T>C; p.N192S as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Montbéliarde AI bull. No information was provided on the descendants of this bull. rs5334475108 2017 28904385
102 OMIA:002015-9615 dog Border Collie (Dog) Dental hypomineralization FAM20C substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 6 g.16452327G>A c.899C>T p.(A300V) 2016 27187611 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
89 OMIA:001327-9615 dog Bedlington Terrier (Dog) Irish Terrier (Dog) Kromfohrlander (Dog) Hyperkeratosis, palmoplantar FAM83G substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 5 NC_006587.3:g.41055619G>C XM_003434636.3:c.155G>C XP_003434684.1:p.(R52P) 2014 24832243 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. Additional breed informationbased on Makri et al. (2021)
1511 OMIA:002600-9986 rabbit New Zealand White (Rabbit) Amelogenesis imperfecta FAM83H deletion, gross (>20) Genome-editing (CRISPR-Cas9) Not currently evaluated large deletion of more then 900bp in exon 5 2022 36300761
460 OMIA:001683-9615 dog Cavalier King Charles Spaniel (Dog) Congenital keratoconjunctivitis sicca and ichthyosiform dermatosis FAM83H deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 13 g.37328057del c.977del p.(P326Hfs*258) NM_001289427.1; NP_001276356.1; genomic position in accordance with HGVS 3'-rule 2012 22253609 Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn.
1805 OMIA:002959-9685 domestic cat Russian Blue (Cat) REM sleep behaviour disorder FAM8A1 deletion, gross (>20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B2 NC_058372.1:g.11622168_11622190del XM_019831563.3:c.485_507del XP_019687122.3:p.(Q162Pfs*115) 2025 40266280 We are greateful to M.C. Temizkan for alerting us to a typographical error in the c. coordinates. [12/12/2025]
683 OMIA:002683-9615 dog Basenji (Dog) Fanconi syndrome FAN1 deletion, gross (>20) frameshift Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 3 NC_049224.1:g. 38383631_38383947del XM_038532604.1:c.2954_3090+181del XP_038388532.1:p.(L985Vfs19*) "317 bp of exon 14 were deleted starting at the second exon14 nucleotide and extending into the 3' untranslated region of FAN1"; details reported by Farias et al. (2024; PMID:39596669) 2011 Reference not in PubMed; see OMIA 002683-9615 for reference details
646 OMIA:000151-9913 taurine cattle Holstein (black and white) (Cattle) Brachyspina FANCI deletion, gross (>20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 21 g.20773899_20777226del p.(V877Lfs*27) 2012 22952632 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1880 OMIA:003045-9615 dog Boerboel (Dog) Autoimmune lymphoproliferative syndrome FAS duplication Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 26 NC_049247.1:g.39040590_39040603 XM_038576079.1:c.179_192dup XP_038432007.1:p.(P65Vfs*54) 2026 41742579
613 OMIA:002064-9685 domestic cat British Shorthair (Cat) Autoimmune lymphoproliferative syndrome FASLG duplication frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 F1 NC_058384.1:g.14766775dup NM_001009352.1:c.418dup NP_001009352.1:p.(R140Kfs*37) published as c.413_414insA "insertion of an adenine at position 14,607,400 [Felis_Catus_6.2]" (Aberdein et al., 2017); changed in this table to a recent reference genome and HGVS nomenclature 2017 27770190 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
377 OMIA:000628-9913 taurine cattle Japanese Black, Japan (Cattle) Marfan syndrome FBN1 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.2 10 g.61917867G>A c.8227-1G>A rs5334475078 2012 22221020 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
201 OMIA:000628-9913 taurine cattle Limousin (Cattle) Marfan syndrome FBN1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 10 NC_037337.1:g.61831200G>A NM_174053.2:c.3598G>A NP_776478.1:p.(E1200K) rs5334475103 2005 15776436 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1402 OMIA:000628-9823 pig Marfan syndrome FBN1 deletion, small (<=20) frameshift Genome-editing (ZFN) Not currently evaluated Sscrofa11.1 1 NC_010443.5:g.123246159del NM_001001771.1:c.1296del NP_001001771.1:p.(E433Nfs98*) 2016 27074716
1914 OMIA:002846-9796 domestic horse Quarter Horse (Horse) Spinocerebellar ataxia, juvenile FDXR substitution splicing Naturally occurring variant Not currently evaluated EquCab3.0 11 NC_009154.3:g.6973334G>C XM_023652064.1:c.177+1778G>C  eighth base pair of a cryptic exon identified in spinal cord tissue of affected horses 2026 42160398
910 OMIA:000836-9913 taurine cattle Blonde d'Aquitaine (Cattle) Limousin (Cattle) Protoporphyria FECH substitution extension (stop-lost) Naturally occurring variant Not currently evaluated ARS-UCD1.3 24 NC_037351.1:g.56787697C>A NM_174054.2:c.1250G>T NP_776479.1:p.(*417Lext*27) rs5334474668 1998 9784594 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
576 OMIA:001525-9615 dog German Shepherd Dog (Dog) Leukocyte adhesion deficiency, type III FERMT3 insertion, small (<=20) insertion (in-frame) Naturally occurring variant Not currently evaluated CanFam3.1 18 g.52835932_52835933insGGCAGCCGTCTT c.1349_1350insAAGACGGCTGCC p.(L450_A451insRRLP) XM_038425194.1; XP_038281122.1; 12-base pair insertion 2010 20126836
1336 OMIA:002382-9615 dog Dachshund, Miniature Wire-Haired (Dog) Afibrinogenaemia FGA deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 15 NC_006597.3:g.52240694del XM_532697.6:c.1665delT XP_532697.6:p.(I555Mfs*33) Transcript XM_532697.6 / ENSCAFT00000043702.3 rs1152388481 2021 34356081
1529 OMIA:002625-9913 taurine cattle Japanese Black, Japan (Cattle) Skeletal dysplasia, FGD3 related FGD3 delins, small (<=20) missense Naturally occurring variant Not currently evaluated UMD_3.1.1 8 g.85826989_85826990delinsTG p.(H171C) 2015 26306008
1326 OMIA:002374-9913 taurine cattle Holstein Friesian (Cattle) Jersey (Cattle) Charcot Marie Tooth disease FGD4 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.77262490C>T XM_024992559.1:c.1671+1G>A Splice donor mutation based on XM_005206883.3 rs5334475069 2021 34045765
941 OMIA:001723-9940 sheep Romney Marsh (Sheep) Familial episodic ataxia FGF14 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 10 NC_040261.1:g.88095843G>A XM_027973760.1:c.214C>T XP_027829561.1:p.(Q72*) Oar_v3.1 position is g.77593415, published as c.46C>T & p.(Q16*), coordinates in this table updated to reflect recent transcript and protein information 2017 29253853 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
327 OMIA:000889-9031 chicken Israeli experimental line, Israel (Chicken) Storrs Connecticut scaleless low line, United States of America (Chicken) UC Davis line, United States of America (Chicken) Scaleless FGF20 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated GRCg6a 4 NC_006091.5:g.63270422A>T XM_426335.6:c.724A>T XP_426335.3:p.(R242*) published as c.535A>T, p.(R179*) - g. coordinates in this table were previously incorrectly listed as g.63270401A>T - all coordinates updated to recent reference genome / transcript [1/8/2026] 2012 22712610
929 OMIA:000272-9615 dog Rhodesian Ridgeback (Dog) Thai Ridgeback (Dog) Ridge & dermoid sinus FGF3 Ridge allele duplication Naturally occurring variant Not currently evaluated CanFam3.1 18 g.48372578_48505893dup133316 A large ~133,000 bp duplication on chromosome 18, encompassing three FGF genes (FGF3, FGF4, FGF19) and another gene ORAOV1. There is an additional single T inserted between the two copies of the duplication. This is not indicated in the genomic variant designation. 2007 17906623
694 OMIA:002542-9615 dog Basset Hound (Dog) Cairn Terrier (Dog) Cardigan Welsh Corgi (Dog) Dachshund (Dog) Dandie Dinmont Terrier (Dog) Lancashire Heeler (Dog) Norwich Terrier (Dog) Pekingese (Dog) Pembroke Welsh Corgi (Dog) Petit Basset Griffon Vendeen (Dog) Shih Tzu (Dog) Skye Terrier (Dog) Swedish Vallhund (Dog) Tibetan Spaniel (Dog) West Highland White Terrier (Dog) Chondrodysplasia FGF4 retrogene CFA18 FGF4L1 insertion, gross (>20) Naturally occurring variant Not currently evaluated 18 a 5kb insertion containing a FGF4 retrogene, i.e. a processed pseudogene of FGF4: The insertion containing the FGF4 retrogene starts at 23,431,136 on CFA18, which is 25Mb away from the complete (original) FGF4 gene, which is located at CFA18 48413479-48415205 2009 19608863
855 OMIA:000157-9615 dog American Cocker Spaniel (Dog) Basset Hound (Dog) Beagle (Dog) Cardigan Welsh Corgi (Dog) Chesapeake Bay Retriever (Dog) Chihuahua (Dog) Coton de Tulear (Dog) Dachshund (Dog) English Springer Spaniel (Dog) French Bulldog (Dog) Nova Scotia Duck Tolling Retriever (Dog) Intervertebral disc disease, type I FGF4 retrogene in CFA12 FGF4L2 insertion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 12 " the insertion on CFA12 is 3,209 bp long (GenBank accession no. MF040221) and includes parental FGF4 cDNA (i.e., FGF4 exons spliced without introns) . . . ." 200922: g. info moved here (g.33710178_33710179insMF040221) until it can be standardised 2017 29073074
853 OMIA:002133-9615 dog Nova Scotia Duck Tolling Retriever (Dog) Skeletal dysplasia, FGF4-retrogene-related FGF4 retrogene on CFA12 FGF4L2 insertion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 12 " the insertion on CFA12 is 3,209 bp long (GenBank accession no. MF040221) and includes parental FGF4 cDNA (i.e., FGF4 exons spliced without introns) . . . ." 200922: g. info moved here (g.33710178_33710179insMF040221) until can be standardised 2017 29073074
983 OMIA:000439-9844 llama Long hair FGF5 haplotype Naturally occurring variant Not currently evaluated A "a single base deletion (c.348delA), [and] a 12-bp insertion (c.351_352insCATATAACATAG)" that comprise a single likely causal variant 2017 29024003
982 OMIA:000439-10141 domestic guinea pig Long hair Fgf5 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.403C>T p.(R135*) "The data were submitted to the European Variation Archive (accession no. PRJEB24997)" 2018 29603294
984 OMIA:000439-9844 llama Long hair FGF5 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.499C>T 2017 29024003
559 OMIA:000439-10036 golden hamster Hair, long Fgf5 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated c.546delG p.(R184Gfs*6) 2015 26481120
347 OMIA:000439-9793 ass (donkey) Âne de Provence, France (Ass) Âne des Pyrénées, France (Ass) Âne grand noir du Berry, France (Ass) Âne normand, France (Ass) Hair, long FGF5 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ASM1607732v2 3 NC_052179.1:g.161373495G>A XM_014836312.2:c.245G>A XP_014691798.1:p.W82* 2014 25927731
560 OMIA:000439-9793 ass (donkey) Âne Bourbonnais, France (Ass) Âne des Pyrénées, France (Ass) Âne normand, France (Ass) Poitou (Ass) Hair, long FGF5 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ASM1607732v2 3 NC_052179.1:g.161381098_161381099del XM_014836312.2:c.433_434del XP_014691798.1:p.M145Vfs*15 2014 25927731
1343 OMIA:000439-9838 Arabian camel Long hair FGF5 substitution missense Naturally occurring variant Not currently evaluated CamDro3 2 g.76625546C>T c.779C>T p.(P260L) cDNA and protein positions based on transcript ENSCDRT00005003721.1 2021 34432312
952 OMIA:000439-9615 dog Eurasier (Dog) Long hair FGF5 Lh3 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 32 NC_006614.3::g.4528617_4528632del NM_001048129.1:c.556_571del NP_001041594.1:p.(A186Tfs*71) published as c.556_571del16; p.(A186Tfs*69) rs397509816 2013 23384345 Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn.
48 OMIA:000439-9615 dog Afghan Hound (Dog) Belgian Shepherd Dog, Malinois (Dog) Belgian Shepherd Dog, Tervueren (Dog) Border Collie (Dog) Cocker Spaniel (Dog) Collie (Dog) Dachshund (Dog) German Shepherd Dog (Dog) Golden Retriever (Dog) Huntaway (Dog) New Zealand Heading Dog (Dog) Pembroke Welsh Corgi (Dog) Pomeranian (Dog) Samoyed (Dog) Long hair FGF5 Lh1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 32 NC_006614.3:g.4509367G>T NM_001048129.1:c.284G>T NP_001041594.1:p.(C95F) ROS_Cfam_1.0:g.4533621G>T ENSCAFT00845031580.1:c.290G>T ENSCAFP00845024720.1:p.Cys97Phe. Additional breeds based on PMID:40965331, PMID:41773981 rs851828354 2006 16879338 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
418 OMIA:000439-9615 dog Afghan Hound (Dog) Long hair FGF5 Lh5 substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 32 NC_006614.3:g.4517257T>A NM_001048129.1:c.368-11T>A ROS_Cfam_1.0:g.4541511T>A ENSCAFT00845031580.1:c.368-11T>A rs397511324 2013 23384345 30 Dec 2020: g. coordinate corrected: thanks to Angelica K Kallenberg
950 OMIA:000439-9615 dog Afghan Hound (Dog) Belgian Shepherd Dog, Malinois (Dog) Belgian Shepherd Dog, Tervueren (Dog) Eurasier (Dog) Long hair FGF5 Lh4 duplication frameshift Naturally occurring variant Not currently evaluated CanFam3.1 32 NC_006614.3:g.4528620_4528621dup NM_001048129.1:c.559_560dup NP_001041594.1:p.(R188Afs*75) published as c.559_560dupGG and p.(R188Afs*73),

rs397512451 2013 23384345 Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. Additional breeds based on PMID: 41773981
104 OMIA:000439-9615 dog Akita (Dog) Samoyed (Dog) Long hair FGF5 Lh2 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 32 NC_006614.3:g.4528639C>T NM_001048129.1:c.578C>T NP_001041594.1:p.(A193V) 2013 23384345 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1890 OMIA:000439-9615 dog Mixed Breed (Dog) Long hair FGF5 Lh6 duplication frameshift Naturally occurring variant Not currently evaluated Dog10K_Boxer_Tasha 32 NC_006614.4:g.37352832dup NM_001048129.1:c.562dup NP_001041594.1:p.(R188Pfs*12) published as NC_006614.4:g.37352830-37352831insG; NM_001048129: c.562_563insC - changed in this table to a duplication based on HGVS nomenclature recommendations

2026 41828909
1891 OMIA:000439-9615 dog Anatolian Shepherd Dog (Dog) Tibetan Mastiff (Dog) Long hair FGF5 Lh7 substitution missense Naturally occurring variant Not currently evaluated Dog10K_Boxer_Tasha 32 NC_006614.4:g.37352896T>A NM_001048129.1:c.497A>T NP_001041594.1:p.(E166V)


2026 41828909
1892 OMIA:000439-9615 dog Tibetan Mastiff (Dog) Long hair FGF5 Lh8 substitution missense Naturally occurring variant Not currently evaluated Dog10K_Boxer_Tasha 32 NC_006614.4:g.37364148C>A NM_001048129.1:c.407G>T NP_001041594.1:p.(R136L) published as NM_001048129.1:c.410G>T, NP_001041594.1:p.(R137L)

2026 41828909
1893 OMIA:000439-9615 dog Tibetan Mastiff (Dog) Long hair FGF5 Lh9 substitution missense Naturally occurring variant Not currently evaluated Dog10K_Boxer_Tasha 32 NC_006614.4:g.37364157A>G NM_001048129.1:c.398T>C NP_001041594.1:p.(V133A)


2026 41828909
1368 OMIA:000439-9685 domestic cat Maine Coon (Cat) Long hair FGF5 l^MCC2 (M5) substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.139634158C>T NM_001114546.1:c.577G>A NP_001108018.1:p.(A193T) 2021 34599367 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
130 OMIA:000439-9685 domestic cat Long hair FGF5 l (M4) substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.139634260G>T NM_001114546.1:c.475A>C NP_001108018.1:p.(T159P) published as c.474delT; variant can be in a haplotype with c.474del rs5334475161 2007 17433015 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
498 OMIA:000439-9685 domestic cat Maine Coon (Cat) Ragdoll (Cat) Long hair FGF5 l^MCC1 (M3) deletion, small (<=20) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.139634261del NM_001114546.1:c.474del published as c.474delT; variant can be in a haplotype with c.475A>C resulting in two different predicted effects on the protein 2007 17433015 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
311 OMIA:000439-9685 domestic cat Norwegian Forest Cat (Cat) Long hair FGF5 l^NFC (M2) substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.139645946G>A NM_001114546.1:c.406C>T NP_001108018.1:p.(R136*) rs5334475123 2007 17767004 The genomic location on Felis_catus_9.0 is based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
595 OMIA:000439-9685 domestic cat Ragdoll (Cat) Long hair FGF5 l^Rag (M1) insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.139653676_139653677insA NM_001114546.1:c.356_357insT NP_001108018.1:p.(M119Ifs) published as c.ins356T 2007 17767004 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1575 OMIA:000439-9986 rabbit Angora (Rabbit) Hair, long FGF5 substitution missense Naturally occurring variant Not currently evaluated OryCun2.0 15 g.70103616A>G c.571T>C p.(L191S) XM_008267686.2; XP_008265908.1; published as c.T19234C in exon 2; coordinates in this table are based on a recent reference genome 2023 37268908
787 OMIA:002090-9913 taurine cattle Holstein (black and white) (Cattle) Facial dysplasia syndrome FGFR2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 26 NC_037353.1:g.41489034C>A NM_001205310.1:c.927G>T NP_001192239.1:p.(W309C) rs5334475009 2017 28768473 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1675 OMIA:001313-9685 domestic cat Bengal (Cat) Egyptian Mau (Cat) Toyger (Cat) Coat texture, glitter FGFR2 insertion, gross (>20) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 D2 NC_058378.1:g.77479931_77479934insN[585] a 585-bp cat-specific Endogenous Retroviral Long Terminal Repeat (ERV1-3_FCa-type LTR) element insertion 2024 38531359 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1179 OMIA:001703-9913 taurine cattle Holstein (black and white) (Cattle) Chondrodysplasia, disproportionate FGFR3 substitution extension (stop-lost) Naturally occurring variant Not currently evaluated ARS-UCD1.3 6 NC_037333.1:g.116767863C>A NM_174318.3:c.2408G>T NP_776743.1:p.(*803Lext*93) NM_174318.3: c.2408G>T; [XM_024992994.1: p.(Ter803Leuext*93) rs5334474953 2020 32239744
225 OMIA:001703-9940 sheep Suffolk (Sheep) Chondrodysplasia, Spider lamb FGFR3 substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 6 NC_040257.1:g.128784747A>T XM_027971315.1:c.2093T>A XP_027827116.1:p.(V698E) published as c.1719T>A; p.(V700E); updated to HGVS nomenclature [10/04/2026] 2006 16441300 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
77 OMIA:001335-9615 dog German Shepherd Dog (Dog) Renal cystadenocarcinoma and nodular dermatofibrosis FLCN substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 5 NC_006587.3:g.42186445A>G XM_005619508.3:c.764A>G XP_005619565.1:p.(H255R) rs1152388411 2003 14532326 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
860 OMIA:001360-9031 chicken Beijing You, China (Chicken) Commercial strain- layer- ISA Brown (Chicken) Commercial strain- layer- Lohmann Brown (Chicken) Marans (Chicken) Rhode Island Red (Chicken) TETRA strain, United States of America (Chicken) Transylvanian Naked Neck (Chicken) Trimethylaminuria (fishy taint) FMO3 substitution missense Naturally occurring variant Not currently evaluated 8 c.1034A>T p.(T329S) 2005 15916878
304 OMIA:001360-9913 taurine cattle Swedish Red and White (Cattle) Trimethylaminuria (fishy taint) FMO3 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 16 NC_037343.1:g.38666821C>T NM_174057.2:c.712C>T NP_776482.1:p.(R238*) rs797790546 2002 12466292 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; rsID gleaned from or confirmed by Table 1 of  Sharma et al. (2017) Animal Genetics 48(3):369-370
531 OMIA:000526-9615 dog Weimaraner (Dog) Hypomyelination of the central nervous system FNIP2 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 15 g.55928287del c.1078del p.(I360Lfs*3) XM_005629382.3; XP_005629439.1; published as CanFam2:58974928delA, XM_532705:c.880delA and p.(I294fs*296) - coordinates in the table have been updated to a recent reference genome and / or transcript and HGVS nomenclature 2014 24272703
571 OMIA:000323-9615 dog Chinese Crested (Dog) Peruvian Hairless Dog (Dog) Xoloitzcuintli (Dog) Ectodermal dysplasia FOXI3 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ROS_Cfam_1.0 17 g.38764875_38764881dup c.57_63dup p.(A23Rfs*219) NM_001135646.1; NP_001129118.1 2008 18787161
1319 OMIA:001949-9685 domestic cat Birman (Cat) Hypotrichosis, with short life expectancy FOXN1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 E1 NC_058381.1:g.18231051_18231054del XM_019817475.3:c.1030_1033del XP_019673034.2:p.(L344Gfs) published as c.1030_1033delCTGT; predicted to cause a frameshift leading to a premature stop codon at position 547 2015 25781316 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
461 OMIA:000396-9615 dog English Springer Spaniel (Dog) Fucosidosis, alpha FUCA1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 2 g.75665866_75665879del c.379_392del p.(A127Vfs*26) NM_001003250.1; NP_001003250.1; a 14-bp deletion at the 3' end of exon 1 1996 8730282
178 OMIA:000862-9823 pig Resistance to oedema disease (F18 receptor) FUT1 substitution missense Naturally occurring variant Not currently evaluated Sscrofa11.1 6 NC_010448.4:g.54079560T>C ENSSSCT00000051297.2:c.304A>G ENSSSCP00000062180.1:p.(T102A) The variant was initially described as c.307G>A and p.A103T by Vögeli et al. 1997. VEP analysis identified the variant as c.304A>G p.T102A in transcript ENSSSCT00000051297.2 rs335979375 2000 11132149
1436 OMIA:002536-9615 dog Wirehaired Pointing Griffon (Dog) Juvenile cataract FYCO1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 20 g.42952995del c.2024delG p.(S675Tfs*5) XM_038566669.1; XP_038422597.1 2022 35205377
1299 OMIA:002318-9913 taurine cattle Montbéliarde (Cattle) coat colour, dilution (milca) FZD7 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.90572569G>C NM_001144091.1:c.1241G>C NP_001137563.1:p.(G414A) CDS position in transcript ENSBTAT00000002946.6 based on ENSEMBL Variant Effect Predictor rs5334475107 2021 33686687
1361 OMIA:000418-9615 dog German Pinscher (Dog) Glycogen storage disease Ia G6PC insertion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 9 g.20134857_20134858insN[76] c.634_635insN[76] XM_038676372.1; insertion of 60 consecutive adenines and an additional 16 bp duplication of the integration site (Christen et al., 2021) 2021 34610166
44 OMIA:000418-9615 dog Maltese (Dog) Glycogen storage disease Ia G6PC substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 9 NC_006591.3:g.20138777C>G NM_001002993.2:c.363G>C NP_001002993.2:p.(M121I) NM_001002993.2; NP_001002993.2; published as c.450G>C; coordinates in the table have been updated to a recent reference genome and / or transcript 1997 9259982 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
488 OMIA:000419-9913 taurine cattle Shorthorn (Cattle) Glycogen storage disease II GAA E18 deletion, small (<=20) Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.52484973_52484974del NM_173913.2:c.2454_2455del NP_776338.1:p.(T819R) 2000 10723725 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
294 OMIA:000419-9913 taurine cattle Blanco Orejinegro, Colombia (Cattle) Brahman (Cattle) Glycogen storage disease II GAA E13 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.52488949G>A NM_173913.2:c.1783C>T NP_776338.1:p.(R595*) UMD3.1 position is g.53105979C>T; variant initially identified in Brahman cattle and later reported in additional breeds:PMID:34779908. rs5334474904 2000 10723725 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
487 OMIA:000419-9913 taurine cattle Blanco Orejinegro, Colombia (Cattle) Brahman (Cattle) Droughtmaster (Cattle) Glycogen storage disease II GAA E7 deletion, small (<=20) Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.52492405_52492406del NM_173913.2:c.1057_1058del NP_776338.1:p.(Y353L) UMD3.1 position is g.53109436_53109437del; variant initially identified in Brahman cattle and later reported in additional breeds: PMID:28444756, PMID:34779908. 2000 10723725 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
270 OMIA:000419-9615 dog Finnish Lapphund (Dog) Swedish Lapphund (Dog) Glycogen storage disease II GAA substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 9 NC_006591.3:g.1603730C>T XM_845556.5:c.2237G>A XP_850649.1:p.(W746*) 2013 23457621 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1827 OMIA:000419-93934 Japanese quail Glycogen storage disease, type II GAA deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Coturnix japonica 2.1 c.1096delG p.(A366Hfs*23) 2025 40870023
1544 OMIA:000419-9685 domestic cat Domestic Shorthair (Cat) Glycogen Storage Disease Type II (Pompe Disease) GAA substitution missense Naturally occurring variant P F.catus_Fca126_mat1.0 E1 NC_058381.1:g.59338041G>A XM_006940652.4:c.1799G>A XP_006940714.4:p.(R600H) 2023 37106898 The OMIA curators thank Osamu Yamato for providing the variant information not included in Rakib et al. (2023); 17 April 2023. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
517 OMIA:000578-9544 Rhesus monkey Krabbe disease GALC deletion, small (<=20) Naturally occurring variant Not currently evaluated c.387delAC 1997 9192853
953 OMIA:000578-9615 dog Irish Setter (Dog) Krabbe disease GALC insertion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 8 g.59294611_59294612insN[78] c.790_791insN[78] NM_001003238.1; NP_001003238.1; the 78 bp insertion includes a 16-bp insertion site duplication and a 62 bp U4 snRNA-derived sequence; the downstream reading frame is preserved (for sequence details see McGraw et al., 2006) 2006 16490723
51 OMIA:000578-9615 dog Cairn Terrier (Dog) West Highland White Terrier (Dog) Krabbe disease GALC substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 8 NC_006590.3:g.59311801T>G NM_001003238.1:c.473A>C NP_001003238.1:p.(Y158S) NM_001003238.1; NP_001003238.1 1996 8661004 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
1607 OMIA:000578-9615 dog Mixed Breed (Dog) Krabbe disease GALC substitution missense Naturally occurring variant Not currently evaluated Dog10K_Boxer_Tasha 8 NC_006590.4:g.58893972G>A NM_001003238.1:c.149C>T NP_001003238.1:p.(A50V) NM_001003238.1; NP_001003238.1; published as NC_006590.4:g.58893972G>A 2023 37593836
1327 OMIA:002375-9913 taurine cattle Holstein Friesian (Cattle) Jersey (Cattle) Congenital disorder of glycosylation GALNT2 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.2 28 g.2281801G>A c.1561-1G>A Splice acceptor mutation based on NM_001193103.1. rs5334474933 2021 34045765
1884 OMIA:003047-9541 crab-eating macaque Polycystic kidney disease, GANAB-related GANAB substitution missense Naturally occurring variant Not currently evaluated NM_001285075.1:c.2708T>C p.(V903A) 2023 36876010
182 OMIA:001826-9913 taurine cattle Holstein (black and white) (Cattle) Abortion due to haplotype HH4 GART substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 1 NC_037328.1:g.1997582A>C NM_001040473.2:c.869A>C NP_001035563.1:p.(N290T) rs465495560 2013 23762392 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1501 OMIA:002559-9913 taurine cattle Holstein Friesian (Cattle) Persistent truncus arteriosus GATA6 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.2 24 g.34187181T>A c.1249A>T p.(K417X) ENSBTAT00000007537.6 2023 36333145
1899 OMIA:003056-9615 dog Mixed Breed (Dog) Myopathy, GATM-related GATM substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 30 NC_049251.1:g.12010480G>A NM_001287084.1:c.1240C>T NP_001274013.1:p.(R414C) 2026 41742483
231 OMIA:002621-9940 sheep South Down (Sheep) Gaucher disease, type GBA substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 1 NC_040252.1:g.111561271C>T XM_004002580.4:c.1142G>A XP_004002629.2:p.(C381Y) Oar_v3.1 position is g.103978212C>T rs429928390 2017 29023809 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
322 OMIA:000420-9796 domestic horse American Paint (Horse) Quarter Horse (Horse) Glycogen storage disease IV GBE1 substitution nonsense (stop-gain) Naturally occurring variant P EquCab3.0 26 NC_009169.3:g.8667651C>A NM_001081940.2:c.102C>A NP_001075409.1:p.(Y34*) NM_001081940.2; NP_001075409.1 rs3437568674 2004 15366377 The genomic position in EquCab3.0 was provided by Elizabeth Clark, working under the guidance of Professor Ernie Bailey in April 2022
742 OMIA:000420-9685 domestic cat Norwegian Forest Cat (Cat) Glycogen storage disease IV GBE1 delins, gross (>20) Naturally occurring variant P F.catus_Fca126_mat1.0 C2 NC_058376.1:g.34574435_34612034delinsN[334] published as "334 bp insertion at the site of a 6.2 kb deletion that extends from intron 11 to intron 12 (g. IVS11+1552_IVS12-1339 del6.2kb ins334 bp), removing exon 12"  2007 17257876 Genomic position in Felis_catus_9.0 is based on information provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
744 OMIA:001245-9031 chicken Rhode Island Red (Chicken) Retinal degeneration I GC1 complex rearrangement Naturally occurring variant Not currently evaluated 26 This allele is characterised by an 81bp insertion adjacent to a 642bp deletion 1998 9448321
1782 OMIA:002937-51751 ball python Skin colour, axanthism gch2/LOC103050242 substitution nonsense (stop-gain) Not currently evaluated 2 g.281146407C>T c.520C>T p.(R174*) The genomic location corresponds to chromosome 2 position 281146407 of the Burmese Python assembly 2025 40235167
1494 OMIA:002579-9913 taurine cattle Irish Moiled (Cattle) Perinatal mortality syndrome, GCK-related GCK substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.2 4 g.77173487A>T 2022 36105082
721 OMIA:000701-9031 chicken Naked neck GDF7 insertion, gross (>20) Naturally occurring variant Not currently evaluated 3 a large insertion approximately 260kb downstream from the BMP12 gene (now known as GFD7), increasing the expression of this gene in embryonic skin 2011 21423653
1221 OMIA:002366-9685 domestic cat Toyger (Cat) Holoprosencephaly GDF7 deletion, small (<=20) frameshift Naturally occurring variant LP/P F.catus_Fca126_mat1.0 A3 NC_058370.1:g.124327443_124327449del XM_023252074.2:c.221_227del XP_023107842.2:p.(R74Pfs*17) published as "a 7 bp deletion in the coding region of GDF7 (c.221_227delGCCGCGC [p.Arg74Profs*17]) at the position A3:127002233 (ENSFCAT00000063603)" (Yu et al., 2020) rs5334475136 2020 32575532 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
239 OMIA:002362-9940 sheep Wicklow Cheviot (Sheep) Fecundity, Thoka, FecG GDF9 FecG(T) substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 5 NC_040256.1:g.46545130T>G NM_001142888.2:c.1279A>C NP_001136360.2:p.(S427R) Oar_v3.1 position is g.41841117T>G; protein and cDNA positions are based on NP_001136360.2 and NM_001142888.2, respectively 2009 19713444 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
242 OMIA:002362-9940 sheep Belclare (Sheep) Cambridge (Sheep) Fecundity, High fertility, FecG GDF9 FecG(H) substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 5 NC_040256.1:g.46545225G>A NM_001142888.2:c.1184C>T NP_001136360.2:p.(S395F) Oar_v3.1 position is g.41841212G>A; protein and cDNA position based on NP_001136360.2 and NM_001142888.2 respectively 2004 14627550 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
243 OMIA:002362-9940 sheep Gammelnorsk spaelsau, Norway (Sheep) Fecundity, Norwegian White Sheep GDF9 FecG(F) substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 5 NC_040256.1:g.46545298C>T NC_040256.1:c.1111G>A NP_001136360.2:p.(V371M) Oar_v3.1 position is g.41841285C>T rs403536877 2013 23280002 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
240 OMIA:002362-9940 sheep Pelibuey, Mexico (Sheep) Santa Ines, Brazil (Sheep) Fecundity, Embrapa, FecG GDF9 FecG(E) substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 5 NC_040256.1:g.46545375A>C NM_001142888.2:c.1034T>G NP_001136360.2:p.(F345C) Oar_v3.1 position is g.41841362T>G; protein and cDNA position based on NP_001136360.2 and NM_001142888.2, respectively rs1092755620 2011 20528846 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1407 OMIA:002362-9940 sheep Icelandic (Sheep) Fecundity, Loa, FecG GDF9 FecG(L) deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 5 NC_040256.1:g.46545396_46545399del NP_001136360.2:p.(N337Rfs*26) Oar_v3.1 position is g.41841383_41841386del 2021 34967038
246 OMIA:002362-9940 sheep Ile-De-France (Sheep) Fecundity, Vacaria, FecG GDF9 FecG(V) substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 5 NC_040256.1:g.46545466G>A NM_001142888.2:c.943C>T NP_001136360.2:p.(R315C) Oar_v3.1 position is g.41841453G>A; protein and cDNA positions based on NP_001136360.2 and NM_001142888.2, respectively 2014 25039891 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
444 OMIA:001514-9615 dog English Pointer (Dog) English Springer Spaniel (Dog) French Spaniel (Dog) German Shorthaired Pointer (Dog) Acral mutilation syndrome GDNF substitution regulatory Naturally occurring variant Not currently evaluated CanFam3.1 4 NC_006586.3:g.70875561C>T "This variant, located 90 kb upstream of the GDNF gene, a highly relevant neurotrophic factor candidate gene, lies in [the last exon of] a long intergenic non-coding RNAs (lincRNA), GDNF-AS." 2016 28033318
114 OMIA:001208-9615 dog Labrador Retriever (Dog) Alexander disease GFAP substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 9 NC_006591.3:g.18572769G>A XM_022422887.1:c.719G>A XP_022278595.1:p.(R240H) rs850986067 2016 26486469 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
293 OMIA:001442-9913 taurine cattle Japanese Black, Japan (Cattle) Forelimb-girdle muscular anomaly GFRA1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 26 NC_037353.1:g.36627244G>A NM_001105411.1:c.430C>T NP_001098881.1:p.(Q144*) rs5334475112 2013 Reference not in PubMed; see OMIA 001442-9913 for reference details Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
655 OMIA:001089-9823 pig Blood group system ABO GGTA1 O deletion, gross (>20) Naturally occurring variant Not currently evaluated 1 "the 0 allele has a large deletion between exon 7 of the A0 blood group gene and the neighbouring SURF6". 2011 21554350
190 OMIA:001473-9915 indicine cattle (zebu) Brahman (Cattle) Dwarfism, growth-hormone deficiency GH1 substitution missense Naturally occurring variant Not currently evaluated c.641C>T p.(T200M) Bos indicus cDNA position based on AF034386, protein position based on AAB92549 2009 19524387 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1232 OMIA:001473-9615 dog Chihuahua (Dog) Dwarfism, growth-hormone deficiency GH1 deletion, small (<=20) Naturally occurring variant Not currently evaluated CanFam3.1 9 g.11832438_11832443del c.573_578del p.(K191_D193delinsN) NM_001003168.1; NP_001003168.1; variant initially identified in Chihuahuas and later reported in additional breeds: PMID: 37582787 2020 32646299 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
660 OMIA:000309-9031 chicken Connecticut (CT) strain, United States of America (Chicken) S2 line, China (Chicken) Dwarfism, sex-linked GHR deletion, gross (>20) Naturally occurring variant Not currently evaluated Z deletion of 1773 bp in the 3' end of the coding region of the growth hormone receptor gene 1994 7964293
677 OMIA:001920-27706 largemouth bass Abortion due to deletion in GHRH GHRH deletion, gross (>20) Naturally occurring variant Not currently evaluated a 66bp deletion (c.-923_-858del) in the 5' flanking region of the GHRH gene in an autosomal recessive embryonic lethal 2014 24697798
1362 OMIA:001152-9031 chicken Feather colour, melanotic GJA5 delins, gross (>20) regulatory Naturally occurring variant Not currently evaluated GRCg6a 1 g.95256761_95256801delinsAAACTACTGCTTATTAAACTACTACTACTATTTAAGAT cis-acting regulatory mutation 2021 34607956
1832 OMIA:003004-80972 clown anemonefish Skin colour pattern, Snowflake gja5b substitution missense Naturally occurring variant Not currently evaluated c.124G>A p.(E42K) 2025 40909517
1802 OMIA:002957-7994 Mexican tetra Anophthalmia/microphthalmia gja8b substitution missense Naturally occurring variant Not currently evaluated p.(S89K) 2024 39554031
1803 OMIA:002957-7994 Mexican tetra Anophthalmia/microphthalmia gja8b substitution missense Naturally occurring variant Not currently evaluated p.(T39M) 2024 39554031
794 OMIA:002119-9615 dog Leonberger (Dog) Polyneuropathy (LPN2) GJA9 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 15 g.3863524_3863525del c.1107_1108delAG p.(A370Nfs*12) 2017 28841859
1872 OMIA:003038-9615 dog Labrador Retriever (Dog) Paw pad hyperkeratosis GJB6 substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 25 NC_049246.1:g.17993749C>T XM_038573516.1:c.223C>T XP_038429444.1:p.(R75W) 2026 41601192
41 OMIA:000402-9615 dog Portuguese Water Dog (Dog) Gangliosidosis, GM1 GLB1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 23 NC_006605.3:g.3754313G>A NM_001037641.1:c.179G>A NP_001032730.1:p.(R60H) published as c.200G>A; coordinates in the table have been updated to a recent reference genome and / or transcript 2000 11032334
462 OMIA:000402-9615 dog Shiba Inu (Dog) Gangliosidosis, GM1 GLB1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 23 NC_006605.3:g.3796317delC NM_001037641.1:c.1649delC NP_001032730.1:p.(P550Rfs*50) 2002 12555949 The variant coordinates are those reported by Pervin et al. (2022) Animals 12(10), 1242.
573 OMIA:000402-9615 dog Alaskan Husky (Dog) Gangliosidosis, GM1 GLB1 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 23 NC_006605.3:g.3796356_3796374dup NM_001037641.1:c.1688_1706dup NP_001032730.1:p.(T570Pfs*22) 19 base pair duplication in exon 15. Two different aberrant mRNA transcripts are produced from the mutant allele. The protein variant designation refers to one of these transcripts that includes the mutant exon 15. In the other aberrant transcript, the mutant exon 15 is skipped and a different truncated protein is encoded. 2005 15944348
126 OMIA:000402-9685 domestic cat Korat (Cat) Siamese (Cat) Gangliosidosis, GM1 GLB1 substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 C2 NC_058376.1:g.156332550C>G NM_001009860.1:c.1448G>C NP_001009860.1:p.(R483P) rs5334475143 2008 18353697 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
230 OMIA:000402-9940 sheep Romney Marsh (Sheep) Gangliosidosis, GM1 GLB1 substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 19 NC_040270.1:g.8003247C>A XM_015102219.2:c.686G>T XP_014957705.2:p.(C299F) 2012 Reference not in PubMed; see OMIA 000402-9940 for reference details The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
302 OMIA:000689-9913 taurine cattle Polled Hereford (Cattle) Myoclonus GLRA1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 7 NC_037334.1:g.63070074G>T NM_174321.2:c.156C>A NP_776746.1:p.(Y52*) rs5334475027 2001 11178872 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1571 OMIA:000689-9615 dog Miniature Australian Shepherd Dog (Dog) Hyperekplexia GLRA1 deletion, gross (>20) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 4 g.58338954_58338989del published as a 36-bp deletion encompassing part of the intron 1 and exon 2 (chr4:g.58,338,953); coordinates in the this table are in accordance with HGVS nomenclature 2023 37222814
496 OMIA:001427-9685 domestic cat Gangliosidosis, GM2, GM2A deficiency GM2A deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A1 NC_058368.1:g.195482837_195482840del XM_003981379.6:c.516_519del XP_003981428.3:p.(V173Sfs*17) published as c.516_519delGGTC 2005 16200419 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
515 OMIA:001368-9031 chicken Retinopathy globe enlarged GNB3 deletion, small (<=20) Naturally occurring variant Not currently evaluated 1 c.D153del 2006 17065478
1804 OMIA:002958-9913 taurine cattle Aubrac (Cattle) Rhizomelic chondrodysplasia punctata GNPAT substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.2 28 NC_037355.1:g.4039268G>A r.spl 2024 40394457 Reference not in PubMed; see OMIA 002958-9913 for reference details
1035 OMIA:001248-9685 domestic cat Domestic Shorthair (Cat) Mucolipidosis II GNPTAB substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B4 NC_058374.1:g.122140618G>A XM_003989173.6:c.2644C>T XP_003989222.3:p.(Q882*) 2018 30591066 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
265 OMIA:000665-9925 goat Anglo-Nubian (Goat) Mucopolysaccharidosis IIID GNS substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS1.2 5 NC_030812.1:g.48406875C>T NM_001285690.1:c.304C>T NP_001272619.1:p.(R102*) rs5334475114 1995 7623459 The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. Published as c.322C>T. 
778 OMIA:001985-9913 taurine cattle Simmental (Cattle) Dwarfism, Fleckvieh GON4L deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 3 NC_037330.1:g.15024247del NM_001192625.1:c.4287del NP_001179554.1:p.(G1430Kfs*66) Previously listed as ARS-UCD1.2: g.15024245del and c.4286del; g. and c. updated to reflect HGVS recommendations  (3' rule) [29/08/2024] rs723240647 2016 27036302 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 210909 
1097 OMIA:002207-9615 dog Cocker Spaniel (Dog) Bernard-Soulier syndrome, type C GP9 deletion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 20 g.3025814_3028273del c.127_*2052del XM_846924.3; Gentilini et al. (2019): "The [2460bp] deletion truncates 104 (71%) of the 146 codons of the wildtype canine reading frame." 2019 31484196
383 OMIA:000821-9685 domestic cat Primary hyperoxaluria type II (Oxalosis II) GRHPR substitution splicing Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 D4 NC_058380.1:g.58931559G>A XM_006939292.4:c.507-1G>A XP_006939354.1:p.(N169Kfs*46) "point mutation, G to A, . . . at the 3# splice acceptor site of intron 4" rs5334475152 2009 Reference not in PubMed; see OMIA 000821-9685 for reference details Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1831 OMIA:003002-9913 taurine cattle Simmental (Cattle) Short stature–auditory depigmentation syndrome GRID1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 28 NC_037355.1:g.40526902G>T XM_024986926.1:c.1466C>A XP_024842694.1:p.(P489H) s719437442 2025 40913728
693 OMIA:000078-9615 dog Coton de Tulear (Dog) Ataxia, cerebellar GRM1 insertion, gross (>20) Naturally occurring variant Not currently evaluated 1 "a 62-bp truncated retrotransposon insert in exon 8" 2011 21281350
1552 OMIA:002692-9796 domestic horse American Saddle Horse (Horse) American Trotter (Horse) Miniature Horse (Horse) Missouri Fox Trotting Horse, United States of America (Horse) Morgan (Horse) Quarter Horse (Horse) Racking Horse (Horse) Rocky Mountain, United States of America (Horse) Spotted Saddle Horse (Horse) Tennessee Walking Horse (Horse) Night blindness, congenital stationary, GRM6-related GRM6 substitution missense Naturally occurring variant LP EquCab3.0 14 NC_009157.3:g.2655618C>T XM_001916934.4:c.533C>T XP_001916969.3:p.(T178M) XM_001916934.4; XP_001916969.3; variant initially reported in Tennessee Walking horse and later reported in other breeds [PMID:37815029] rs1138010744 2021 32654228
1774 OMIA:002926-9615 dog Labrador Retriever (Dog) Retinal atrophy, progressive, GTPBP2-related GTPBP2 deletion, small (<=20) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 12 NC_049233.1:g.12264348_12264350del XM_038554178.1:c.1607_1609del XP_038410105.1:p.(A536del) Published as c.1606_1608del, c. coordinates updated to NCBI transcript 2025 39971978
1536 OMIA:002646-9615 dog German Spitz (Dog) Progressive retinal atrophy GUCY2D insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 5 g.32849537_32849538insT c.1598_1599insT p.(S534Efs*20) NM_001003207.1; NP_001003207.1 2023 36872573
1195 OMIA:002268-9823 pig Danish Landrace (Pig) Vitamin C deficiency GULO od deletion, gross (>20) frameshift Naturally occurring variant Not currently evaluated 14 "This deletion includes 77 bp of exon VIII, 398 bp of intron 7 and 3.7 kbp of intron 8, which leads to a frame shift. The mutant protein is truncated to 356 amino acids, but only the first 236 amino acids are identical to the wild-type GULO protein." (Hasan et al., 2004) 2004 15112110
58 OMIA:000667-9615 dog Brazilian Terrier (Dog) Mucopolysaccharidosis VII GUSB substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 6 NC_006588.3:g.740428G>A NM_001003191.1:c.866C>T NP_001003191.1:p.(P289L) 2012 22815736 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
57 OMIA:000667-9615 dog German Shepherd Dog (Dog) Mucopolysaccharidosis VII GUSB substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 6 NC_006588.3:g.741429C>T NM_001003191.1:c.497G>A NP_001003191.1:p.(R166H) ROS_Cfam_1.0:g.546709C>T ENSCAFT00845023689.1:c.482G>A ENSCAFP00845018598.1:p.Arg161His rs1152388412 1998 9521879 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
133 OMIA:000667-9685 domestic cat Mucopolysaccharidosis VII GUSB substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 E3 NC_058383.1:g.16002670G>A NM_001009310.1:c.1051G>A NP_001009310.1:p.(E351K) published as "single G-to-A transition at nucleotide position 1074, predicting a glutamate-to-lysine substitution of amino acid residue 351 (E351K)" rs5334475137 1999 10366443 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
139 OMIA:000667-9685 domestic cat Mucopolysaccharidosis VII GUSB haplotype delins (in-frame) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 E3 NC_058383.1:g.[16005726T>G;16005729C>T] NM_001009310.1:c.[1423T>G;1426C>T] NP_001009310.1:p.(S475_R476delinsAW) published as c.1421T>G and c.1424C>T; coordinates in the table have been updated to a recent reference genome and / or transcript 2015 26118695 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1887 OMIA:000131-9796 domestic horse Blood group K GYPA Ka delins, small (<=20) missense Naturally occurring variant Not currently evaluated EquCab3.0 2 NC_009145.3:g.88418148_88418149delinsAT XM_005607829.3:c.145_146delinsAT XP_005607886.1:p.(D49I) rs1146637742, rs1137723782 2026 41837461
163 OMIA:001158-9796 domestic horse American Paint (Horse) Appaloosa (Horse) Belgian Draft (Horse) Quarter Horse (Horse) Polysaccharide storage myopathy/Exertional rhabdomyolysis GYS1 substitution missense Naturally occurring variant P EquCab3.0 10 NC_009153.3:g.19203501C>T NM_001126125.2:c.926G>A NP_001119597.2:p.(R309H) ENSECAT00000023453.3:c.926G>A ENSECAP00000019426.2:p.Arg309His rs1150416011 2008 18358695 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. Breed information updated based on PMID: 38600096
924 OMIA:001374-9615 dog Labrador Retriever (Dog) Centronuclear myopathy, HACD1-related HACD1 insertion, gross (>20) splicing Naturally occurring variant Not currently evaluated CanFam3.1 2 g.19371988_19371989ins[N[236];CACACAAAGGTTT] c.203_204ins[N[236];CACACAAAGGTTT] NM_001025269.1; published as insertion of a 236 bp antisense canine tRNA-like SINE (EMBL accession no. AJ876906), flanked on both sides by a 13 bp direct duplication of the insertion site; resulting in multiple splicing defects 2005 15829503
1421 OMIA:002522-9615 dog Norwegian Elkhound (Dog) Ataxia, HACE1-related HACE1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 12 g.62282767del c.1001del p.(G334Vfs*34) ENSCAFT00000072236.1; ENSCAFP00000049888.1 2022 35061740
419 OMIA:000703-9615 dog Doberman Pinscher (Dog) Narcolepsy HCRTR2 insertion, gross (>20) splicing Naturally occurring variant Not currently evaluated CanFam3.1 12 g.22603767_22603768insN[226] c.647-36_647-35insN[226] NM_001002933.1; a 226 bp SINE insertion in intron 3 of the HCRTR2 gene leads to skipping of exon 4 1999 10458611
64 OMIA:000703-9615 dog Dachshund (Dog) Narcolepsy HCRTR2 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 12 NC_006594.3:g.22517939G>A NM_001002933.1:c.160G>A NP_001002933.1:p.(E54K) NM_001002933.1; NP_001002933.1 2001 11282968 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
368 OMIA:000703-9615 dog Labrador Retriever (Dog) Narcolepsy HCRTR2 substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 12 NC_006594.3:g.22620881G>A NM_001002933.1:c.1105+5G>A NM_001002933.1; NP_001002933.1; experimentally confirmed splice defect; skipping of exon 6 in the HCRTR2 mRNA transcript due to a G to A transition at position +5 in the 5′-splice site of intron 6 rs1152388413 1999 10458611
1784 OMIA:000703-9615 dog Dogo Argentino (Dog) Narcolepsy HCRTR2 duplication duplication (in-frame) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 12 NC_049233.1:g.22824096_22843670dup NM_001002933.1:c.403_762dup NP_001002933.1:p.(T135_Q254dup) 2025 40095233
296 OMIA:002230-9913 taurine cattle Belted Galloway (Cattle) Brown Swiss (Cattle) Hypotrichosis HEPHL1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 29 NC_037356.1:g.721234T>A NM_001192511.2:c.1684A>T NP_001179440.1:p.(K562*) NC_037356.1 (ARS-UCD1.2 assembly, chromosome 29): g.721234A>T; NM_001192511.2 c.1684A>T; NP_001179440.1: p.Lys562* (Kuca et al., 2021); Variant initially identified in Galloway cattle and later reported in additional breeds: PMID:30014197 rs5334475051 2021 33926013
535 OMIA:001944-9615 dog Miniature Schnauzer (Dog) Spondylocostal dysostosis, autosomal recessive HES7 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 5 NC_006587.3:g.32945846del XM_014113578.2:c.126delG XP_013969053.2:p.(T43Pfs*24) 2015 25659135
145 OMIA:001987-9685 domestic cat Japanese Domestic (Cat) Bobtail HES7 JBT substitution missense Naturally occurring variant Out of scope F.catus_Fca126_mat1.0 E1 NC_058381.1:g.2905189A>G XM_003996191.5:c.5A>G XP_003996240.1:p.(V2A) rs5334475119 2016 27030474 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1178 OMIA:001461-9217 American flamingo Tay-Sachs disease HEXA substitution missense Naturally occurring variant Not currently evaluated c.1406C>T p.(P469L) 2008 18693054
1825 OMIA:001461-9913 taurine cattle Angus (Cattle) Gangliosidosis, GM2 HEXA delins, small (<=20) nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD2.0 10 NC_037337.1:g.19269480_19269481delinsGGAGT NM_001075164.2: c.834_835delinsACTCC) NP_001068632.1:p.(Y278*) 2025 41290211
26 OMIA:001461-9615 dog Japanese Chin (Dog) Gangliosidosis, GM2, type I HEXA substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 30 NC_006612.3:g.35841247C>T XM_544758.6:c.967G>A XP_544758.2:p.(E323K) 2013 23266199 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
387 OMIA:001461-9940 sheep Jacob (Sheep) Gangliosidosis, GM2, type I (B variant) HEXA substitution splicing Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 7 NC_040258.1:g.20584348C>G NM_001126343.1:c.1330G>C The variant [c.1330G>C; G444R] at the end of exon 11 effects splicing and results in skipping of exon 11. 2010 20817517 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1318 OMIA:001461-9823 pig Wild Boar (Pig) Gangliosidosis, GM2, type I HEXA substitution missense Naturally occurring variant Not currently evaluated Sscrofa11.1 7 NC_010449.5:g.60910365C>T NM_001123221.1:c.1495C>T NP_001116693.1:p.(R499C) cDNA positions based on NM_001123221.1 rs5334475169 2021 34119419
463 OMIA:001462-9615 dog Poodle, Toy (Dog) Gangliosidosis, GM2, type II (Sandhoff or variant 0) HEXB deletion, small (<=20) nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 2 NC_006584.3:g.57225684del XM_022414769.1:c.391del XP_022270477.1:p.(V131*) published as c.283delG and p.(V59fs); coordinates in the table have been updated to a recent reference genome and / or transcript 2012 22766310
798 OMIA:001462-9615 dog Shiba Inu (Dog) Gangliosidosis, GM2, type II (Sandhoff or variant 0) HEXB deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated CanFam3.1 2 NC_006584.3:g.57243656_57243658del XM_022414769.1:c.849_851del XP_022270477.1:p.(L284del) published by Kolicheski et al. (2017) as p.Leu317del and reported by Wang et al. (2018) as p.(L207del) 2017 28833537
497 OMIA:001462-9685 domestic cat Korat (Cat) Gangliosidosis, GM2, type II (Sandhoff or variant 0) HEXB deletion, small (<=20) frameshift Naturally occurring variant P F.catus_Fca126_mat1.0 A1 NC_058368.1:g.139024540del NM_001009333.2:c.40del NP_001009333.2:p.(L14Sfs*82) published as c.39delC; g. and c. coordinates updated to reflect HGVS 3' rule 1994 8178934 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
309 OMIA:001462-9685 domestic cat Japanese Domestic (Cat) Gangliosidosis, GM2, type II (Sandoff or variant 0) HEXB substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A1 NC_058368.1:g.139048794C>T NM_001009333.2:c.667C>T NP_001009333.2:p.(R223*) 2007 16872651 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
381 OMIA:001462-9685 domestic cat Burmese (Cat) Gangliosidosis, GM2, type II (Sandhoff or variant 0) HEXB deletion, small (<=20) splicing Naturally occurring variant P F.catus_Fca126_mat1.0 A1 NC_058368.1:g.139054716_139054730del NM_001009333.2:c.1244-8_1250del r.(spl?) 2009 19231264 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
741 OMIA:001462-9685 domestic cat Domestic Shorthair (Cat) Gangliosidosis, GM2, type II (Sandhoff or variant 0) HEXB inversion frameshift Naturally occurring variant P F.catus_Fca126_mat1.0 A1 NC_058368.1:g.139055474_139055498inv NM_001009333.2:c.1467_1491inv NP_001009333.2:p.(F489Lfs*4) 2004 15081585 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1584 OMIA:001243-9601 Sumatran orangutan Alkaptonuria HGD substitution missense Naturally occurring variant Not currently evaluated Susiae_PABv2/ponAbe3 3 g.17314095G>A c.1081G>A p.(G361R) 2023 37354891
1170 OMIA:001311-9615 dog Miniature Schnauzer (Dog) Progressive retinal atrophy, Miniature Schnauzer, type 1 HIVEP3 probably not causal, can be used as linked marker for genetic testing substitution Naturally occurring variant Not currently evaluated CanFam3.1 15 NC_006597.3:g.1432293G>A "intronic variant in HIVEP3/ENSCAFG00000035604" (Kaukonen et al., 2020). The genetic evidence is unable to distinguish between the HIVEP3 and PPT1 variants as potential causes of PRA. ... functional considerations favor causality of the coding PPT1 structural variant over the intronic HIVEP3 SNV" (Aguirre et al. 2020). 2020 32150541
530 OMIA:001493-9685 domestic cat Porphyria, acute intermittent HMBS deletion, small (<=20) frameshift Naturally occurring variant LP/P F.catus_Fca126_mat1.0 D1 NC_058377.1:g.16579672_16579675del NM_001177808.1:c.107_110del NP_001171279.1:p.(D36Vfs*6) published as c.107_110delACAG 2013 24239138 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
596 OMIA:001493-9685 domestic cat Siamese (Cat) Porphyria, acute intermittent HMBS insertion, small (<=20) frameshift Naturally occurring variant P F.catus_Fca126_mat1.0 D1 NC_058377.1:g.16580212dup NM_001177808.1:c.189dup NP_001171279.1:p.(L64Sfs*2) published as c.189dupT 2010 19934113 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
135 OMIA:001493-9685 domestic cat Porphyria, acute intermittent HMBS substitution missense Naturally occurring variant P F.catus_Fca126_mat1.0 D1 NC_058377.1:g.16580358G>A NM_001177808.1:c.250G>A NP_001171279.1:p.(A84T) rs5334475139 2010 19934113 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
136 OMIA:001493-9685 domestic cat Porphyria, acute intermittent HMBS substitution missense Naturally occurring variant LP/P F.catus_Fca126_mat1.0 D1 NC_058377.1:g.16581286C>T NM_001177808.1:c.445C>T NP_001171279.1:p.(R149W) rs5334475165 2010 19934113 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
402 OMIA:001493-9685 domestic cat Porphyria, acute intermittent HMBS substitution splicing Naturally occurring variant P F.catus_Fca126_mat1.0 D1 NC_058377.1:g.16583320G>A NM_001177808.1:c.826-1G>A rs5334475129 2013 24239138 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
501 OMIA:001493-9685 domestic cat Siamese (Cat) Porphyria, acute intermittent HMBS deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 D1 NC_058377.1:g.16583337_16583339del NM_001177808.1:c.842_844del NP_001171279.1:p.(G281del) published as c.842_844delGAG 2010 19934113 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
689 OMIA:000299-9986 rabbit Dwarf, long-haired Holland Lop (Rabbit) Netherland dwarf (Rabbit) Dwarfism HMGA2 dw deletion, gross (>20) Naturally occurring variant Not currently evaluated 4 "that the dwarf allele constitutes a ~12.1 kb deletion overlapping the promoter region and first three exons of the HMGA2 gene leading to inactivation of this gene." 2017 27986804
1824 OMIA:001968-9796 domestic horse German Riding Pony (Horse) New Forest Pony (Horse) Shetland Pony (Horse) Welsh Pony (Horse) small size HMGA2 substitution missense Naturally occurring variant Not currently evaluated TB-T2T 6 NC_091689.1:g.94527217G>A NM_001433493.1:c.83G>A NP_001420422.1:pG28E 2015 26474182
727 OMIA:000317-9913 taurine cattle Highland (Cattle) Ears, crop HMX1 insertion, gross (>20) Naturally occurring variant Not currently evaluated 6 76bp duplication of 106,720058 to 106,720,133 on BTA6; UMD3 reference assembly 2013 24194898
1153 OMIA:001952-9940 sheep Altay Fat-Rumped, China (Sheep) Awassi (Sheep) Kazakh Fat-Rumped (Sheep) Microtia HMX1 duplication Naturally occurring variant Not currently evaluated Oar_v4.0 6 g.114173249_114173324dup He et al. (2020) identified a 76 bp duplication in an evolutionary conserved region downstream of HMX1 (duplication of 76bp segment 6:126893417-126893492) in Altay sheep, the variant was later identified in other breeds and validated (PMID:32481741; PMID:38395239). 2020 31691317
1728 OMIA:002878-9823 pig Diabetes mellitus, HNF1A-related HNF1A insertion, gross (>20) Transgenesis via somatic cell nuclear transfer (SCNT) Not currently evaluated integration of human HNF1⍺ gene with a P291fsinC mutation 2009 19357985
624 OMIA:001952-9823 pig Microtia HOXA1 delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated Sscrofa11.1 18 NC_010460.4:g.45478110delinsTC XM_003134844.5:c.451delinsTC XP_003134892.1:p.(A151fs) Previously listed in OMIA as g.45478109delinsTC and p.(L151fs) - corrected on 29/02/2025 2015 26035869
1742 OMIA:002721-9940 sheep Tail length, long HOXB13 insertion, gross (>20) Naturally occurring variant Not currently evaluated ARS-UI_Ramb_v2.0 11 NC_056064.1:g.37524995_37524996insN[168] 2022 36068271
751 OMIA:000668-9031 chicken Huiyang Bearded, China (Chicken) Muffs and beard HOXB8 complex rearrangement Naturally occurring variant Not currently evaluated 27 "The Mb allele differs from the wild-type mb allele by three duplications, one in tandem and two that are translocated to that of the tandem repeat around 1.70 Mb on GGA27 2016 27253709
1296 OMIA:000240-9031 chicken Crested (Chicken) Polish (Chicken) Silkie (Chicken) Crest HOXC10 duplication Naturally occurring variant Not currently evaluated GRCg6a 33 g.7587588_7587784dup "a 197 bp duplication of an evolutionarily conserved sequence located in the intron of HOXC10 on chromosome 33" (Li et al., 2021) 2021 33704432
1800 OMIA:002769-8090 Japanese medaka dorsalfinless hoxc11a insertion, gross (>20) Naturally occurring variant Not currently evaluated 7 insertion of 12.8 kb transposon-like DNA in 3′ UTR of hoxc11a resulting in reduced expression of hoxc11a 
2024 38861596
1286 OMIA:000806-9925 goat Polyceraty HOXD1 delins, gross (>20) Naturally occurring variant Not currently evaluated ARS1.2 2 NC_030809.1:g.115652290_116155699delins137kb 2021 33528505
1285 OMIA:000806-9940 sheep Damara (Sheep) Hebridean (Sheep) Jacob (Sheep) Manx Loaghtan (Sheep) Navajo-Churro (Sheep) Sishui, China (Sheep) Polyceraty HOXD1 deletion, small (<=20) splicing Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 2 NC_040253.1:g.144548739_144548742del "a four-nucleotide deletion located at position +4 to +7 bp after exon 1 of the HOXD1 gene ([Oar_v4.0] g.132,832,249_132,832,252del; . . . ), i.e. encompassing three nucleotides (+4, +5, +6) of the consensus splice donor site" (Allais-Bonnet et al., 2021) 2021 33528505
691 OMIA:000081-9796 domestic horse Arab (Horse) Atlanto occipital fusion HOXD3 deletion, gross (>20) Naturally occurring variant VUS 18 "a 2.7-kb deletion located 4.4 kb downstream of the end of HOXD4 and 8.2 kb upstream of the start of HOXD3." 2017 28111759
1215 OMIA:002275-9615 dog French Bulldog (Dog) Coat colour, Cocoa HPS3 HPS3^co substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 23 NC_006605.3:g.43969695G>A XM_542830.6:c.2420G>A XP_542830.3:p.(T807*) XM_542830.6:c.2420G>A; XP_542830.3:p.(Trp807*) 2020 32526956
1731 OMIA:002275-452646 American mink Coat colour, Royal pastel HPS3 b insertion, gross (>20) Naturally occurring variant Not currently evaluated NNQGG.v01 6 NC_058096.1:g.75137871_75137872ins[OR863243];75137865_75137871 2024 38956930
789 OMIA:002116-69293 three-spined stickleback Coat colour, albinism, oculocutaneous, HPS5-related Hps5 casper insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated "casper mutants have an insertion of a single nucleotide in the 6th exon of Hsp5, predicted to generate an early frameshift" 2017 28739598
1423 OMIA:002116-9685 domestic cat Donskoy (Cat) Pink-eye HPS5 substitution splicing Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 D1 NC_058377.1:g.74250261C>T XM_023239634.2:c.2571-1G>A
 
2020 32558164 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1222 OMIA:002229-9685 domestic cat Lykoi (Cat) Hypotrichia and Roaning HR hr^TN duplication frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.35878965_35878966dupGT XM_023252512.2:c.1255_1256dup XP_023108280.2:p.(Q420Sfs*100) published as c.1255_1256dupGT 2020 32580512 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1224 OMIA:002229-9685 domestic cat Lykoi (Cat) Hypotrichia and Roaning HR hr^Fr delins, small (<=20) splicing Naturally occurring variant P F.catus_Fca126_mat1.0 B1 NC_058371.1:g.35879114delinsCAG XM_023252512.2:c.1402+2delinsCAG published as c.1404+2delTinsCAG; changed to HGVS nomenclature and recent transcript information in this table; "This variant should extend and change the reading frame, including an additional 24 amino acids in the aberrant protein before a stop codon is recognized. Alternatively, a cryptic splice site may be used from within intron 4." (Buckley et al., 2020) 2020 32580512 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1225 OMIA:002229-9685 domestic cat Lykoi (Cat) Hypotrichia and Roaning HR hr^TX substitution splicing Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.35883950G>A XM_023252512.2:c.2112G>A "This variant likely disrupts the splice donor allowing read-through for an additional 12 amino acids until a stop codon is encountered .... Alternatively, a cryptic splice site may be used from within intron 8." (Buckley et al., 2020) rs5334475128 2020 32580512 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1226 OMIA:002229-9685 domestic cat Lykoi (Cat) Hypotrichia and Roaning HR hr^NC substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.35885221C>T XM_023252512.2:c.2239C>T XP_023108280.2:p.(R747*) previously listed as c.2243C>T, p.(R748*) - updated to reflect recent transcript information [12/07/2025] rs5334475155 2020 32580512 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1227 OMIA:002229-9685 domestic cat Lykoi (Cat) Hypotrichia and Roaning HR hr^Ca substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.35885692C>T XM_023252512.2:c.2593C>T XP_023108280.2:p.(Q865*) rs5334475120 2020 32580512 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1223 OMIA:002229-9685 domestic cat Lykoi (Cat) Hypotrichia and Roaning HR hr^VA insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.35889728_35889729insGACA XM_023252512.2:c.3389_3390insGACA XP_023108280.2:p.(S1130Rfs*29) ENSFCAT00000012982.5; ENSFCAP00000012037.2; published as g.36051555insGACA and c.3389insGACA; changed to reflect HGVS nomenclature in this table 2020 32580512 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
331 OMIA:001348-9544 Rhesus monkey Atrichia with papular lesions HR substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated MMUL_1 8 g.22046679C>T c.1831C>T p.(R611*) 2002 11831740 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
319 OMIA:002229-9940 sheep Valle del Belice, Italy (Sheep) Hypotrichosis HR substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 2 NC_040253.1:g.45703202C>T XM_027964354.1:c.1312C>T XP_027820155.1:p.(Q438*) Oar_v3.1 position is g.43224867C>T rs423413166 2003 12927087 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1095 OMIA:002777-9615 dog Dachshund (Dog) Disorder of sexual development, HSD17B3-related HSD17B3 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 1 g.70554301_70554302del c.159_160del p.(T54Wfs*13) XM_003638870.2; XP_003638918.1; deletion CA 2019 31476086
456 OMIA:001758-9615 dog Australian Shepherd (Dog) Cataract, early onset HSF4 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 5 g.82198114del c.971del p.(P324Hfs*87) NM_001048121.1; NP_001041586.1; published as g.85286582delC 2006 16939467
568 OMIA:001758-9615 dog Boston Terrier (Dog) Staffordshire Bull Terrier (Dog) Cataract, early onset HSF4 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 5 g.82198114_82198115insG c.971_972insC p.(L325Tfs*28) NM_001048121.1; NP_001041586.1; published as g.85286582_85286583insC 2006 16939467
919 OMIA:001319-9913 taurine cattle Holstein Friesian (Cattle) Myopathy of the diaphragmatic muscles HSPA1A deletion, gross (>20) Naturally occurring variant Not currently evaluated 23 Deletion of one of two HSP70 (heat-shock protein) genes in the bovine major histocompatibility complex 2003 12755819
204 OMIA:001817-9913 taurine cattle Japanese Black, Japan (Cattle) Perinatal weak calf syndrome IARS substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 8 NC_037335.1:g.83909754C>G NM_001101069.2:c.235G>C NP_001094539.1:p.(V79L) rs5334475110 2013 23700453 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1604 OMIA:000706-9615 dog Nederlandse Kooikerhondje (Dog) Necrotising myelopathy IBA57 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 14 g.801179G>A c.439C>T p.(R147W) XM_038686047.1; XP_038541975.1 2023 37588046
1786 OMIA:000664-9542 Japanese macaque Mucopolysaccharidosis I IDUA substitution missense Naturally occurring variant Not currently evaluated c.786 C>A p.(H262Q) 2025 40251406
1237 OMIA:000664-9615 dog Golden Retriever (Dog) Mucopolysaccharidosis I IDUA deletion, gross (>20) deletion (in-frame) Naturally occurring variant Not currently evaluated CanFam3.1 3 g.91523238_91523524del c.1400-76_1521+89del p.(G467_E507del) NM_001313883.1; NP_001300812.1 2020 32785987
1190 OMIA:000664-9615 dog Boston Terrier (Dog) Mucopolysaccharidosis I IDUA insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 3 g.91534556_91534557insGGGGGCCG c.19_20insCGGCCCCC p.(R7Pfs) NM_001313883.1; NP_001300812.1 2020 32300136
911 OMIA:000664-9615 dog Plott Hound (Dog) Mucopolysaccharidosis I IDUA substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 3 NC_006585.3:g.91534420C>T NM_001313883.1:c.155+1G>A NM_001313883.1 rs1152388407 1992 1339393
500 OMIA:000664-9685 domestic cat Domestic Shorthair (Cat) Mucopolysaccharidosis I IDUA deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.204935473_204935475del NM_001305032.1:c.1041_1043del NP_001291961.1:p.(D348del) a 3 bp deletion in the IDUA gene; previously listed as c.1042_1044del updated to recent transcript [09/07/2025] 1999 10356309 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1301 OMIA:002320-9615 dog Lapponian Herder (Dog) Progressive retinal atrophy IFT122 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 20 NC_006602.3:g.5648046C>T XM_533734.6:c.3176G>A XP_533734.2:p.(R1059H) Protein and CDS positions based on XP_533734.2 and XM_533734.6 2021 33606121
1396 OMIA:001823-9913 taurine cattle Holstein Friesian (Cattle) Haplotype with homozygous deficiency-HH2 IFT80 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 1 NC_037328.1:g.107172616del NM_001098959.1:c.1155del NP_001092429.1:p.(L385Ffs*3) published as g.107172616delT, ENSBTAT00000044761.4:c.1140del ENSBTAP00000042227.4:p.Leu381PhefsTer3, c. and p. coordinates updated to NCBI transcripts [29/08/2024] rs523422030 2021 34873723
687 OMIA:000006-9031 chicken Chinese Xingyi bantam, China (Chicken) Achondroplasia, creeper IHH deletion, gross (>20) Naturally occurring variant Not currently evaluated Gallus_gallus-4.0 7 g.21798705_21810600del "a 11,896bp large deletion region (chr7: 21,798,705-21,810,600) covering the entire Indian hedgehog (IHH) gene" 2016 27439785
337 OMIA:001899-9796 domestic horse Quarter Horse (Horse) Warmblood (Horse) Incontinentia pigmenti IKBKG substitution nonsense (stop-gain) Naturally occurring variant P EquCab3.0 X NC_009175.3:g.126898409C>T NM_001284533.1:c.184C>T NP_001271462.1:p.(R62*) Previously listed as as c.202C>T and p.(R68*), updated in this table to reflect  NM_001284533.1 transcript rs3433281055 2013 24324710 Breed information updated based on PMID: 38600096
1202 OMIA:002271-9913 taurine cattle Holstein Friesian (Cattle) Immunodeficiency, IL17Ra-related IL17RA deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.108813252del XM_015460734.2:c.180del XP_015316220.2:p.(C61Afs*62) published as g.108813251delC, g. coordinates in this table updated to reflect HGVS nomenclature (3' rule) [03/09/2024] rs5334474974 2020 32448141
584 OMIA:000899-9615 dog Cardigan Welsh Corgi (Dog) Severe combined immunodeficiency disease, X-linked IL2RG insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 X g.55483461_55483462insG c.583_584insC p.(R195Pfs*5) NM_001003201.1; NP_001003201.1; "a single nucleotide insertion causing a frameshift". The variant could also be described as a duplication of a cytosine (c.583dup). 1995 8571541
476 OMIA:000899-9615 dog Basset Hound (Dog) Severe combined immunodeficiency disease, X-linked IL2RG deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 X g.55484657_55484660del c.30_33del p.(L11Yfs) NM_001003201.1; NP_001003201.1; c.30_33delCCTC 1994 7829104
1622 OMIA:002763-9541 crab-eating macaque Severe combined immunodeficiency disease IL2RG substitution nonsense (stop-gain) Base-editing Not currently evaluated Macaca_fascicularis_5.0 X g.68110639G>A c.391C>T p.(Q131*) XM_005593892.2; XP_005593949.1 2023 37661226
1253 OMIA:002289-9615 dog Lhasa Apso (Dog) Progressive retinal atrophy 4 (PRA4) IMPG2 insertion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 33 " LINE-1 insertion was identified within the critical region in this PRA-affected LA, situated within 200 bp upstream of the interphotoreceptor matrix proteoglycan 2 (IMPG2) gene within the following coordinates: CANFA33: 7,785,475-7,785,491" (Hitti-Malin et al., 2020) 2020 32894063
1034 OMIA:002173-9615 dog Norwich Terrier (Dog) Diffuse cystic renal dysplasia and hepatic fibrosis INPP5E substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 9 NC_006591.3:g.49069064G>A XM_005625109.3:c.1572+5G>A Dillard et al. (2018): "the identified variant introduces a novel splice site in INPP5E causing a frameshift and formation of a premature stop codon." 2018 30235266
962 OMIA:001675-61379 black-footed cat Cone-rod dystrophy 2 IQCB1 deletion, small (<=20) nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.1282delCT p.(L428*) 2017 28322220
606 OMIA:001675-9615 dog American Pit Bull Terrier (Dog) Cone-rod dystrophy 2 IQCB1 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 33 g.25078909_25078910insC c.952_53insC p.(S319Ifs*12) 2013 24045995
805 OMIA:001528-9940 sheep INRA 401, France (Sheep) Fleece variation, woolly IRF2BP2 insertion, gross (>20) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 25 insertion of an antisense EIF2S2 retrogene (called asEIF2S2) into the 3' UTR of the IRF2BP2 gene 2017 28379502
1711 OMIA:000284-10036 golden hamster Diabetes mellitus, type 2 Irs2 deletion, gross (>20) Genome-editing (CRISPR-Cas9) Not currently evaluated 2653-bp deletion in exon 1 2024 39134590
336 OMIA:001886-9615 dog Chinook (Dog) Karelian Bear Dog (Dog) Norwegian Elkhound (Dog) Chondrodysplasia, disproportionate short-limbed ITGA10 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 17 NC_006599.3:g.58703935G>A XM_845262.4:c.2083C>T XP_850355.1:p.(R695*) XM_845262.4; XP_850355.1, additional breed inforamtion based on PMID:27525650 2013 24086591 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
1569 OMIA:001000-9615 dog Golden Retriever (Dog) Thrombastenia ITGA2B deletion, small (<=20) Naturally occurring variant Not currently evaluated 9 Published in a conference proceeding as (1924delC) 2017 Reference not in PubMed; see OMIA 001000-9615 for reference details
369 OMIA:001000-9615 dog Great Pyrenees (Dog) Thrombasthenia ITGA2B duplication splicing Naturally occurring variant Not currently evaluated CanFam3.1 9 g.19057144_19057157dup c.1360_1373dup NM_001003163.2; NP_001003163.1; experimentally confirmed splice defect; a 14-base duplication in exon 13 and defective splicing of intron 13 2000 11105947
80 OMIA:001000-9615 dog Otterhound (Dog) Thrombasthenia ITGA2B substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 9 NC_006591.3:g.19054488G>C NM_001003163.2:c.1192G>C NP_001003163.1:p.(D398H) NM_001003163.2; NP_001003163.1; published as c.1193G>C / c.1100G>C; substitution of histidine for aspartic acid at position 398 (367). Coordinates in the table have been updated to a recent reference genome and or transcripts. 2001 11703027 Breed was incorrectly listed as Scottish Deerhound. Changed to Otterhound [19/5/2023]
1568 OMIA:001000-9615 dog Mixed Breed (Dog) Thrombasthenia ITGA2B substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 9 NC_006591.3:g.19057141C>T 1357C>T NP_001003163.1:p.(R453*) NM_001003163.2; NP_001003163.1; published as (C1264T) and (R422X), coordinates in this table have been updated to a recent reference genome 2016 26764135
164 OMIA:001000-9796 domestic horse Quarter Horse (Horse) Thoroughbred (Horse) Thrombasthenia ITGA2B substitution missense Naturally occurring variant P EquCab3.0 11 NC_009154.3:g.19245752G>C NM_001081793.1:c.215G>C NP_001075262.1:p.(R72P) NM_001081793.1; NP_001075262.1; originally published as p.(R41P) and listed by Leite et al. (2019) as c.122G>C; coordinates in this table have been updated to a recent reference genome and / or transcript 2006 16407493
512 OMIA:001000-9796 domestic horse Peruvian Paso (Horse) Quarter Horse (Horse) Thrombasthenia ITGA2B deletion, small (<=20) Naturally occurring variant P EquCab3.0 11 NC_009154.3:g.19247983_19247992del g.19247983_19247992delCAGGTGAGGA 2007 17338169 g. coordinates obtained from Dahlgren et al. (2020)
1245 OMIA:001000-9685 domestic cat Domestic Shorthair (Cat) Glanzmann's thrombasthenia ITGA2B deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 E1 NC_058381.1:g.42487303del XM_003996987.6:c.1839del XP_003997036.4:p.(P613fs) published as c.1986delC; p.Pro662fs (Li et al., 2020), previously listed here as Felis_catus 9.0 g.44416063del; coordinates updated to reflect HGVS 3' rule and recent reference genome and transcript [07/07/2025] rs5334475153 2020 32935881 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1809 OMIA:001000-9685 domestic cat Domestic Shorthair (Cat) Thrombasthenia ITGA2B insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Felis_catus 9.0 E1 NC_018736.3:g:44416063_44416064insGG XM_003996987.5:c.1839_1840insCC XP_003997036.3:p.(E614fs) Published as ENSFCAT00000003056.6:c.1986_1987insCC 2024 38426552
1185 OMIA:002261-9913 taurine cattle Holstein (black and white) (Cattle) de novo mutation in an AI sire ITGA3 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 19 g.36586185G>A p.(T252M) Bourneuf et al. (2017) detected ITGA3 g.37219021G>A; p.T252M as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Holstein AI bull. No information was provided on the descendants of this bull. rs5334475090 2017 28904385
1577 OMIA:002718-9913 taurine cattle Charolais (Cattle) Epidermolysis bullosa, junctional, ITGA6-related ITGA6 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.24112740C>A NM_001109981.1:c.2160+1G>T NP_001103451.1:p.(I657Mfs) NM_001109981.1 2023 37308849
197 OMIA:000595-9913 taurine cattle Blanco Orejinegro, Colombia (Cattle) Holstein Friesian (Cattle) Jersey (Cattle) Simmental (Cattle) Leukocyte adhesion deficiency, type I ITGB2 BLAD substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 1 NC_037328.1:g.144770078T>C NM_175781.1:c.383A>G NP_786975.1:p.(D128G) Variant initially identified in Holstein Friesian cattle and later reported in additional breeds. rs445709131 1992 1384046 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries.
53 OMIA:000595-9615 dog Irish Red and White Setter (Dog) Irish Setter (Dog) Leukocyte adhesion deficiency, type I ITGB2 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 31 NC_006613.3:g.38537012C>G XM_014109833.2:c.107G>C XP_013965308.1:p.(C36S) ROS_Cfam_1.0: g.38142116C>G ENSCAFT00845038113.1:c.107G>C ENSCAFP00845029856.1:p.Cys36Ser rs1152388503 1999 10512685 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
775 OMIA:000595-9685 domestic cat Leukocyte adhesion deficiency, type I ITGB2 ITGB-2 missing exon 2 deletion, gross (>20) splicing Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 C2 NC_058376.1:g.1764454_1764477del XM_045036502.1:c.46_58+11del Bauer et al. (2017) "24 bp deletion at the exon 2 to intron 2 boundary (c.46_58 + 11del), predicting premature translational termination due to abnormal splicing of exon 1 to exon 3 or 4 2017 28750142 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
684 OMIA:001948-9913 taurine cattle Charolais (Cattle) Epidermolysis bullosa, junctionalis, ITGB4 ITGB4 deletion, gross (>20) Naturally occurring variant Not currently evaluated 19 "a 4.4 kb deletion involving exons 17 to 22" of the ITGB4 gene 2015 25890340
1272 OMIA:001948-9940 sheep Mouton vendéen, France (Sheep) Epidermolysis bullosa, junctionalis, ITGB4 ITGB4 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 11 NC_040262.1:g.7412626C>T XM_027974087.1:c.2791C>T XP_027829888.1:p.(R931*) Published as OAR11_v4.0, g.54799925G>A  / p.Arg885* 2020 33225458
543 OMIA:001948-9940 sheep Spanish Churro (Sheep) Epidermolysis bullosa, junctionalis, ITGB4 ITGB4 deletion, small (<=20) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 11 NC_040262.1:g.7425460_7425463del XM_027974087.1:c.4412_4415del Oar_v3.1: g.54849767_54849770del 2015 25955497 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1716 OMIA:002872-9913 taurine cattle Holstein Friesian (Cattle) Bovine lymphocyte intestinal retention defect ITGB7 BLIRD substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.26807079G>A NP_001098835.1:904G>A NP_001098835.1:p.(G302S) Published as ENSBTAT00000025279.5:p.(G375S) rs444441523 2023 Reference not in PubMed; see OMIA 002872-9913 for reference details
754 OMIA:002097-9615 dog Italian Spinone (Dog) Ataxia, spinocerebellar ITPR1 repeat variation Naturally occurring variant Not currently evaluated 20 Forman et al. (2015) identified an expanded GAA-repeat in intron 35 of the ITPR1 gene in affected dogs. The wildtype sequence contains 8 GAA repeats. The expanded disease-associated alleles carry an estimated 318-651 GAA repeats. 2015 25354648
1769 OMIA:002916-9615 dog Lancashire Heeler (Dog) Charcot-Marie-Tooth disease 1J with amelogenesis imperfecta ITPR3 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 12 NC_049233.1:g.12:3214076C>T XM_038553756.1:c.5002C>T XP_038409684:p.(Q1668X) 2025 39804930
739 OMIA:000809-9615 dog Mixed Breed (Dog) Polycythemia JAK2 delins, small (<=20) delins (in-frame) Naturally occurring variant Not currently evaluated CanFam3.1 1 g.93416506_93416510delinsTTCCT c.1849_1853delinsTTCCT p.(V617_C618delinsFL) XM_022421838.1; XP_022277546.1; published as a three-base change in codons 617 and 618 of JAK2 giving rise to V617F and C618L, SOMATIC MUTATION/MOSAICISM 2011 21320566
1794 OMIA:002943-9615 dog Shih Tzu (Dog) Retinal atrophy, progressive, JPH2-related JPH2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 24 c.452A>C p.L151X 2021 34231238
1390 OMIA:002483-9913 taurine cattle Neuromuscular channelopathy KCNG1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 13 NC_037340.1:g.78918850C>A NM_001205719.1:c.1248G>T NP_001192648.1:p.(W416C) NM_001205719.1; NP_001192648.1 rs3423356335 2021 34828398
1154 OMIA:002240-9615 dog Norwegian Buhund (Dog) Ataxia, cerebellar, KCNIP4-related KCNIP4 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 3 NC_006585.3:g.88890674T>C XM_005618660.3:c.436T>C XP_005618717.1:p.(T146R) XM_005618660.3; XP_005618717.1 2020 31999692
612 OMIA:002089-9615 dog Huntaway (Dog) Jack Russell Terrier (Dog) New Zealand Heading Dog (Dog) Ataxia, cerebellar, KCNJ10-related KCNJ10 insertion, small (<=20) regulatory Naturally occurring variant Not currently evaluated CanFam3.1 38 g.22141027insC c.*214_*215insC XM_005640901.1; Gast et al. (2016) "Bioinformatic analysis using RegRNA indicated the KCNJ10:g.22141027insC affecting regulation of gene expression via a regulatory RNA motif or miRNA target site." Additional breeds based on PMID:40965331 rs1152388457 2016 27724896
945 OMIA:002089-9615 dog Dachshund (Dog) Jack Russell Terrier (Dog) Parson Russell Terrier (Dog) Russell Terrier (Dog) Smooth Fox Terrier (Dog) Tenterfield Terrier (Dog) Ataxia, cerebellar, KCNJ10-related KCNJ10 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 38 NC_006620.3:g.22140300C>G XM_545752.6:c.627C>G XP_545752.3:p.(I209M) rs1152388456 2014 37905444 25998802 24708069 Genomic coordinates in CanFam3.1 and EVA ID provided by Zoe Shmidt and Robert Kuhn.
947 OMIA:002089-9615 dog Belgian Shepherd Dog (Dog) Belgian Shepherd Dog, Malinois (Dog) Bouvier des Ardennes (Dog) Spongy degeneration with cerebellar ataxia 1 (SDCA1) KCNJ10 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 38 NC_006620.3:g.22140659T>C XM_545752.6:c.986T>C XP_545752.3:p.(L329P) 2017 36426918 27966545 28007838 Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn.
1596 OMIA:002332-9615 dog English Springer Spaniel (Dog) Long QT syndrome KCNQ1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 18 NC_006600.3:g.46604412C>A XM_022405121.1:c.770C>A XP_022260829.1:p.(T257K) XM_022405121.1; XP_022260829.1; published as "Genbank KF439050, KCNQ1_T377K" - coordinates in this table are updated to a recent reference genome. 2015 25779927
196 OMIA:001722-9913 taurine cattle Marchigiana (Cattle) Romagnola (Cattle) Lethal multi-organ developmental dysplasia KDM2B substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 17 NC_037344.1:g.53761149G>A XM_005217983.4:c.2503G>A XP_005218040.1:p.(D835N) rs5334475109 2012 23029151 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
207 OMIA:002390-9913 taurine cattle Brown Swiss (Cattle) Original Swiss Brown (Cattle) Spinal muscular atrophy KDSR substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 24 NC_037351.1:g.61620374C>T NM_001045919.1:c.523G>A NP_001039384.1:p.(A175T) previously listed incorrectly in this table as g.61620302C>T, c.562G>A, p.(A188T) - corrected and updated to coordinates in ARS-UCD1.3 [1/08/2026] 2007 17420465
604 OMIA:000979-9031 chicken Talpid-3 KIAA0586 insertion, small (<=20) Naturally occurring variant Not currently evaluated 5 insT 2006 16702409
1005 OMIA:000527-9913 taurine cattle Angus (Cattle) Charolais (Cattle) Uckermärker, Germany (Cattle) Progressive ataxia KIF1C substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.26407668C>T NM_001205802.2:c.608G>A NP_001192731.2:p.(R203Q); p.(R203_T204delinsQ*) ENSBTAT00000081136.1:c.608G>A ENSBTAP00000062635.1:p.Arg203Gln Duchesne et al. (2018): "This substitution has two effects: firstly, it modifies a conserved amino acid (p.R203Q). Secondly, it causes an alternative splicing event, resulting in exon 5 skipping in most of the transcripts (p.RT203-204QStop) associated with a drastic reduction of overall mRNA expression and leading to the absence of detectable KIF1C protein in brain extracts from affected cattle." The variant was initially reported in Charolais cattle and later reported in additional breeds (see PMIDs 38338009 and 32281115). rs800926237 2018 30067756
1231 OMIA:002283-9823 pig Large White (Pig) Arthrogryposis multiplex congenita, KIF21A-related KIF21A insertion, gross (>20) nonsense (stop-gain) Naturally occurring variant Not currently evaluated Sscrofa11.1 5 NC_010447.5:g.70964237_70964238insAAGATAGAGGTTCTTTCCTCTAGACTTGAGGTTCTCCTGGTGTGACAGATGGTTCTTTCCTCT XM_013997927.2:c.124_125insAGAGGAAAGAACCATCTGTCACACCAGGAGAACCTCAAGTCTAGAGGAAAGAACCTCTATCTT XP_013853381.2:p.(F42*) published as NC_010447.5:g70964237_ g70964238insAAGATAGAGGTTCTTTCCTCTAGACTTGAGGTTCTCCTGGTGTGACAGATGGTTCTTTCCTCT; p.Val41_Phe42insTer) (Fang et al., 2020) rs5334475173 2020 32686171
1191 OMIA:002267-9685 domestic cat Bengal (Cat) Highlander (Cat) Highlander Shorthair (Cat) Savannah (Cat) Progressive retinal atrophy KIF3B substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A3 NC_058370.1:g.26520830C>T XM_006929856.5:c.1000G>A XP_006929918.1:p.(A334T) rs5334475117 2020 32386558 The genomic location on Felis_catus_9.0 is based on Rodney et al. 2021 (PMID: 33785770). Additional breeds reported based on PMID:35709088. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1440 OMIA:001836-9913 taurine cattle Holstein-Friesian, Switzerland (Cattle) Abortion due to haplotype HH13 KIR2DS1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 18 NC_037345.1:g.62758881G>A NM_001097567.1:c.475C>T NP_001091036.1:p.(Q159*) NM_001097567.1; NP_001091036.1 rs437566778 2022 35361830
749 OMIA:001576-9913 taurine cattle Belgian Blue (Cattle) Bohuskulla, Sweden (Cattle) Brown Swiss (Cattle) Fjällnära boskap, Sweden (Cattle) Galloway (Cattle) Pohjoissuomenkarja, Finland (Cattle) Svensk Fjällras (Cattle) Svensk kullig boskap (skb), Sweden (Cattle) Väneko, Sweden (Cattle) White Park, United Kingdom of Great Britain and Northern Ireland (Cattle) Coat colour, colour-sided KIT Cs(29) complex rearrangement Naturally occurring variant Not currently evaluated 29 Durkin et al. (2012): "colour sidedness is determined by a first allele on chromosome 29 (Cs(29)), which results from the translocation of a 492-kilobase chromosome 6 segment encompassing KIT to chromosome 29, and a second allele on chromosome 6 (Cs(6)), derived from the first by repatriation of fused 575-kilobase chromosome 6 and 29 sequences to the KIT locus. We provide evidence that both translocation events involved circular intermediates. This is the first example, to our knowledge, of a phenotype determined by homologous yet non-syntenic alleles that result from a novel copy-number-variant-generating mechanism." 2012 22297974 Additional breeds based on PMID:40624682
1133 OMIA:001576-9913 taurine cattle Belgian Blue (Cattle) Bohuskulla, Sweden (Cattle) Brown Swiss (Cattle) Fjällnära boskap, Sweden (Cattle) Svensk Fjällras (Cattle) Svensk kullig boskap (skb), Sweden (Cattle) Coat colour, colour-sided KIT Cs(6) complex rearrangement Naturally occurring variant Not currently evaluated 6 Durkin et al. (2012): "colour sidedness is determined by a first allele on chromosome 29 (Cs(29)), which results from the translocation of a 492-kilobase chromosome 6 segment encompassing KIT to chromosome 29, and a second allele on chromosome 6 (Cs(6)), derived from the first by repatriation of fused 575-kilobase chromosome 6 and 29 sequences to the KIT locus. We provide evidence that both translocation events involved circular intermediates. This is the first example, to our knowledge, of a phenotype determined by homologous yet non-syntenic alleles that result from a novel copy-number-variant-generating mechanism." 2012 22297974 Additional breeds based on PMID:40624682
1116 OMIA:001576-9913 taurine cattle Berrenda en Negro, Spain (Cattle) Cikasto govedo, Slovenia (Cattle) Evolèner, Switzerland (Cattle) Gloucester, United Kingdom of Great Britain and Northern Ireland (Cattle) Herens (Cattle) Pinzgau (Cattle) Tux-Zillertaler, Austria (Cattle) Pinzgauer spotting KIT KIT^PINZ complex rearrangement Naturally occurring variant Not currently evaluated 6 Briefly: the KIT^PINZ variant is "characterized by the fusion of a duplicated chromosome 4 segment into a deleted part of chromosome 6." (Küttel et al., 2019) In more detail: "a complex structural variant characterized by a ~9.4-kb deletion . . . and in silico evidence for a duplication of ~1.5 kb about 34 kb farther downstream . . . . Apparently, the duplicated copy of the ~1.5-kb segment appears inversely inserted at the upstream breakpoint of the ~9.4-kb deletion . . . . Furthermore, we noticed at the upstream breakpoint of the inversely inserted segment chimeric read pairs in which both ends mapped to chromosome 6 and 4 . . . . The inspection of the sequence coverage of the involved genome region on chromosome 4 indicated a ~310-kb duplication from 84 864 544 to ~85 174 000 bp". (Küttel et al., 2019) 2019 31294880
715 OMIA:001743-9823 pig Coat colour, patch KIT duplication Naturally occurring variant Not currently evaluated 8 the patch allele comprises a 450kb duplication that includes KIT (roughly in the middle) 1998 9724328
743 OMIA:001745-9823 pig Essex, United Kingdom of Great Britain and Northern Ireland (Pig) Hampshire Down (Sheep) Schwäbisch Hällisches Schwein, Germany (Pig) Wessex Saddleback (Pig) White belt KIT complex rearrangement Naturally occurring variant Not currently evaluated 8 Hampshire pigs (belted phenotype) have "a 4.3-kb duplication (DUP2) located ~¼100 kb upstream of KIT and a 23-kb duplication (DUP3) ~100 kb downstream of KIT, which in turn contained a fourth ~4.3-kb duplication (DUP4) not present on wild-type chromosomes". Across four breeds, belted pigs always had DUP2 and DUP4, but some lacked DUP3. 2012 23151514
1818 OMIA:000209-30521 domestic yak Coat colour, white KIT deletion, small (<=20) regulatory Naturally occurring variant Not currently evaluated 6 14bp deletion in KIT promoter 2025 40629379
748 OMIA:000426-9913 taurine cattle Bohuskulla, Sweden (Cattle) Chillingham (Cattle) Fjällnära boskap, Sweden (Cattle) Pohjoissuomenkarja, Finland (Cattle) Svensk Fjällras (Cattle) Svensk kullig boskap (skb), Sweden (Cattle) Väneko, Sweden (Cattle) Gonadal hypoplasia KIT cs(29) complex rearrangement Naturally occurring variant Not currently evaluated 29 "gonadal hypoplasia in Northern Finncattle and Swedish Mountain cattle is associated with a complex chromosomal rearrangement including a ~500kb duplicated segment from BTA6 which is translocated to BTA29. This duplicated segment includes the entire coding sequence of the KIT gene" 2013 24086604 Additional breed information based on Hall et al. (2021) and PMID:40624682
1525 OMIA:001652-9627 red fox Platinum coat colour KIT substitution splicing Naturally occurring variant Not currently evaluated G>A variant in the first nucleotide of KIT intron 17 causes skipping of exon 17 2015 25662789
979 OMIA:000209-9823 pig Dominant white KIT I complex rearrangement Naturally occurring variant Not currently evaluated 8 This dominant white allele carries at least three causal polymorphisms, namely a 450 kb duplication (originally reported by Johansson Moller (1996); also present in Patch - see OMIA 001743-9825), the splice mutation reported by Marklund et al. (1998) (unique to Dominant white) and smaller duplication(s) (that occur within the 450kb duplication) causing Belt (see OMIA 001745-9825).(with thanks to Leif Andersson). To emphasise the original discovery of the duplication, the ref cited here is Johansson Moller (1996) 1996 8875890
566 OMIA:001737-9838 Arabian camel Coat colour, white spotting, KIT-related KIT deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated c.1842delG p.(M614Ifs*5) 2017 28282952
403 OMIA:000209-494514 Arctic fox Coat colour, dominant white KIT substitution splicing Naturally occurring variant Not currently evaluated c.1867+1G>T 2013 24308634
1762 OMIA:001737-9913 taurine cattle Coat colour, colour-headed KIT deletion, gross (>20) Naturally occurring variant Not currently evaluated ARS-UCD1.2 6 The ARS-UCD1.2 reference genome was generated from a white-headed Hereford. Colour-headed cattle have a deletion of 20.6 kb upstream of KIT relative to the ARS-UCD1.2 reference genome. 2024 39694857
1763 OMIA:001737-9913 taurine cattle Hereford (Cattle) Coat colour, white-headed KIT complex rearrangement Naturally occurring variant Not currently evaluated ARS-UCD1.2 6 The ARS-UCD1.2 reference genome was generated from a white-headed Hereford and contains two copies of a segmental duplication upstream of KIT associated with depigmentation in white-headed cattle. The segments miss 1.8 kb and 800 bp of sequence, respectively, relative to the full 14.3 kb sequence observed in Simmental cattle.  2024 39694857
1764 OMIA:001737-9913 taurine cattle Simmental (Cattle) Coat colour, white-headed KIT complex rearrangement Naturally occurring variant Not currently evaluated ARS-UCD1.2 6 The ARS-UCD1.2 reference genome was generated from a white-headed Hereford and contains two copies of a segmental duplication upstream of KIT associated with depigmentation in white-
headed cattle. White-headed Simmental cattle contain three copies of the 14.3 kb segmental duplication. 
2024 39694857
1849 OMIA:001737-9913 taurine cattle Gelbvieh (Cattle) Hereford (Cattle) Holstein Friesian (Cattle) Jersey (Cattle) Maine-Anjou (Cattle) Montbéliarde (Cattle) Normande (Cattle) Red Angus (Cattle) Coat colour, white spotting KIT deletion, gross (>20) regulatory Naturally occurring variant Not currently evaluated ARS-UCD1.2 6 The ARS-UCD1.2 reference genome was generated from a white-headed Hereford and contains two copies of the deletion allele. Animals with ancestrial / solid colour phenotype have an insertion of either 6948-bp (long) or ~6000-bp (intermediate) ~114-kbp upstream of KIT exon 1 (NM_001166484.1) compared the the reference genome. 2025 41237223
1165 OMIA:001737-9913 taurine cattle Brown Swiss (Cattle) Coat colour, white spotting KIT deletion, gross (>20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 6 g.70239551_70239590del c.1390_1429del p.(N464Afs*50) "NC_037333.1:g.70239551_70239590del; NM_001166484.1:c.1390_1429del; NP_001159956.1:p.(Asn464AlafsTer50)" (Häfliger et al., 2020) rs5411005071 2020 32065668
1201 OMIA:001737-9925 goat Bezoar (Goat) Wild type or Bezoar KIT reference sequence allele Naturally occurring variant Not currently evaluated ARS1.2 6 "The coverage plot of bezoars (BEZ) does not show any copy number variation and represents the wildtype allele." (Henkel et al., 2019) 2019 31841508
1187 OMIA:001737-9925 goat Barbari (Goat) White-spotted KIT KIT^BAR repeat variation Naturally occurring variant Not currently evaluated ARS1.2 6 The CNV "started ~63 kb downstream of KIT and covered ~100 kb of the genome reference sequence without known coding DNA. The short read-aligments of read-pairs spanning the amplification breakpoints confirmed that the individual copies of the CNV were arranged in tandem in a head to tail orientation" (Henkel et al., 2019) "70'911'301-70'927'581: deleted; 89'210'545-89'233'246: 3 copies of which 2 are inserted at 70'911'302" (Table S5; Henkel et al., 2019); previously listed in htis table as :g.70859258_70959918 (2 copies) 2019 31841508
1188 OMIA:000209-9925 goat Pak Angora, Pakistan (Goat) White KIT KIT^ANG repeat variation Naturally occurring variant Not currently evaluated ARS1.2 6 This CNV "started ~63 kb downstream of KIT and covered ~100 kb of the genome reference sequence without known coding DNA. The short read-aligments of read-pairs spanning the amplification breakpoints confirmed that the individual copies of the CNV were arranged in tandem in a head to tail orientation" (Henkel et al.,2019); previously listed in this table as g.70859258_70959918 (3 copies) 2019 31841508
150 OMIA:000209-9793 ass (donkey) Coat colour, dominant white KIT W substitution missense Naturally occurring variant Not currently evaluated ASM1607732v2 3 NC_052179.1:g.139882496A>C XM_014853517.2:c.662A>C XP_014709003.2:p.(Y221S)

2015 25818843
405 OMIA:001737-9793 ass (donkey) Coat colour, white spotting, due to KIT KIT Ws substitution splicing Naturally occurring variant Not currently evaluated ASM1607732v2 3 NC_052179.1:g.139911533T>A XM_014853517.2:c.1978+2T>A 2015 25818843
570 OMIA:001737-9615 dog Coat colour, white spotting, KIT-related KIT insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 13 g.47144513_47144514insA c.140_141insA p.(L48Vfs*10) NM_001003181.1; NP_001003181.1; "a 1-bp insertion of an adenine 70 bases downstream of the beginning of exon 2." The variant represents a duplication of an adenine and could also be described as c.140dup. 2013 23134432
464 OMIA:001516-9615 dog Gastrointestinal stromal tumor KIT deletion, small (<=20) Naturally occurring variant Not currently evaluated CanFam3.1 13 g.47178531_47178536del c.1664_1669del NM_001003181.1; deletion of AGTGGA; SOMATIC MUTATION 2010 20950418
465 OMIA:001516-9615 dog Gastrointestinal stromal tumor KIT deletion, small (<=20) Naturally occurring variant Not currently evaluated CanFam3.1 13 g.47178534_47178539del c.1667_1672del NM_001003181.1; deletion of GGAAGG; SOMATIC MUTATION 2010 20950418
459 OMIA:001737-9615 dog Coat colour, white spotting, KIT-related KIT deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated CanFam3.1 13 g.47179174_47179176del c.1936_1938del p.(L646del) NM_001003181.1; NP_001003181.1; published as c.1960_1962delCTC; p.(L654del); coordinates in the table have been updated to a recent reference genome and / or transcript 2013 23659249 Dr. Wanda M. Gerding provided additional sequence information to facilitate identification of the genomic position in CanFam3.1
1331 OMIA:000209-9796 domestic horse American Paint (Horse) American Trotter (Horse) Belgian Draft (Horse) Icelandic Horse (Horse) Quarter Horse (Horse) Thoroughbred (Horse) Welsh Pony (Horse) White spotting KIT W32 substitution missense Naturally occurring variant LB/B EquCab3.0 3 NC_009146.3:g.79538738C>T NM_001163866.1:c.2878G>A NP_001157338.1:p.(A960T) cDNA position previously listed as c.3214G>A; p.(A1072T) based on transcript ENSECAT00000014037.3 [16/04/2024] rs1141982296 2021 34223905 Breed information updated based on PMID: 38600096
882 OMIA:000209-9796 domestic horse Süddeutsches Kaltblut, Germany (Horse) Coat colour, dominant white KIT W11 substitution splicing Naturally occurring variant P EquCab3.0 3 NC_009146.3:g.79540429C>T NM_001163866.1:c.2684+1G>A rs5334475183 2009 19456317 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
939 OMIA:000209-9796 domestic horse Thoroughbred (Horse) Coat colour, dominant white KIT W26 deletion, small (<=20) frameshift Naturally occurring variant VUS EquCab3.0 3 NC_009146.3:g.79540694del NM_001163866.1:c.2536del NP_001157338.1:p.(S846Vfs*15) NM_001163866.1; NP_001157338.1; published as c.2536delA rs3101685403 2018 29333746
873 OMIA:000209-9796 domestic horse Oldenburg (Horse) Coat colour, dominant white KIT W16 substitution missense Naturally occurring variant LP/P EquCab3.0 3 NC_009146.3:g.79540741T>A NM_001163866.1:c.2489A>T NP_001157338.1:p.(K830I) rs5334475213 2011 21554354 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
883 OMIA:000209-9796 domestic horse Miniature Horse (Horse) Quarter Horse (Horse) Shetland Pony (Horse) Coat colour, dominant white KIT W13 substitution splicing Naturally occurring variant P EquCab3.0 3 NC_009146.3:g.79544066C>G NM_001163866.1:c.2472+5G>C NM_001163866.1 rs3102773259 2011 21554354 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
889 OMIA:000209-9796 domestic horse Thoroughbred (Horse) Coat colour, dominant white KIT W14 deletion, gross (>20) deletion (in-frame) Naturally occurring variant LP/P EquCab3.0 3 NC_009146.3:g.79544098_79544151del NM_001163866.1:c.2392_2445del NP_001157338.1:p.(H798_N815del) NM_001163866.1; NP_001157338.1 2011 21554354 genomic coordinates updated from g.79544151_79544204del to g.79544098_79544151del in EquCab3.0 [17/09/2023]
891 OMIA:000209-9796 domestic horse Icelandic Horse (Horse) White spotting KIT W21 deletion, small (<=20) frameshift Naturally occurring variant P EquCab3.0 3 NC_009146.3:g.79544174del NM_001163866.1:c.2369delC NP_001157338.1:p.(A790Efs*20) rs5334475210 2015 26059442 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
885 OMIA:000209-9796 domestic horse Appaloosa (Horse) Haflinger (Horse) Lipizzan horse (Horse) Noric (Horse) Quarter Horse (Horse) Coat colour, dominant white KIT sabino 1 (SB1) substitution splicing Naturally occurring variant P EquCab3.0 3 NC_009146.3:g.79544206A>T "SNP AX-103727726 (ECA3:77735520; SB1, SNP KI16+1037A)" (Druml et al., 2018) rs5334475211 2005 16284805 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
893 OMIA:000209-9796 domestic horse Trottatore Italiano, Italy (Horse) Coat colour, dominant white KIT W24 substitution splicing Naturally occurring variant LP/P EquCab3.0 3 NC_009146.3:g.79545245C>T NM_001163866.1:c.2349+1G>A rs3443588955 2017 28856698
1462 OMIA:000209-9796 domestic horse American Trotter (Horse) Dominant white spotting KIT W33 substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 3 NC_009146.3:g.79545248T>A NM_001163866.1:c.2347A>T NP_001157338.1:p.(N783Y) NC_009146.3; previously listed as ENSECAT00000014037.3: c.2783A>T / p.(N895Y) [16/04/2024] 2022 35641888
881 OMIA:000209-9796 domestic horse Icelandic Horse (Horse) Coat colour, dominant white KIT W8 substitution splicing Naturally occurring variant P EquCab3.0 3 NC_009146.3:g.79545374C>T NM_001163866.1:c.2222-1G>A NM_001163866.1 rs3434854925 2009 19456317
1778 OMIA:000209-9796 domestic horse Warmblood (Horse) White spotting KIT W38 substitution splicing Naturally occurring variant Not currently evaluated EquCab3.0 3 NC_009146.3:g.79545867C>A NM_001163866.2:c.2221+5G>T 2025 40218308
886 OMIA:000209-9796 domestic horse Thoroughbred (Horse) Coat colour, dominant white KIT W5 deletion, small (<=20) frameshift Naturally occurring variant P EquCab3.0 3 NC_009146.3:g.79545900del NM_001163866.1:c.2193delG NP_001157338.1:p.(T732Qfs*9) rs5334475194 2009 19456317 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
878 OMIA:000209-9796 domestic horse Freiberger (Horse) Coat colour, dominant white KIT W1 substitution nonsense (stop-gain) Naturally occurring variant P EquCab3.0 3 NC_009146.3:g.79545942G>C NM_001163866.1:c.2151C>G NP_001157338.1:p.(Y717*) rs5334475201 2007 17997609 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124
877 OMIA:000209-9796 domestic horse American Paint (Horse) American Trotter (Horse) Appaloosa (Horse) Arab (Horse) Belgian Draft (Horse) Clydesdale (Horse) Freiberger (Horse) Friesian (Horse) German Riding Pony (Horse) Morgan (Horse) Noric (Horse) Oldenburg (Horse) Quarter Horse (Horse) Shetland Pony (Horse) Thoroughbred (Horse) Tori hobune, Estonia (Horse) Traditional Gypsy Cob, United Kingdom of Great Britain and Northern Ireland (Horse) Warmblood (Horse) Welsh Pony (Horse) Coat colour, dominant white KIT W20 substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 3 NC_009146.3:g.79548220T>C NM_001163866.1:c.2045G>A NP_001157338.1:p.(R682H) ENSECAT00000014037.3:c.2381A>G ENSECAP00000011188.2:p.His794Arg; reference genome corresponds to g.79548220T and the transcript NM_001163866.1 represents g.79548220C rs1143160924 2013 23659293 Variant coordinates initially gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124. Breed information updated based on PMID:38600096, PMID41865906
1261 OMIA:000209-9796 domestic horse Berber, Germany (Horse) Extensive coat white patterning KIT W30 substitution missense Naturally occurring variant LP/P EquCab3.0 3 NC_009146.3:g.79548244A>T NM_001163866.1:c.2021T>A NP_001157338.1:p.(L674H) published as g.79548244, c.2020T>A; p.L674H (Martin et al., 2020) - changed to  NM_001163866.1:c.2021T>A [16/042024] rs5334475224 2020 33111383
890 OMIA:000209-9796 domestic horse Thoroughbred (Horse) White spotting KIT W22 deletion, gross (>20) Naturally occurring variant P EquCab3.0 3 NC_009146.3:g.79548925_79550822del 1898bp deletion 2017 28444912
868 OMIA:000209-9796 domestic horse Thoroughbred (Horse) Coat colour, dominant white KIT W2 substitution missense Naturally occurring variant P EquCab3.0 3 NC_009146.3:g.79549540C>T NM_001163866.1:c.1960G>A NP_001157338.1:p.(G654R) rs5334475198 2007 17997609 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124
869 OMIA:000209-9796 domestic horse Camarillo White Horse, United States of America (Horse) Coat colour, dominant white KIT W4 substitution missense Naturally occurring variant P EquCab3.0 3 NC_009146.3:g.79549781G>A NM_001163866.1:c.1805C>T NP_001157338.1:p.(A602V) Previously incorrectly listed as g.79549780G>A [16/04/2024] 2007 17997609 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
871 OMIA:000209-9796 domestic horse Holsteiner (Horse) Coat colour, dominant white KIT W9 substitution missense Naturally occurring variant LP/P EquCab3.0 3 NC_009146.3:g.79549797C>T NM_001163866.1:c.1789G>A NP_001157338.1:p.(G597R) rs5334475209 2009 19456317 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
872 OMIA:000209-9796 domestic horse Arab (Horse) Coat colour, dominant white KIT W15 substitution missense Naturally occurring variant LP/P EquCab3.0 3 NC_009146.3:g.79550351A>G NM_001163866.1:c.1597T>C NP_001157338.1:p.(C533R) rs5334475202 2011 21554354 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
1777 OMIA:000209-9796 domestic horse Anglo-Arab (Horse) Zangersheide, Belgium (Horse) White spotting KIT W37 insertion, small (<=20) Naturally occurring variant Not currently evaluated EquCab3.0 3 NC_009146.3:g.79551903_79551904insA NM_001163866.2:c.1512_1513insT NP_001157338.2:p.(N505*) published as g.79551897_79551898insA - coordinates in this table consider the 3'rule of the HGVS recommendations 2025 40218308
940 OMIA:000209-9796 domestic horse Thoroughbred (Horse) Coat colour, dominant white KIT W27 substitution missense Naturally occurring variant LP EquCab3.0 3 NC_009146.3:g.79551937A>C NM_001163866.1:c.1473T>G NP_001157338.1:p.(C491W) NM_001163866.1; NP_001157338.1 rs3110307743 2018 29333746
884 OMIA:000209-9796 domestic horse CH-Warmblut, Switzerland (Horse) Coat colour, dominant white KIT W18 substitution splicing Naturally occurring variant P EquCab3.0 3 NC_009146.3:g.79553751C>T NM_001163866.1:c.1346+1G>A rs5334475221 2013 23659293 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124
876 OMIA:000209-9796 domestic horse Arab (Horse) Coat colour, dominant white KIT W19 substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 3 NC_009146.3:g.79553776T>C NM_001163866.1:c.1322A>G NP_001157338.1:p.(Y441C) rs5334475217 2013 23659293 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124
1476 OMIA:000209-9796 domestic horse American Paint (Horse) American Trotter (Horse) Appaloosa (Horse) Arab (Horse) Mangalarga (Horse) Morgan (Horse) Mustang (Horse) Quarter Horse (Horse) Rocky Mountain, United States of America (Bighorn sheep) Warmblood (Horse) Increased white spotting KIT W34 substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 3 NC_009146.3:g.79566881T>C NM_001163866.1:c.1171A>G NP_001157338.1:p.(T391A) Previously listed as ENSECAT00000014037.3:c.1495A>G; ENSECAP00000011188.2:p.(T499A) [16/04/2024] rs1140732842 2022 35953947 Breed information updated based on PMID: 38600096
887 OMIA:000209-9796 domestic horse Quarter Horse (Horse) Coat colour, dominant white KIT W10 deletion, small (<=20) frameshift Naturally occurring variant P EquCab3.0 3 NC_009146.3:g.79566923_79566926del NM_001163866.1:c.1126_1129del NP_001157338.1:p.(E376Ffs*3) NM_001163866.1; NP_001157338.1; published as c.1126_1129delGAAC 2009 19456317 Genomic coordinates updated in this table from g.79566926_79566929del in EquCab3.0 after feedback from Micaela Vierra identified that these coordinates were incorrect [27/09/2023].
870 OMIA:000209-9796 domestic horse Thoroughbred (Horse) Coat colour, dominant white KIT W6 substitution missense Naturally occurring variant VUS EquCab3.0 3 NC_009146.3:g.79573754C>T NM_001163866.1:c.856G>A NP_001157338.1:p.(G286R) rs5334475167 2009 19456317 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124
892 OMIA:000209-9796 domestic horse Arab (Horse) White spotting KIT W23 substitution splicing Naturally occurring variant VUS/LB EquCab3.0 3 NC_009146.3:g.79578484C>G NM_001163866.1:c.756+1G>C rs1095048836 2017 28378922
879 OMIA:000209-9796 domestic horse Arab (Horse) Coat colour, dominant white KIT W3 substitution nonsense (stop-gain) Naturally occurring variant P EquCab3.0 3 NC_009146.3:g.79578535T>A NM_001163866.1:c.706A>T NP_001157338.1:p.(K236*) rs5334475200 2007 17997609 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124
938 OMIA:000209-9796 domestic horse Thoroughbred (Horse) Coat colour, dominant white KIT W25 substitution missense Naturally occurring variant LP EquCab3.0 3 NC_009146.3:g.79578573A>G NM_001163866.1:c.668T>C NP_001157338.1:p.(L223P) NM_001163866.1; NP_001157338.1 rs3103992630 2018 29333746
888 OMIA:000209-9796 domestic horse Thoroughbred (Horse) Coat colour, dominant white KIT W12 deletion, small (<=20) frameshift Naturally occurring variant P EquCab3.0 3 NC_009146.3:g.79579774_79579778del NM_001163866.1:c.559_563del NP_001157338.1:p.(S187Rfs*10) NM_001163866.1; NP_001157338.1; published as c.559_563delTCTGC rs5334475188 2010 Reference not in PubMed; see OMIA 000209-9796 for reference details Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
1779 OMIA:000209-9796 domestic horse White spotting KIT W39 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated EquCab3.0 3 NC_009146.3:g.79579796G>A NM_001163866.2:c.541C>T NP_001157338.2:p.(R181*) 2025 40218308
1091 OMIA:000209-9796 domestic horse German Riding Pony (Horse) White spotting KIT W28 deletion, gross (>20) splicing Naturally occurring variant LP/P EquCab3.0 3 NC_009146.3:g.79579925_79581197del 1273bp deletion affecting partial intron 2 and exon 3, may impact splicing 2019 31463981
880 OMIA:000209-9796 domestic horse Thoroughbred (Horse) Coat colour, dominant white KIT W7 substitution splicing Naturally occurring variant LP/P EquCab3.0 3 NC_009146.3:g.79580000C>G NM_001163866.1:c.338-1G>C rs5334475216 2009 19456317 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124
1330 OMIA:000209-9796 domestic horse Quarter Horse (Horse) White spotting KIT W31 insertion, small (<=20) frameshift Naturally occurring variant P EquCab3.0 3 NC_009146.3:g.79618532_79618533insA NM_001163866.1:c.30_31insT NP_001157338.1:p.(L11Sfs*115) 2021 34223905
1854 OMIA:000209-9796 domestic horse Japanese Draft, Japan (Horse) Coat colour, dominant white KIT W17 substitution missense Naturally occurring variant LP EquCab3.0 3 NC_009146.3:g.[79548244A>G;79548265T>A] NM_001163866.1:c.[2000A>T;2021T>C] NP_001157338.1:p.[(E667D);(L674P)] The two variants forming this haplotype were previously listed in OMIA as two variants (W17a; omia.variant:874; rs5334475222 and W17b; omia.variant:875; rs5334475224). Changed to this haplotype based on Tozaki et al. (2020,  PMID:33376443) [28/11/2025]. 2011 33376443 21554354 Thanks to Tosso Leeb for bringing the information reported by Tozaki et al. (2020) to our attention.
1695 OMIA:001737-9685 domestic cat Coat colour, salmiak KIT w^sal deletion, gross (>20) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.161142880_161237957del A 94 991 bp deletion in the 65875 bp downstream region of the KIT gene. F.catus_Fca126_mat1.0 coordiantes were previously incorrectly listed in OMIA as NC_058371.1:g.161142882_161237957del and were corrected after valuable feedback from Qianwen Sun [22/07/2026]. 2024 38721753 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
620 OMIA:001580-9685 domestic cat Birman (Cat) Feet white (gloving) KIT g delins, small (<=20) delins (in-frame) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.161337385_161337386deinsTG NM_001009837.3:c.1035_1036delinsCA NP_001009837.3:p.(E345_H346delinsDN) Montague et al. (2014) describe this variant as "two adjacent missense mutations". 2010 21147473 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
994 OMIA:000209-9685 domestic cat Domestic Longhair (Cat) Coat colour, dominant white KIT W insertion, gross (>20) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.161388687_161388688insN[617] published as "a FERV1 long terminal repeat (LTR) is associated with all Dominant White individuals" 2014 25085922 Genomic position in Felis_catus_9.0 is based on information provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
732 OMIA:001737-9685 domestic cat Coat colour, white spotting, KIT-related KIT S insertion, gross (>20) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.161388687_161388688insN[7125] "an insertion of an entire feline endogenous retrovirus (FERV1) into intron 1 of the KIT gene." 2014 25085922 Genomic position in Felis_catus_9.0 is based on information provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1505 OMIA:000449-452646 American mink Shadow coat colour KIT S^h substitution missense Naturally occurring variant Not currently evaluated NNQGG.v01 NWR01000037.1 g.6253028G>T c.2374G>T p.(D792Y) 2022 35481560
391 OMIA:001216-9823 pig Coat colour, roan KIT not known splicing Naturally occurring variant Not currently evaluated Sscrofa11.1 8 NM_001044525.1:c.757_925del a U(26) repeat in intron 5 of the KIT gene, which is likely to mediate skipping of exon 5 of the gene in some tissues including skin 2011 21749430
1248 OMIA:002287-9823 pig Bama Xiang Zhu, China (Pig) Hypopigmentation (piebald) and deafness KIT substitution missense Naturally occurring variant Not currently evaluated Sscrofa11.1 8 NC_010450.4:g.41485957T>A NM_001044525.1:c.2418T>A NP_001037990.1:p.(D806E) ENU mutagenesis was used to create these pigs, NM_001044525.1; c.2418T>A; NP_001037990.1; p.(D806E) (Xu et al., 2020) 2020 33042408
1135 OMIA:001745-9823 pig Cinta Senese, Italy (Pig) White belt KIT substitution Naturally occurring variant Not currently evaluated Sscrofa11.1 8 NC_010450.4:g.41488472C>T NM_001044525.1:c.2502C>T NP_001037990.1:p.(P834P) Variant is not causal, marker for phenotype in some breeds. Ensembl VEP analysis suggests that this can be a synonymous or 3_prime_UTR_variant depending on the transcript analysed. rs328592739 2016 Reference not in PubMed; see OMIA 001745-9823 for reference details
1725 OMIA:001737-89462 water buffalo Coat colour, white spotting, KIT-related KIT substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated UOA_WB_1 7 NC_037551.1:47207784A>T NM_001290952.1:c.2016T>A NP_001277881.1:p.(Y672*) 2024 39048931
1102 OMIA:000209-30538 alpaca Classic grey coat colour KIT substitution missense Naturally occurring variant Not currently evaluated VicPac3.2 2 NW_021964157.1:g.38170962G>A XM_031688000.1:c.391G>A XP_031543860.1:p.G131R published as c.376G>A and p.(G126R), coordinates in this table are based on supplementary table 4 in Tan et al. (2024) 2019 31297861
186 OMIA:001216-9913 taurine cattle Belgian Blue (Cattle) Shorthorn (Cattle) Roan KITLG substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:18262908G>T NM_174375.2:c.653C>A NP_776800.1:p.(A218D) rs5366937507 1999 10384045 NM_174375.2; NP_776800.1; published as c.654 variant, p.Ala193Asp. Variant information in this table were originally based on information listed in Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The coordinates were corrected after Cord Drögemüller notified OMIA curators that the previously listed variant was not present in roan cattle [17/11/2022]
1145 OMIA:002228-9615 dog Nova Scotia Duck Tolling Retriever (Dog) Poodle (Dog) Pigment intensity KITLG repeat variation Naturally occurring variant Not currently evaluated CanFam3.1 15 Weich et al. (2020): "the reference genome shows two tandem copies of the CNV spanning a region of approximately 12 kb. The CNV is located in an intergenic region about 152 kb upstream from the closest gene, KITLG." 200922: g. info moved here (g.29821450_29832950) until it can be standardised 2020 31936656
1152 OMIA:002237-8090 Japanese medaka Few melanophore kitlga insertion, gross (>20) Naturally occurring variant Not currently evaluated Otsuki et al. (2020): "the phenotype of fm medaka is attributable to insertion of a Tcb1-like transposon at the kitlga locus" 2020 31757930
74 OMIA:000819-9615 dog Shih Tzu (Dog) Prekallikrein deficiency KLKB1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 16 NC_006598.3:g.44501415A>T XM_022403603.1:c.988T>A XP_022259311.1:p.(F330I) 2011 20736516 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1495 OMIA:002425-9615 dog Chinese Shar-Pei (Dog) Ichthyosis, KRT1-related KRT1 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 27 g.44229728_44229730del c.567_569del p.(N190del) NM_001003392.1; NP_001003392.1 2022 36251712
364 OMIA:001415-9615 dog Norfolk Terrier (Dog) Hyperkeratosis, epidermolytic KRT10 substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 9 NC_006591.3:g.21866234G>T XM_014116588.2:c.1125+1G>T XM_038676544.1; XP_038532472.1; experimentally confirmed splice defect; a single base GT>TT change in the consensus 5'-splice site of intron 5 2005 16029326
1579 OMIA:001415-9615 dog Chihuahua (Dog) Ichthyosis, epidermolytic KRT10 substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 9 NC_049230.1:g.21814695G>A XM_038547368.1:c.437G>A XP_038403296:p.(R146H) XM_038547368.1; XP_038403296 2023 37332248
1229 OMIA:002281-9685 domestic cat Domestic Shorthair (Cat) Epidermolysis bullosa, simplex, KRT14-related KRT14 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 E1 NC_058381.1:g.40385540G>A XM_003996860.6:c.979C>T XP_003996909.3:p.(Q327*) 2020 32657488 Genomic position in Felis_catus_9.0 provided by Joshua Khamis. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
936 OMIA:002088-9615 dog Dogue de Bordeaux (Dog) Palmoplantar keratoderma, nonepidermolytic, focal 1 KRT16 delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 9 g.[21170012_21170013delinsCGGA;21170030del] c.[1147_1148delinsCGGA;1165del] p.(V383Rfs) XM_548101.4; XP_548101.2; published as p.(E392*) - protein coordinates updated to HGVS nomenclature 2015 25521457
856 OMIA:003039-9796 domestic horse Bashkir Curly (Horse) Curly Horse (Horse) Curly coat KRT25 Crd substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 11 NC_009154.3:g.21962991G>A NM_001346190.1:c.266G>A NP_001333119.1:p.(R89H) rs1095048844 2017 29686323 29141579 Variant coordinates obtained from and/or confirmed by EBI's Some Effect Predictor (VEP) tool
777 OMIA:000246-9913 taurine cattle Aberdeen-Angus (Cattle) Ayrshire (Cattle) Montbéliarde (Cattle) Simmental (Cattle) Curly hair, karakul-type KRT27 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.40982250G>C NM_001075815.1:c.276C>G NP_001069283.1:p.(N92K) rs384881761 2014 25017103 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
1265 OMIA:002081-9913 taurine cattle Belgian Blue (Cattle) Epidermolysis bullosa, simplex, KRT5-related` KRT5 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.27367611_27367613del NM_001008663.1:c.534_536del NP_001008663.1:p.(N178del) Publised as '27367604delCAA' coordinates in the table have been updated to reflect HGVS nomenclature (3' rule) [03/09/2024] 2020 33135329
192 OMIA:002081-9913 taurine cattle Friesian cross (Cattle) Jersey cross Epidermolysis bullosa KRT5 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.27371128G>A NM_001008663.1:c.1432G>A NP_001008663.1:p.(E478K) rs5334474982 2005 15955091 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1480 OMIA:002081-9615 dog Cardigan Welsh Corgi (Dog) Epidermolysis bullosa, simplex, KRT5-related KRT5 substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 27 NC_049248.1:g.44080887C>T NM_001346035.1:c.1426G>A NP_001332964.1:p.(E476K) NM_001346035.1; NP_001332964.1 2022 36004757
1697 OMIA:002081-9615 dog German Shepherd Dog (Dog) Epidermolysis bullosa simplex, localized, KRT5-related KRT5 delins, small (<=20) delins (in-frame) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 27 NC_049248.1:g.44081942_44091959del NM_001346035.1:c.988_1005del NP_001332964.1:p.(N330_D335del) 2024 38742646
662 OMIA:000394-9031 chicken Frizzle KRT6A deletion, gross (>20) splicing Naturally occurring variant Not currently evaluated GRCg6a 33 g.5251413_5251496del p.(V311_K333del) NM_001001313.2; NP_001001313.2; published as a 84bp deletion that covers positions −24 of exon 5 to +59 of intron 5 of KRT6A (called KRT75 in an earlier genome assembly); the deletion activates a cryptic splice site resulting in a 69 bp in-frame deletion in mRNA after splicing and a deletion of 23-amino acids (position 311–333) 2012 22829773
1337 OMIA:002114-9913 taurine cattle Hereford (Cattle) Hypotrichosis, KRT71-related KRT71 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.27331221_27331228del NM_001075970.1:c.281_288del NP_001069438.1:p.(M94Nfs*14) cDNA and protein positions based on NM_001075970.1 and NP_001069438.1, respectively 2021 34356054 210909: FN checked the ARS-UCD1.2 assembly, and discovered that the deletion spans 27331221 to 27331228. Thus g.27331221delTGTGCCCA was changed to g.27331221_27331228del. From NCBI's genome browser, worked out that the c. notation needs to be changed from c.281delTGTGCCCA to c.281_288del.
1043 OMIA:000245-9615 dog Bichon Frise (Dog) Chesapeake Bay Retriever (Dog) Curly Coated Retriever (Dog) Irish Terrier (Dog) Lagotto Romagnolo (Dog) Spanish Water Dog (Dog) Curly coat KRT71 c^2 delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 27 g.2543230_2543237delinsACA c.1266_1273delinsACA p.(S422Rfs) NM_001197029.1; NP_001183958.1 2019 30444027 30456859 Genomic position in CanFam3.1 provided by Mateo Etcheveste and Robert Kuhn.
35 OMIA:000245-9615 dog Huntaway (Dog) New Zealand Heading Dog (Dog) Portuguese Water Dog (Dog) Curly coat KRT71 c^1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 27 NC_006609.3:g.2539211C>T NM_001197029.1:c.451C>T NP_001183958.1:p.(R151W) NM_001197029.1; NP_001183958.1, additional breeds based on PMID:40965331 rs23373415 2009 19713490 Genomic coordinates in CanFam3.1 and EVA ID provided by Robert Kuhn
382 OMIA:001583-9685 domestic cat Sphynx (Cat) Sphynx hairless KRT71 Re^HR substitution splicing Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B4 NC_058374.1:g.78941699C>T NM_001195239.1:c.816+1G>A rs5334475135 2010 20953787 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
394 OMIA:001712-9685 domestic cat Selkirk Rex (Cat) Curly coat, Selkirk rex KRT71 Re^S substitution splicing Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B4 NC_058374.1:g.78943283C>G NM_001195239.1:c.445-1G>C 2013 23770706 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
380 OMIA:001581-9685 domestic cat Devon Rex (Cat) Curly coat, Devon rex KRT71 re haplotype splicing Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B4 NC_058374.1:g.[78939377_78939378insA;78939389_78939390insCTCCAACT;78939390_78939470del] NM_001195239.1:c.[1108-4_1184del;1184_1185insAGTTGGAG;1196_1197insT] 2010 20953787 Genomic position in Felis_catus_9.0 is based on information provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1549 OMIA:002687-9940 sheep Fleece variation, fine wool KRT74 substitution missense Naturally occurring variant Not currently evaluated Oar_v4.0 3 NC_019460.2:g.133486008C>A XM_004006324.3:c.367C>A XP_004006373.1:p.(H123N) XM_004006324.3; XP_004006373.1; the C allele is associated with wool fineness rs427563779 2024 37137429
1398 OMIA:002486-9031 chicken Kirin (Chicken) Xiushui Yellow (Chicken) Frizzle KRT75L4 deletion, small (<=20) Naturally occurring variant Not currently evaluated GRCg6a 33 g.5285437_5285451del g.5285437-5285451delGATGCCGGCAGGACG 2018 30572816
735 OMIA:001371-9615 dog Staffordshire Bull Terrier (Dog) L-2-hydroxyglutaricacidemia L2HGDH delins, small (<=20) delins (in-frame) Naturally occurring variant Not currently evaluated CanFam3.1 8 g.26723470_26723472delinsAAG c.1298_1300delinsCTT p.(L433_H434delinsPY) XM_858437.5; XP_863530.2; published as ENSCAFG00000014237; CanFam1.0: (c[1297T→C; 1299c→t]; p[Leu433Pro; His434Tyr]; coordinates in the table have been updated to a recent reference genome and / or transcript 2007 17475916
427 OMIA:001371-9615 dog Yorkshire Terrier (Dog) L-2-hydroxyglutaricacidemia L2HGDH substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 8 NC_006590.3:g.26760351T>C XM_858437.5:c.1A>G XP_013971359.1:p.(M1?) XM_858437.5; published as p.(Met1?) 2012 22843824 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
1317 OMIA:001371-9685 domestic cat Domestic Longhair (Cat) L-2-hydroxyglutaric aciduria L2HGDH substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B3 NC_058373.1:g.97844907T>C XM_023255678.2:c.1301A>G XP_023111446.2:p.(H434R) rs5334475154 2021 34062805 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1535 OMIA:001371-9685 domestic cat Domestic Shorthair (Cat) L-2-hydroxyglutaricacidemia L2HGDH substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B3 NC_058373.1:g.97881395G>A XM_023255679.2:c.397C>T XP_023111447.2:p.(Q133*) 2023 36880414
1399 OMIA:002459-9615 dog Staffordshire Bull Terrier (Dog) Congenital muscular dystrophy LAMA2 deletion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 1 g.67734331_67736575del c.610-1412_789+653del XM_003432522.2; 2022 34854126
1389 OMIA:002459-9615 dog Italian Greyhound (Dog) Congenital muscular dystrophy LAMA2 CMD substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 1 NC_006583.3:g.67883271G>A XM_022419950.1:c.3285G>A XP_022275658.1:p.(W1095*) XM_022419950.1; XP_022275658.1 2021 34828429
701 OMIA:001677-9615 dog German Pointer (Dog) Epidermolysis bullosa, junctionalis, LAMA3 LAMA3 insertion, gross (>20) Naturally occurring variant Not currently evaluated 7 "insertion (4818+207ins6.5 kb) of repetitive satellite DNA within intron 35 of the gene (LAMA3)" 2005 15737193
909 OMIA:001677-9913 taurine cattle Belgian Blue (Cattle) Epidermolysis bullosa, junctionalis, LAMA3-related LAMA3 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.2 24 g.32749369G>A c.7549C>T p.(R2517*) rs5334475046 2015 26370913 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1324 OMIA:001677-9615 dog Australian Cattle Dog X Epidermolysis bullosa, junctionalis, LAMA3 LAMA3 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 7 g.64427161T>A c.8615T>A p.(D2867V) cDNA and protein positions based on XM_537297.6 and XP_537297.2, respectively 2021 34250689
658 OMIA:001677-9796 domestic horse American Saddle Horse (Horse) Epidermolysis bullosa, junctionalis, LAMA3-related LAMA3 deletion, gross (>20) Naturally occurring variant Not currently evaluated EquCab3.0 8 NC_009151.3:g.48678342_48684920del "6589-bp deletion spanning exons 24-27 . . . in the LAMA3 gene in American Saddlebred foals" 2009 19016681 Coordinates in EquCab3.0 kindly provided by Haley Rutstein, working under the guidance of Professor Ernie Bailey.
1387 OMIA:002479-9913 taurine cattle Romagnola (Cattle) Hemifacial microsomia LAMB1 HFM substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 4 NC_037331.1:g.49019693G>A NM_001206519.1:c.2002C>T NP_001193448.1:p.(R668C) NM_001206519.1; NP_001193448.1; 2022 34796979
1781 OMIA:002269-9940 sheep Bleu Du Maine (Sheep) Junctional epidermolysis bullosa LAMB3 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UI_Ramb_v2.0 12 NC_056065.1:g.73166198delG XM_042229255.1:c.3051 + 1delG XP_042085189.1:p.(V1018Ffs*12) the 1-bp deletion affects the first nucleotide of intron 20 at the exon/intron boundary and mary result in altered splicing of exon 20 2025 40100311
1239 OMIA:002269-9615 dog Australian Shepherd (Dog) Epidermolysis bullosa, junctionalis, LAMB3-related LAMB3 JEB substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 7 NC_006589.3:g.8286613A>G XM_014115071.2:c.1174T>C XP_013970546.1:p.(C392R) NC_006589.3:g.8286613A>G; XM_014115071.2:c.1174T>C; XP_013970546.1:p.Cys392Arg 2020 32906717
682 OMIA:001678-9913 taurine cattle Hereford (Cattle) Epidermolysis bullosa, junctionalis, LAMC2 LAMC2 deletion, gross (>20) Naturally occurring variant Not currently evaluated 16 "2.4 kb deletion encompassing the first exon of the LAMC2 gene" 2015 25888738
599 OMIA:001678-9796 domestic horse Belgian Draft (Horse) Breton, France (Horse) Cavallo Agricolo Italiano da Tiro Pesante Rapido, Italy (Horse) Comtois (Horse) Epidermolysis bullosa, junctionalis, LAMC2-related LAMC2 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated EquCab3.0 5 NC_009148.3:g.17498175dup NM_001081768.1:c.1372dup NP_001075237.1:p.(R458Pfs) NM_001081768.1; NP_001075237.1; published as c.1368insC; coordinates in the table have been updated to HGVS nomenclature (3'-rule) and recent reference genome and / or transcript inforamtion 1,372 Protein position: 458 2002 12230513 The genomic position in EquCab3.0 was provided by Margaret Higgins, working under the guidance of Professor Ernie Bailey [April 2022]
507 OMIA:001678-9940 sheep German Blackheaded Mutton (Sheep) Epidermolysis bullosa, junctionalis, LAMC2-related LAMC2 deletion, small (<=20) nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 12 NC_040263.1:g.68856318_68856319del NM_001142358.1:c.2746_2747del NP_001135830.1:p.(A928*) FM872310 c.2746delCA 2011 21573221 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1168 OMIA:002251-9615 dog Airedale Terrier (Dog) Surfactant metabolism dysfunction, pulmonary LAMP3 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 34 NC_006616.3:g.16092728C>T XM_843796.4:c.1159G>A XP_848889.2:p.(E387K) 2020 32150563
1371 OMIA:002460-9615 dog Labrador Retriever (Dog) Muscular dystrophy-dystroglycanopathy LARGE substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 10 NC_006592.3:g.30357716C>T XM_531751.6:c.1363C>T XP_531751.3:p.(R455*) 2021 34654610
449 OMIA:001160-9986 rabbit Hyperlipidaemia LDLR deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated "an in-frame deletion of 12 nucleotides that eliminates four amino acids from the cysteine-rich ligand binding domain of the LDL receptor" 1986 3010466
1556 OMIA:000499-9544 Rhesus monkey Hypercholesterolaemia LDLR substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated 19 p.(W284*) G>A in exon 6 in position 914 of the human cDNA resulting in p.(W284*) 1990 2326270
1557 OMIA:000499-9544 Rhesus monkey Hypercholesterolaemia LDLR substitution missense Naturally occurring variant Not currently evaluated 19 c.245G>A p.(C82Y) 2023 37186395
1817 OMIA:000499-9685 domestic cat Korat (Cat) Hypercholesterolaemia LDLR substitution nonsense (stop-gain) Not currently evaluated F.catus_Fca126_mat1.0 A2 NC_058369.1:g.8410638G>A XM_003981898.6:c.2274G>A XP_003981947.3:p.(W758*) published with mRNA position XM_003981898.6:c.2406G>A, changed in the OMIA variant table to CDS position based on feedback from Jenna Himawan [16/09/2025] 2024 Reference not in PubMed; see OMIA 000499-9685 for reference details
987 OMIA:000499-9823 pig Hypercholesterolaemia LDLR substitution missense Naturally occurring variant Not currently evaluated Sscrofa11.1 2 NC_010444.4:g.69841413C>T NM_001206354.2:c.343C>T NP_001193283.1:p.(R115C) Published as p.(R84C) - p. and c. coordinates updated to recent transcript/protein ID (29/01/2025) rs701604154 1998 9556295 The genomic location on Sscrofa11.1 was determined and the effect was confirmed with Ensembl VEP by Stephanie Shields (27/05/2020)
269 OMIA:001596-9615 dog Lagotto Romagnolo (Dog) Epilepsy, benign familial juvenile LGI2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 3 NC_006585.3:g.85210442A>T XM_022416405.1:c.1558A>T XP_022272113.1:p.(K520*) XM_022416405.1; XP_022272113.1; published as c.1552A>T & p.(K518*); coordinates in the table have been updated to a recent reference genome and / or transcript 2011 21829378
1862 OMIA:003031-9685 domestic cat Deafness, LHFPL5-realated LHFPL5 substitution splicing Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B2 NC_058372.1:g.34339237A>G XM_003986102.4:c.413‐2A>G 2025 41400044
362 OMIA:002314-9615 dog Czechoslovakian Wolfdog (Dog) German Shepherd Dog (Dog) Saarloos Wolfhond (Dog) Tibetan Terrier (Dog) White Swiss Shepherd Dog (Dog) Pituitary dwarfism LHX3 delins, small (<=20) splicing Naturally occurring variant Not currently evaluated 9 "a deletion of one of six 7 bp [GTGTTTT] repeats in intron 5 of LHX3" 2011 22132174 additioanl breeds added based on PMID:33890524 & PMID:40833232
608 OMIA:002314-9615 dog German Shepherd Dog (Dog) Pituitary dwarfism LHX3 duplication Naturally occurring variant Not currently evaluated CanFam3.1 9 NC_006591.3:g.49252491_49252493dup NM_001197187.1:c.545_547dup NP_001184116.1:p.(N182dup) published as c.545_547dupACA 2011 22132174 Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn.
1415 OMIA:002516-9913 taurine cattle Brown Swiss (Cattle) Original Swiss Brown (Cattle) Haplotype with homozygous deficiency OH4 LIG3 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.15080336_15080341del NM_001038107.2:c.2483_2484+4delAGGTG NP_001033196.1:p.K828fs NM_001038107.2 rs5381613636 2021 34915862
1842 OMIA:003023-9913 taurine cattle Brown Swiss (Cattle) Ataxia LIPC ATX substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 10 NC_037337.1:g.51715800G>C NM_001035410.1:c.924C>G NP_001030487.1:p.(F308L) 2026 42007389
450 OMIA:001566-9986 rabbit Rex coat LIPH deletion, small (<=20) Naturally occurring variant Not currently evaluated 14 c.1362delA 2011 21552526
1203 OMIA:002273-9685 domestic cat Ural Rex (Cat) Curly coat, Ural Rex LIPH urx delins, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 C2 NC_058376.1:g.81753670_81753676delinsC XM_019840031.3:c.477_483delinsC XP_019695590.2:p.(S160_G161del) changed from c.478_483del to c.477_483delinsC in accordance with HGVS nomenclature [17/2/2022] 2020 32463158 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
649 OMIA:002389-9685 domestic cat Highlander (Cat) Maine Coon (Cat) Maine Coon Polydactyl (Cat) Spinal muscular atrophy LIX1 deletion, gross (>20) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A1 NC_058368.1:g.158510559_158648551del published as "a ~140 kb deletion removing exons 4-6 of LIX1 and all except exon 1 of LNPEP"
Previously listed incorrectly in this table as NC_058368.1:g.159254616_159394886del. Coordinates updated to the correct position NC_058368.1:g.158510559_158648551del based on feedback from Bojana Matić. [04/04/2026].
2006 16899656 Genomic position in Felis_catus_9.0 is based on information provided by Leslie Lyons and Reuben Buckley. Additional breeds reported based on PMID:35709088. 
663 OMIA:001612-9031 chicken Silkie (Chicken) Oligozeugodactyly LMBR1 deletion, gross (>20) Naturally occurring variant Not currently evaluated 2 "a large deletion in LMBR1-intron 5, eliminating most of the limb-specific enhancer conserved sequence." 2011 21509895
434 OMIA:000810-9685 domestic cat Polydactyly LMBR1 Pd^UK2 substitution regulatory Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A2 NC_058369.1:g.167522322T>A regulatory variant in the ZPA regulatory sequence (ZRS); published as AGACACAG[A/T]AATGAG 2008 18156157 Genomic position in Felis_catus_9.0 provided by Joshua Khamis. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
433 OMIA:000810-9685 domestic cat Polydactyly LMBR1 Pd^UK1 substitution regulatory Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A2 NC_058369.1:g.167522546C>G regulatory variant in the ZPA regulatory sequence (ZRS); published as CC[G/C]GTG 2008 18156157 Genomic position in Felis_catus_9.0 provided by Joshua Khamis, Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
432 OMIA:000810-9685 domestic cat Maine Coon (Cat) Polydactyly LMBR1 Pd^Hw substitution regulatory Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A2 NC_058369.1g.167522324T>C regulatory variant in the ZPA regulatory sequence (ZRS); published as AGACAC[A/G]GAAATGAG   

2008 18156157 Genomic position in Felis_catus_9.0 provided by Joshua Khamis, Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1583 OMIA:002700-9615 dog Australian Shepherd (Dog) Hyposegmentation of granulocytes LMBR1L substitution splicing Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 27 NC_049248.1:g.41169674C>T XM_038577534.1:c.191+1G>A XM_038577534.1 2023 37347778
1823 OMIA:002977-9796 domestic horse Freiberger (Horse) Hypertriglyceridemia-induced pancreatitis LMF1 HIP delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated EquCab3.0 NC_009156.3:g.42,935,259_42,935,263delinsTCT XM_023616679.1:c.369_373delinsTCT XP_023472447.1:p.(L125Rfs*193 2025 40764662
1521 OMIA:001213-9986 rabbit Emery-Dreifuss muscular dystrophy LMNA substitution missense Base-editing Not currently evaluated p.(L530P) 2022 35282412
1672 OMIA:002796-9541 crab-eating macaque Cardiomyopathy, dilated, LMNA-related LMNA substitution splicing Base-editing Not currently evaluated MFA1912RKSv2 1 NC_052255.1:g.93546791T>C XM_045371898.1:c.357-2A>G 2024 38559624
1401 OMIA:001213-9823 pig Yucatan Miniature, United States of America (Pig) Hutchinson-Gilford progeria syndrome LMNA substitution splicing Genome-editing (CRISPR-Cas9) Not currently evaluated Sscrofa11.1 4 NC_010446.5:g.93900345G>A NM_001111257.2:c.1824C>T 2019 30911407
1638 OMIA:002796-9615 dog Nova Scotia Duck Tolling Retriever (Dog) Cardiomyopathy, dilated, LMNA-related LMNA deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 7 g.41688530del c.1726del p.(D576Tfs*124) NM_001287151.1; NP_001274080 2023 37925523
1797 OMIA:002953-9823 pig Cardiomyopathy, hypertrophic LOC100736765 substitution missense Base-editing Not currently evaluated Sscrofa11.1 7 NC_010449.5:g.75685084C>T XM_021099233.1:c.1360C>T XP_020954892.1:p.(R454C) Published as p.(R453C) 2024 38862020
1046 OMIA:001701-13146 budgerigar Feater colour, blue LOC101880715 substitution missense Naturally occurring variant Not currently evaluated 1 NW_004848279.1:g.21369066T>C XM_005153087.1c.1930T>C p.(R644W) 2017 28985565
1913 OMIA:003065-9796 domestic horse Friesian (Horse) Sperm abnormalities and embryonic lethality, FH10 Haplotype LOC106782482 deletion, gross (>20) Naturally occurring variant Not currently evaluated EquCab3.0 23 NC_009166.3:g.5958862_6314918del deleted 356kb region comprises SLC28A3-like and SPATA31D-like genes/ncRNAs   2026 41808016
393 OMIA:000344-9031 chicken Fayoumi (Chicken) Epilepsy LOC430486 delins, small (<=20) splicing Naturally occurring variant Not currently evaluated 25 c581-4CC>TG 2011 22046416
1816 OMIA:002971-9615 dog Beagle (Dog) Pembroke Welsh Corgi (Dog) GST‐theta enzyme activity, deficiency LOC477558 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated CanFam3.1 26 NC_006608.3:g.28565797_28565802del XM_851878.6:c.385_390del XP_856971.3:p.(D129_Q130del) 2017 29105159
108 OMIA:002071-9615 dog Labrador Retriever (Dog) Macular corneal dystrophy LOC489707 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 5 NC_006587.3:g.75279762C>A XM_005620685.3:c.814C>A XP_005620742.1:p.(R272S) The genomic position was previously listed incorrectly in OMIA as CanFam3.1 g.75279699C>A and was corrected based on feedback from Martina Tunjić [01/05/2025]. 2016 26585178
1151 OMIA:001928-9615 dog Golden Retriever (Dog) Myasthenic syndrome, congenital, COLQ-related LOC608697 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 23 NC_006605.3:g.27175559G>A XM_858278.5:c.880G>A XP_863371.1:p.(G294R) 2020 31769119
900 OMIA:001928-9615 dog Labrador Retriever (Dog) Myasthenic syndrome, congenital LOC608697 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 23 NC_006605.3:g.27176737T>C XM_858278.5:c.1010T>C XP_863371.1:p.(I337T) XM_858278.5; XP_863371.1 2014 25166616 Genomic position in CanFam3.1 provided by Robert Kuhn
1314 OMIA:002336-9615 dog Rottweiler (Dog) Nonsyndromic hearing loss LOXHD1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 7 g.44806821G>C c.5747G>C p.(G1914A) XM_022421426.1, c.5747G>C; J9PAE4, p.(G1914A) (Hytönen et al., 2021) 2021 33983508
522 OMIA:001684-9685 domestic cat Cornish Rex (Cat) German Rex (Cat) Curly/woolly coat, Cornish Rex and German Rex LPAR6 r deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A1 NC_058368.1:g.22865220_22865223del NM_001309049.1:c.250_253del NP_001295978.1:p.(F84Efs*9) c.250_253delTTTG 2013 23826204 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
131 OMIA:001210-9685 domestic cat Hyperlipoproteinaemia LPL substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.37910025C>T NM_001042567.1:c.1315G>A NP_001036032.1:p.(G439R) published as c.1234G>A and p.(G412R); coordinates in the table have been updated to a recent reference genome and / or transcript 1996 8636438 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1260 OMIA:001486-9615 dog Beagle (Dog) Night blindness, congenital stationary, LRIT3-related LRIT3 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 32 g.30038863del c.763del p.(K245Nfs*5) c.763delG 2019 31578364
1878 OMIA:002765-7957 goldfish Celestial eye lrp2a substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated 9 g.28575379C>T 2025 41226661
1877 OMIA:002765-7957 goldfish Telescope eye lrp2a insertion, gross (>20) frameshift Naturally occurring variant Not currently evaluated ASM336829v1 9 13-kBP insertion in intron 45 due to insertion of foamy-like endogenous retrovirus resulting in premature stop codon  2020 32392470
1876 OMIA:002765-7957 goldfish Telescope eye lrp2a substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ASM336829v1 9 NC_039251.1:g.7990395C>A XM_026271200.1:c.13549G>T XP_026126985.1:p.(G4517*) published as p.G4480* 2020 32392470
1875 OMIA:002765-7957 goldfish Telescope eye lrp2a substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ASM336829v1 9 NC_039251.1:g.8006317G>T XM_026271200.1:c.10386C>A XP_026126985.1:p.(Y3462*) published as p.(Y3425*) 2020 32392470
627 OMIA:000963-9913 taurine cattle Holstein Friesian (Cattle) Syndactyly (mule foot) LRP4 delins, small (<=20) delins (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.2 15 g.76800972_76800973delinsAT c.4863_4864delinsAT p.(N1621_G1622delinsKC) Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4 2006 16859890
378 OMIA:000963-9913 taurine cattle Angus (Cattle) Syndactyly (mule foot) LRP4 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 15 NC_037342.1:g.76792588C>T NM_001077843.1:c.5385+1G>A "a G to A transition at the first nucleotide in the splice donor site of intron 37" rs5334475003 2006 16963222 Variant information was initially kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4
769 OMIA:000963-9913 taurine cattle Simmental (Cattle) Syndactyly (mule foot) LRP4 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 15 NC_037342.1:g.76807508C>T NM_001077843.1:c.3595G>A NP_001071311.1:p.(G1199S) rs3423411024 2007 17319939 Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4
768 OMIA:000963-9913 taurine cattle Simmental Charolais Cross Syndactyly (mule foot) LRP4 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 15 NC_037342.1:g.76812187C>T NM_001077843.1:c.2719G>A NP_001071311.1:p.(G907R) rs5334474664 2007 17319939 Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4
1844 OMIA:000963-9913 taurine cattle Holstein Friesian (Cattle) Syndactyly (mule foot) LRP4 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 15 NC_037342.1:g.76819481G>A NM_001077843.1:c.1480C>T NP_001071311.1:p.(R494C) rs380401761 2025 40999323
1882 OMIA:000963-9913 taurine cattle Limousin (Cattle) Syndactyly, syndromic LRP4 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 15 NC_037342.1:g.76826546C>A NM_001077843.1:c.170G>T NP_001071311.1:p.(C57F) 2026 41854179
610 OMIA:002017-9685 domestic cat Siamese (Cat) Glaucoma 3, primary congenita LTBP2 duplication frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B3 NC_058373.1:g.119460393_119460396dup XM_023255858.2:1431_1434dup XP_023111626.2:p.(A479Gfs) published as "a 4-bp insertion in exon 8 located at chrB3: 120995236"[felCat5], previous listed as c.1449_1452dup, p.(A485Gfs) - updated to recent transcript [12/07/2025] 2016 27149523 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1394 OMIA:002485-9685 domestic cat British Shorthair (Cat) Skeletal dysplasia, LTBP3-related LTBP3 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 D1 NC_058377.1:g.108455125del XM_023240055.2:c.158del XP_023095823.2:p.(G53Afs*16) genomic coordinates updated to reflect HGVS 3'-rule [12/07/2025] 2021 34946872 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
605 OMIA:001721-32536 cheetah Coat colour, king LVRN insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated p.(N977Kfs*110) 2012 22997338
307 OMIA:001429-9685 domestic cat Blotched tabby LVRN Ta^b2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A1 NC_058368.1:g.94477275C>A XM_045057766.1:c.176C>A XP_044913701.1:p.(S59*) 2012 22997338 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1429 OMIA:001429-9685 domestic cat Tabby, atypical swirl LVRN Ta^as substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A1 NC_058368.1:g.94477515A>C XM_045057763.1: c.416A>C XP_044913698.1:p.(T139N) associated with an atypical swirled pattern but is incompletely penetrant. F.catus_Fca126_mat1.0 reference sequence represents the C allele / p.(N139T) 2012 22997338 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
124 OMIA:001429-9685 domestic cat Blotched tabby LVRN Ta^b1 substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A1 NC_058368.1:g.94477781G>A XM_045057766.1:c.682G>A XP_044913701.1:p.(D228N) 2012 22997338 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
308 OMIA:001429-9685 domestic cat Blotched tabby LVRN Ta^b3 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A1 NC_058368.1:g.94536796G>A XM_045057763.1:c.2522G>A XP_044913698.1:p.(W841*) Felis_catus_9.0 represents the A allele 2012 22997338 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1348 OMIA:002431-9694 tiger Pseudomelamism LVRN substitution missense Naturally occurring variant Not currently evaluated PanTig1.0 A1 c.1360C>T p.H454Y Sagar et al. (2021): "[Assembly PanTig1.0(GCF_000464555.1)]. . . . (Taqpep c.1360C > T); XP_007086933.1) of the protein (Taqpep p.H454Y)" 2021 34518374
518 OMIA:000185-452646 American mink Chediak-Higashi syndrome LYST deletion, small (<=20) Naturally occurring variant Not currently evaluated c.9468delC 2013 22762706
1359 OMIA:002449-94885 corn snake Skin colour, lavender LYST substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.9508C>T p.(Q3169*) 2020 33020272
183 OMIA:000185-9913 taurine cattle Japanese Black, Japan (Cattle) Chediak-Higashi syndrome LYST substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 28 NC_037355.1:g.8464077T>C NM_174020.2:c.6044A>G NP_776445.1:p.(H2015R) rs481318527 1999 10594238 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1147 OMIA:000185-9685 domestic cat Persian (Cat) Chediak-Higashi disease LYST repeat variation Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 D2 NC_058378.1:g.13064245_13083649dup NM_001290242.1:c.8347-2422_9548+1749dup a tandem segmental duplication encompassing exons 30 through to 38  2020 31919397 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
249 OMIA:000625-10141 domestic guinea pig Mannosidosis, alpha Man2b1 substitution missense Naturally occurring variant Not currently evaluated c.679C>T p.(R227W) 2002 11959458
199 OMIA:000625-9913 taurine cattle Galloway (Cattle) Mannosidosis, alpha MAN2B1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 7 NC_037334.1:g.12840983G>A NM_174561.2:c.662G>A NP_776986.2:p.(R221H) rs5334474945 1997 9208932 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
198 OMIA:000625-9913 taurine cattle Angus (Cattle) Brangus (Cattle) Murray Grey (Cattle) Red Angus (Cattle) Mannosidosis, alpha MAN2B1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 7 NC_037334.1:g.12842292T>C NM_174561.2:c.961T>C NP_776986.2:p.(F321L) rs5334474873 1997 9208932 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1628 OMIA:000625-9615 dog Doberman Pinscher (Dog) Mannosidosis, alpha MAN2B1 substitution missense Naturally occurring variant Not currently evaluated Dog10K_Boxer_Tasha 20 NC_006602.4:g.49320989A>G XM_005632833.4:c.311A>G XP_005632890.1:p.(D104G) XM_005632833.4; XP_005632890.1 2023 37761886
499 OMIA:000625-9685 domestic cat Persian (Cat) Mannosidosis, alpha MAN2B1 deletion, small (<=20) frameshift Naturally occurring variant P F.catus_Fca126_mat1.0 A2 NC_058369.1:g.8955977_8955980del NM_001009222.1:c.1749_1752del NP_001009222.1:p.(Q584Afs) 1997 9396732 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
297 OMIA:000626-9913 taurine cattle Salers (Cattle) Mannosidosis, beta MANBA substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 6 NC_037333.1:g.22188765G>A NM_174387.2:c.2574G>A NP_776812.1:p.(W858*) rs5334475094 1999 10594236 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
451 OMIA:000626-9925 goat Mannosidosis, beta MANBA deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS1.2 6 NC_030813.1:g.22409150del NM_001285691.1:c.1398del NP_001272620.1:p.(W466fs) rs5334475113 1996 8921369 The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries
1093 OMIA:000626-9615 dog Mixed Breed (Dog) Beta mannosidosis MANBA duplication Naturally occurring variant Not currently evaluated CanFam3.1 32 g.24057654_24057658dup c.2377_2381dup p.(H794Hfs) XM_005639236.3; XP_005639293.1; published as c.2377_2381dupTATCA 2019 31439511 Genomic and protein coordinates in CanFam3.1 provided by Robert Kuhn
1072 OMIA:000626-9615 dog German Shepherd Dog (Dog) Beta mannosidosis MANBA substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 32 NC_006614.3:g.24147500A>T XM_005639236.3:c.560T>A XP_005639293.1:p.(I187N) 2019 30983534
1636 OMIA:000626-9685 domestic cat Domestic Shorthair (Cat) Mannosidosis, beta MANBA substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.119398498G>A XM_023252901.2:c.2509G>A XP_023108669.2:p.(G837R) variant was reported in a single affected cat, previously listed as c.2506G>A, p.(G836R) - updated to recent transcript information [11/07/2025]  2024 37913889 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1473 OMIA:002381-9913 taurine cattle Romagnola (Cattle) Skeletal-cardio-enteric dysplasia MAP2K2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 7 NC_037334.1:g.19923991C>T NM_001038071.2:c.535G>A NP_001033160.2:p.(R179W) NM_001038071.2; NP_001033160.2; possible de-novo causal variant 2021 34209498
943 OMIA:001432-9615 dog Dachshund, Miniature Long-Haired (Dog) Cone-rod dystrophy 4 MAP9 deletion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 15 g.52905336_52927296del c.75+181_1378-215del XM_005629374.1; An approximately 22kb deletion "approximately 30 Mb upstream of RPGRIP1 . . . The deletion breakpoints were identified in MAP9 intron 10 and in a downstream partial MAP9 pseudogene." … " The size of the deletion based on genome build CanFam3.1 MAP9_corrected is 21,961 bp, with deletion breakpoints in intron 10 of MAP9 and MAP9." See PMID:38752391 for additional breed information. 2016 27017229
1416 OMIA:002517-9913 taurine cattle Brown Swiss (Cattle) Original Swiss Brown (Cattle) Haplotype with homozygous deficiency BH6 MARS2 BH6 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.86191230G>A NM_001098971.1:c.1553G>A NP_001092441.1:p.(R518Q) NM_001098971.1 rs434672528 2021 34915862
1646 OMIA:002804-9544 Rhesus monkey Germline mutation rate MBD4 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated MMul10 2 g.147059371del c.984del p.(I330Sfs*2) ENSMMUG00000012723 2023 37984997
413 OMIA:002021-9796 domestic horse Quarter Horse (Horse) Warmblood (Horse) Coat colour, brindle 1 MBTPS2 substitution splicing Naturally occurring variant Not currently evaluated EquCab3.0 X NC_009175.3:g.17286855T>C XM_023634090.1:c.1340+4T>C Published as c.1437+4T>C - updated in this table to reflect XM_023634090.1 transcript coordinates rs3434246715 2016 27449517 Breed information updated based on PMID: 38600096
1007 OMIA:001199-10141 domestic guinea pig Brown coat colour MC1R e (MC1R*4) deletion, gross (>20) Naturally occurring variant Not currently evaluated Vidal (2018): "a deletion of 2760 bp, including the entire MC1R coding region" 2018 30101449
674 OMIA:001199-30640 gray squirrel Melanism (black) MC1R E^B deletion, gross (>20) Naturally occurring variant Not currently evaluated MC1RΔ24 allele E^B ["at amino acid positions 87-94"] 2009 19643815
250 OMIA:001199-46844 Geoffroy's cat Melanism (black coat) MC1R substitution missense Naturally occurring variant Not currently evaluated p.(C125R) 2015 25695801
1328 OMIA:000374-495946 Eleonora's falcon Feather colour, extended black MC1R deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated p.(M114_V117del) 2011 21696477
1100 OMIA:000374-57662 red-footed booby White plumage MC1R haplotype Naturally occurring variant Not currently evaluated p.(M85V) + p.(R207H) 2007 17602182
1173 OMIA:001199-37349 woolly mammoth Light hair colour MC1R not known missense Naturally occurring variant Not currently evaluated p.(R67C) 2006 16825562
1101 OMIA:000374-70340 Lesser snow goose Blue plumage MC1R not known missense Naturally occurring variant Not currently evaluated p.(V85M) 2004 15031505
262 OMIA:001199-494514 Arctic fox Blue coat colour MC1R Ed haplotype missense Naturally occurring variant Not currently evaluated p.[(G5C);(F280C)] The blue (Ed) allele is a haplotype comprising two missense variants (p.Gly5Cys and p.Phe280Cys) (Våge et al., 2005) 2005 15982782
1271 OMIA:001199-30532 fallow deer Coat colour, white MC1R substitution missense Naturally occurring variant Not currently evaluated c.143T>C p.(L48P) 2020 33213385
1765 OMIA:002770-51751 ball python Skin colour, Clown colour morph MC1R substitution missense Naturally occurring variant Not currently evaluated 3 c.149G>A p.(S50N) 2025 39609249
180 OMIA:001199-9870 reindeer Coat colour, extension MC1R substitution missense Naturally occurring variant Not currently evaluated c.218T>C p.(M73T) 2014 25039753
1002 OMIA:002156-46218 Chinese painted quail Feather colour, Blue Face MC1R substitution missense Naturally occurring variant Not currently evaluated c.271G>A p.(E92K) 2018 29974967
448 OMIA:001199-9986 rabbit California (Rabbit) Champagne-Silberkaninchen, Germany (Rabbit) Checkered Giant Checkered Small Dutch (Rabbit) New Zealand White (Rabbit) White Giant (Rabbit) Dominant black or Steel MC1R E(D) or E(S) deletion, small (<=20) Naturally occurring variant Not currently evaluated c.280_285del 2006 16978179
630 OMIA:001199-9986 rabbit Coloured dwarf Dutch (Rabbit) English Lop English Spot (Rabbit) Fauve de Borgogne (Rabbit) Lop Lop dwarf New Zealand Red (Rabbit) Saxon Gold Thüringer (Rabbit) Red/fawn/yellow MC1R e deletion, gross (>20) Naturally occurring variant Not currently evaluated c.304_333del30 2006 16978179
18 OMIA:001494-9103 turkey Feather colour, dominant black MC1R substitution missense Naturally occurring variant Not currently evaluated c.364A>T p.(I122F) 2010 20634512
1329 OMIA:000374-120794 gyrfalcon Feather colour, extended black MC1R substitution missense Naturally occurring variant Not currently evaluated c.376A>G p.(I126V) 2012 22497627
1733 OMIA:001199-30532 fallow deer Coat colour, menil MC1R substitution missense Naturally occurring variant Not currently evaluated c.714G>A p.(G236D) 2024 39202415
1006 OMIA:001199-10141 domestic guinea pig Brown coat colour MC1R e (MC1R*2) substitution missense Naturally occurring variant Not currently evaluated c.749T>C p.(L250Q) 2018 30101449
181 OMIA:001199-9870 reindeer Coat colour, extension MC1R substitution missense Naturally occurring variant Not currently evaluated c.839T>G p.(F280C) 2014 25039753
1003 OMIA:002155-46218 Chinese painted quail Feather colour, Red Breasted MC1R substitution missense Naturally occurring variant Not currently evaluated c.872C>T p.(P292L) 2018 29974967
1346 OMIA:001199-37190 antarctic fur seal Hypopigmentation (blond) MC1R substitution missense Naturally occurring variant Not currently evaluated c.872C>T p.(S291F) 2016 27547348
19 OMIA:001494-9103 turkey Feather colour, black-wing bronze MC1R substitution missense Naturally occurring variant Not currently evaluated c.887C>T p.(A296V) 2010 20634512
1009 OMIA:001199-9838 Arabian camel White coat colour MC1R substitution missense Naturally occurring variant Not currently evaluated c.901C>T p.(R301C) KU179867; c.901C>T; p.R301C 2018 29893870
328 OMIA:001494-9103 turkey Bronze feathers MC1R substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.96G>A 2010 20634512
256 OMIA:001435-93934 Japanese quail Feather colour, extended brown MC1R substitution missense Naturally occurring variant Not currently evaluated c.?G>A p.(E92K) 2006 16734695
1160 OMIA:001199-9986 rabbit Angora (Rabbit) Checkered Giant Dutch (Rabbit) Giant Grey Japanese (Rabbit) Rheinische Schecken (Rabbit) Japanese brindling MC1R eJ haplotype Naturally occurring variant Not currently evaluated c.[124G>A;125_130del6] "6 bp-in frame deletion flanked by a G > A transition in 5' (c.[124G>A;125_130del6]) that was present in all animals with Japanese brindling coat colour and pattern." (Fontanesi et al., 2010) 2010 20594318
1848 OMIA:001199-37699 marsupial mole Coat colour, wildtype MC1R nonsense (stop-gain) Naturally occurring variant Not currently evaluated reference sequence the normal cream coat colour of marsupial moles is likley due to an MC1R in-frame stop codon at position 160  2025 41119986
1509 OMIA:001199-9913 taurine cattle Abondance (Cattle) Brown Swiss (Cattle) Evolèner, Switzerland (Cattle) Herens (Cattle) Holstein Friesian (Cattle) Itäsuomenkarja, Finland (Cattle) Original Swiss Brown (Cattle) Rotes Höhenvieh, Germany (Cattle) Simmental (Cattle) Recessive red MC1R e^v2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 18 NC_037345.1:g.14705638G>A NM_174108.2:c.263G>A NP_776533.1:p.(S88N) NM_174108; NP_776533 rs5412784355 2022 35451516
185 OMIA:001199-9913 taurine cattle Angus (Cattle) Holstein Friesian (Cattle) Icelandic Cattle (Cattle) Dominant black MC1R E^D substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 18 NC_037345.1:g.14705671T>C NM_174108.2:c.296T>C NP_776533.1:p.(L99P) NM_174108; NP_776533 rs109688013 1995 8535072 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1167 OMIA:001544-9913 taurine cattle Rat-tail syndrome MC1R E^D substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 18 NC_037345.1:g.14705671T>C NM_174108.2:c.296T>C NP_776533.1:p.(L99P) rs109688013 2016 27037038
485 OMIA:001199-9913 taurine cattle Angus (Cattle) Fries Roodbont, Netherlands (Cattle) Simmental (Cattle) Recessive red MC1R e deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 18 NC_037345.1:g.14705685del NM_174108.2:c.310del NP_776533.1:p.(G104Vfs*53) NM_174108; NP_776533 rs110710422 1995 8535072 Variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1508 OMIA:001199-9913 taurine cattle Angus (Cattle) Brown Swiss (Cattle) Evolèner, Switzerland (Cattle) Herens (Cattle) Holstein Friesian (Cattle) Limousin (Cattle) Normande (Cattle) Original Swiss Brown (Cattle) Witrood Ras van Belgie, Belgium (Cattle) recessive red MC1R e^v1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 18 NC_037345.1:g.14705799C>T NM_174108.2:c.424C>T NP_776533.1:p.(R142C) NM_174108; NP_776533 rs3423445958 2022 35451516
1332 OMIA:001199-9925 goat Murcia-Granada (Goat) Black coat colour MC1R substitution missense Naturally occurring variant Not currently evaluated ARS1.2 18 NC_030825.1:g.16105786C>G XM_018063150.1:c.801C>G XP_017918639.1:p.(C267W) rs669694251 2009 19706191
996 OMIA:001199-9793 ass (donkey) Âne de Provence, France (Ass) Âne des Pyrénées, France (Ass) Âne normand, France (Ass) Miniature, United States of America (Ass) Coat colour, red MC1R e substitution missense Naturally occurring variant Not currently evaluated ASM1607732v2 28 NC_052204.1:g.63570188T>C XM_014836533.2:c.629T>C XP_014692019.1:p.(M210T) 2014 25155046
997 OMIA:001199-9615 dog Alaskan Husky (Dog) Siberian Husky (Dog) White coat colour MC1R e^3 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 5 g.63694433_63694434del c.816_817del p.(I272Mfs*22) NM_001014282.2; NP_001014304.2; published as c.816_817delCT 2018 29932470 Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn.
34 OMIA:001590-9615 dog Belgian Shepherd Dog, Malinois (Dog) Huntaway (Dog) Leonberger (Dog) New Zealand Heading Dog (Dog) Black melanistic mask MC1R E^M substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 5 g.63694460C>T c.790A>G p.(M264V) Additional breeds based on PMID:40965331 rs24201590 2003 12692165 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. Correction to genomic details provided by Professor Claire Wade.
343 OMIA:001199-9615 dog Huntaway (Dog) Irish Setter (Dog) Labrador Retriever (Dog) New Zealand Heading Dog (Dog) Red/yellow coat MC1R e^1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 5 NC_006587.3:g.63694334G>A NM_001014282.2:c.916C>T NP_001014304.2:p.(R306*) NM_001014282.2; NP_001014304.2; ROS_Cfam_1.0:g.63922309A>G, additional breeds based on PMID:40965331 rs851563576 2000 10602988 Genomic location provided by Professor Claire Wade
1645 OMIA:001199-9615 dog Alaskan Klee Kai (Dog) Alaskan Malamute (Dog) Basenji (Dog) Basset Fauve de Bretagne (Dog) Beagle (Dog) Chesapeake Bay Retriever (Dog) Chihuahua (Dog) Chinese Crested (Dog) Chinook (Dog) English Foxhound (Dog) Finnish Hound (Dog) Finnish Lapphund (Dog) Finnish Spitz (Dog) Karelian Bear Dog (Dog) Lapponian Herder (Dog) Peruvian Hairless Dog (Dog) Phalène (Dog) Plott Hound (Dog) Saarloos Wolfhond (Dog) Siberian Husky (Dog) Tamaskan Dog (Dog) Coat colour, reduced expression of eumelanin MC1R e^A substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 5 NC_006587.3:g.63694349G>A NM_001014282.2:c.901C>T NP_001014304.2:p.(R301C) NM_001014282.2; NP_001014304.2; variant was initially identified in ancient canids and later reported in additional breeds PMID:33292722 2013 24098367
1681 OMIA:001199-9615 dog English Cocker Spaniel (Dog) Coat colour, sable MC1R e^H substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 5 NC_006587.3:g.63695000C>T NM_001014282.2:c.250G>A NP_001014304.2:p.(D84N) NM_001014282.2; NP_001014304.2; NC_006587.3 2024 38282569
32 OMIA:001495-9615 dog Afghan Hound (Dog) Saluki (Dog) Grizzle MC1R E^G substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 5 NC_006587.3:g.63695017C>A NM_001014282.2:c.233G>T NP_001014304.2:p.(G78V) NM_001014282.2; NP_001014304.2 2010 20525767 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
998 OMIA:001199-9615 dog Australian Cattle Dog (Dog) Cream coat colour MC1R e^2 substitution regulatory Naturally occurring variant Not currently evaluated CanFam3.1 5 NC_006587.3:g.63695679C>G NM_001014282.1:c.-432G>C NM_001014282.1 2018 29932470
154 OMIA:001199-9796 domestic horse American Trotter (Horse) Arab (Horse) Belgian Draft (Horse) Clydesdale (Horse) Freiberger (Horse) Icelandic Horse (Horse) Morgan (Horse) Quarter Horse (Horse) Shetland Pony (Horse) Thoroughbred (Horse) Warmblood (Horse) Welsh Pony (Horse) Coat colour, chesnut MC1R e substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 3 NC_009146.3:g.36979560C>T NM_001114534.1:c.248C>T NP_001108006.1:p.(S83F) rs68458866 1996 8995760 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. Breed information updated based on PMID: 38600096
155 OMIA:001199-9796 domestic horse Belgian Draft (Horse) Coat colour, chesnut MC1R e^a substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 3 NC_009146.3:g.36979562G>A NM_001114534.1:c.250G>A NP_001108006.1:p.(D84N) rs3443929753 2000 11086549 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. Breed information updated based on PMID: 38600096
123 OMIA:001199-9685 domestic cat Norwegian Forest Cat (Cat) Coat colour, amber MC1R e substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 E2 NC_058382.1:g.61570294G>A NM_001009324.1:c.250G>A NP_001009324.1:p.(D84N) rs5334475156 2009 19422360 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
561 OMIA:001199-9685 domestic cat Burmese (Cat) Coat colour, russet MC1R e^r deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 E2 NC_058382.1:g.61570484_61570486del NM_001009324.1:c.440_442del NP_001009324.1:p.(F147del) published as c.439_441del and p.(F146del); coordinates in the table have been updated to a recent reference genome and / or transcript. 2017 27671997 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1090 OMIA:001199-9685 domestic cat Kurilian Bobtail (Cat) Coat colour, copal MC1R e^c deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 E2 NC_058382.1:g.61570684_61570713del NM_001009324.1:c.640_669del NP_001009324.1:p.(A214_R223del) 2019 31361350 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
817 OMIA:000374-9031 chicken Feather colour, extended black MC1R substitution regulatory Naturally occurring variant Not currently evaluated GRCg6a 11 g.18840609C>T c.-37C>T 5 prime UTR variant rs733919322 2017 28699279 ENSGALT00000096195.1:c.-37C>T
818 OMIA:000374-9031 chicken Feather colour, extended black MC1R E substitution missense Naturally occurring variant Not currently evaluated GRCg6a 11 g.18840857T>C c.212T>C p.(M71T) ENSGALT00000096195.1:c.212T>C ENSGALP00000071620.1:p.Met71Thr rs312264213 2017 28699279
6 OMIA:000374-9031 chicken Feather colour, extended black MC1R E substitution missense Naturally occurring variant Not currently evaluated GRCg6a 11 g.18840919G>A c.274G>A p.(E92K) ENSGALT00000096195.1:c.274G>A ENSGALP00000071620.1:p.Glu92Lys rs314881228 2003 12873211
1306 OMIA:002108-9031 chicken Fayoumi (Chicken) Barring, autosomal MC1R E*R(Fay), Pg substitution missense Naturally occurring variant Not currently evaluated GRCg6a 11 g.18841043T>A c.398T>A p.(L133Q) rs737523889 2021 33793042
7 OMIA:000374-9031 chicken Feather colour, buttercup MC1R substitution missense Naturally occurring variant Not currently evaluated GRCg6a 11 g.18841289A>C c.644A>C p.(H215P) ENSGALT00000096195.1:c.644A>C ENSGALP00000071620.1:p.His215Pro rs735789743 2003 12873211
1142 OMIA:000374-9031 chicken Mie-Jidori, Japan (Chicken) Feather colour, wheaten-like MC1R e^m substitution missense Naturally occurring variant Not currently evaluated GRCg6a 11 g.18841289A>C c.644A>C p.(H215P) ENSGALT00000096195.1:c.644A>C ENSGALP00000071620.1:p.His215Pro rs735789743 2020 31977074
1896 OMIA:001199-36239 least weasel Coat colour, winter-brown MC1R delins, small (<=20) missense Naturally occurring variant Not currently evaluated mMusNiv2.hap1.1 scaffold 337 c.301_302delinsAA p.(L101K) 2026 41957296
1110 OMIA:001199-9940 sheep Valle del Belice, Italy (Sheep) Recessive pheomelanism MC1R e substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 14 NC_040265.1:g.15487353C>T NM_001282528.1:c.199C>T NP_001269457.1:p.(R67C) 2010 Reference not in PubMed; see OMIA 001199-9940 for reference details The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
229 OMIA:001199-9940 sheep Corriedale (Sheep) Dala (Sheep) Damara (Sheep) Merino (Sheep) Dominant black MC1R E^D substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 14 NC_040265.1:g.15487372T>A NM_001282528.1:c.218T>A NP_001269457.1:p.(M73K) 1999 9892731 c.218T>A obtained from Fontanesi et al. (2010); breeds obtained from Rochus et al. (2019); the genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
228 OMIA:001199-9940 sheep Massese, Italy (Sheep) Dominant black MC1R E^D substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 14 NC_040265.1:g.15487515G>A NM_001282528.1:c.361G>A NP_001269457.1:p.(D121N) 1999 9892731 c.361G>A obtained from Fontanesi et al. (2010); breed obtained from Ruchus et al. (2019); the genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1108 OMIA:001199-9940 sheep Gute (Sheep) Swedish Fur (Sheep) Värmlandsfår, Sweden (Sheep) Dominant black MC1R substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 14 NC_040265.1:g.15487606G>A NM_001282528.1:c.452G>A NP_001269457.1:p.(R151Q) 2019 31475378 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
170 OMIA:001199-9823 pig Duroc (Pig) Red MC1R e substitution missense Naturally occurring variant Not currently evaluated Sscrofa11.1 6 NC_010448.4:g.181461C>T NM_001008690.1:c.727G>A NP_001008690.1:p.(A243T) Variant is called p.(A240T) in original paper (Kijas et al., 1998). Two substitutions were found in recessive red (e/e) animals p.(A161V) and p.(A240T) - the p.(A240T) was considered as causative (Kijas et al., 1998).  The Sscrofa11.1 reference genome is from a recessive red animal. rs321432333 1998 9799269
171 OMIA:001199-9823 pig Duroc (Pig) Red MC1R e substitution missense Naturally occurring variant Not currently evaluated Sscrofa11.1 6 NC_010448.4:g.181697G>A NM_001008690.1:c.491C>T NP_001008690.1:p.(A164V) Variant is called p.(A161V) in original paper (Kijas et al., 1998). Two substitutions were found in recessive red (e/e) animals p.(A161V) and p.(A240T) - the p.(A240T) was considered as causative (Kijas et al., 1998). The Sscrofa11.1 reference genome is from a recessive red animal. rs45435032 1998 9799269
169 OMIA:001199-9823 pig Hampshire Down (Sheep) Dominant black MC1R E^D2 substitution missense Naturally occurring variant Not currently evaluated Sscrofa11.1 6 NC_010448.4:g.181818C>T NM_001008690.1:c.370G>A NP_001008690.1:p.(D124N) Variant is called p.(D121N) in original paper (Kijas et al., 1998). cDNA and protein location in this table are based on transcript ENSSSCT00000022534.2. rs326921593 1998 27703696 9799269
168 OMIA:001199-9823 pig Large Black (Pig) Meishan (Pig) Dominant black MC1R E^D1 substitution missense Naturally occurring variant Not currently evaluated Sscrofa11.1 6 NC_010448.4:g.181883A>G NM_001008690.1:c.305T>C NP_001008690.1:p.(L102P) Variant is called p.(L99P) in original paper (Kijas et al., 1998). Two silent (p.(A240A), p.(N118N)) and two missense substitutions p.(V92M) and p.(L99P) were found in dominant black Asian pigs (E^D1/E^D1) (Kijas et al., 1998). cDNA and protein location in this table are based on transcript ENSSSCT00000022534.2. rs45434630 1998 9799269
1290 OMIA:001199-9823 pig Large Black (Pig) Meishan (Pig) Dominant black MC1R E^D1 substitution missense Naturally occurring variant Not currently evaluated Sscrofa11.1 6 NC_010448.4:g.181905C>T NM_001008690.1:c.283G>A NP_001008690.1:p.(V95M) Variant is called p.(V92M) in original paper (Kijas et al., 1998). Two silent (p.(A240A), p.(N118N)) and two missense substitutions p.(V92M) and p.(L99P) were found in dominant black Asian pigs (E^D1/E^D1) (Kijas et al., 1998). cDNA and protein location in this table are based on transcript ENSSSCT00000022534.2. rs45434629 1998 9799269
597 OMIA:001199-9823 pig Bama Xiang Zhu, China (Pig) Pietrain (Pig) Coat colour, black spotting on red or white background MC1R E^P, E^qy insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Sscrofa11.1 6 NC_010448.4:g.182126_182127insGG NM_001008690.1:c.67_68insCC NP_001008690.1:p.(R23Pfs*33) Variant was published as nt67insCC (Kijas et al., 2001), g.462-463CC (Wu et al., 2017), c.67_68insCC (Jia et al. 2017) rs1111798655 2001 28002929 28411032 11404341
1741 OMIA:000374-56313 barn owl Feather colour, rufous MC1R R substitution missense Naturally occurring variant Not currently evaluated T.alba_DEE_v4.0 Super-scaffold 26 NW_024881300.1:g.22522039G>A c.376G>A p.(V126I) valine allele is associated with whiter plumage colorations, whereas the isoleucine allele is associated to redder plumage (rufous) coloration  2015 25857339 Genomic coordinates as reported by Cumer et al. 2024 (PMID:38196365)
115 OMIA:001199-9627 red fox Coat colour, extension MC1R E^A substitution missense Naturally occurring variant Not currently evaluated VulVul2.2 NW_020356486.1 g.6101019T>C c.373T>C p.(C125R) XM_026005028.1; XP_025860813.1 1997 9054949
1603 OMIA:002750-9615 dog reduced hair shedding MC5R substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 1 NC_049222.1:g.24541931C>T XM_038525579.1:c.709G>A XP_038381507.1:p.(A237T) XM_038525579.1; XP_038381507.1; the variant is reported to be associated with reduced hair shedding and shorter hair length and may not be causal 2016 26795439
1900 OMIA:000128-9031 chicken Blood group H MCAM H2 substitution missense Naturally occurring variant Not currently evaluated GRCg6a 24 NC_006111.5:g.4246215G>A NM_001004768.1:c.144G>A NP_001004768.1:p.(V482I) rs739155076 2026 42074531
1437 OMIA:002716-9615 dog German Shepherd Dog (Dog) Congenital idiopathic megaesophagus, risk factor MCHR2 repeat variation Naturally occurring variant Not currently evaluated CanFam3.1 12 Bell et al. (2022): "Within the first intron of MCHR2, we identified a 33 bp variable number tandem repeat (VNTR) containing a consensus binding sequence for the T-box family of transcription factors. Across dogs and wolves, the major allele includes two copies of the repeat, whereas the predominant alleles in GSDs have one or three copies. The single-copy allele is strongly associated with CIM (P-val = 1.32x10-17), with homozygosity for this allele posing the most significant risk". 2022 35271580
1658 OMIA:002814-9615 dog Eurasier (Dog) Polioencephalopathy MECR substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 2 NC_049223.1:g.70793040A>G XM_038531348.1:c.823A>G XP_038387276.1:p.(M275V) XM_038531348.1; XP_038387276.1, variant reported in 3 affected dogs 2024 38041431
558 OMIA:002043-9913 taurine cattle Belgian Blue (Cattle) Abortion (embryonic lethality), MED22-related MED22 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated 11 p.(L38Rfs*25) 2016 27646536
819 OMIA:001932-9615 dog Swedish Vallhund (Dog) Progressive retinal atrophy, MERTK-related MERTK insertion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 17 An insertion of "a full-length [6.401 kb] LINE-1 element comprising the 15 bp target site duplication [indicated by 'ins' in the g. notation], a 5’UTR, 900 bp 5’ ORF1, a 49 bp intergenic spacer, a 3,828 bp 3’ ORF2, a 3’UTR and poly(A) tail. The LINE-1 element has been inserted in the same orientation as the MERTK gene.". 200922: g. info has been moved to here (g.36338043-36338057ins) until it can be standardised 2017 28813472 Genomic location provided by Sally Ricketts
1912 OMIA:003064-9796 domestic horse Friesian (Horse) Embryonic lethality, MET-related MET deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated EquCab3.0 4 NC_009147.3:g.74041982_74041995del XM_014739000.3:c.1559_1572del XP_014594486.1:p.(P392Lfs*3) 2026 41808016
1489 OMIA:002551-9615 dog Bull Mastiff (Dog) Mitochondrial fission encephalopathy MFF delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 25 g.40322999_40323003delinsCGCTCT c.471_475delinsCGCTCT p.(E158Afs*14) XM_038574000.1; XP_038429928.1 2022 36085405
374 OMIA:001106-9913 taurine cattle Blanco Orejinegro, Colombia (Cattle) Tiroler Grauvieh (Cattle) Axonopathy MFN2 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 16 NC_037343.1:g.41686003G>A NM_001190270.1:c.2229C>T "This SNP is located within a putative exonic splice enhancer (ESE) and the variant allele leads to partial retention of the entire intron 19 and a premature stop codon in the aberrant MFN2 transcript". Variant initially identified in Tiroler Grauvieh and later reported in additional breeds: PMID:34779908 rs5334475057 2011 21526202 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
472 OMIA:002153-9615 dog Schnauzer-Beagle Cross (Dog) Neuroaxonal dystrophy MFN2 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated CanFam3.1 2 g.84289962_84289964del c.1617_1619del p.(E539del) NM_001284441.1; NP_001271370.1; published as c.1617_1619delGGA; genomic position considers 3' rule of the HGVS 2011 21643798 Genomic position in CanFam3.1 provided by Robert Kuhn.
1426 OMIA:002197-9796 domestic horse Shetland Pony (Horse) Coat colour, dilution (mushroom) MFSD12 Mu duplication frameshift Naturally occurring variant Not currently evaluated EquCab3.0 7 NC_009150.3:g.2544518dup XM_023646425.1:c.600dup XP_023502193.1:p.(D201fs) XM_023646425.1; XP_023502193.1; published as NC_009150.3: g.2544512dup (XM_023646425.1:c.600dupC, p.Asp201fs); coordinates in the table have been updated to reflect HGVS nomenclature 2019 31635058
1081 OMIA:002197-9615 dog Afghan Hound (Dog) Akita (Dog) Alaskan Malamute (Dog) Bichon Frise (Dog) Coton de Tulear (Dog) German Shepherd Dog (Dog) Huntaway (Dog) Leonberger (Dog) New Zealand Heading Dog (Dog) Poodle (Dog) Pug (Dog) Puli (Dog) Saluki (Dog) Samoyed (Dog) Schnauzer (Dog) Scottish Terrier (Dog) West Highland White Terrier (Dog) White Swiss Shepherd Dog (Dog) Coat colour, white or cream MFSD12 substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 20 NC_049241.1:g.56252402C>T XM_038567816.1:c.151C>T XP_038423744.1:p.(R51C) Additional breeds based on PMID:40965331 rs22915955 2019 31117290 The cDNA coordinate kindly provided by Tosso Leeb [19/05/23] and genomic coordinates were corrected by Claire Wade [30/05/24] ; the previously linked EVA ID (rs22915955) was removed as incorrect [30/05/2024]
1637 OMIA:002371-9940 sheep Kerry Hill (Sheep) Microcephaly, MFSD2A-related MFSD2A duplication frameshift Naturally occurring variant Not currently evaluated ARS-UI_Ramb_v2.0 1 NC_056054.1:g.14577421dup XM_004001833.5:c.285dup XP_004001882.2:p.(D96Rfs*9) XM_004001833.5; XP_004001882.2 2024 37921236
1694 OMIA:001962-9986 rabbit Lionhead Dwarf Neuronal ceroid lipofuscinosis, 7 MFSD8 duplication frameshift Naturally occurring variant Not currently evaluated 15 NC_013683.1:g.103727963_103738667dup XM_002717263.3:c.202_701dup XP_002717309.2:p.(E235Lfs*23) 2024 38712841
551 OMIA:001962-9615 dog Chihuahua (Dog) Chinese Crested (Dog) Neuronal ceroid lipofuscinosis, 7 MFSD8 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 19 g.13010761del c.846del p.(F282Lfs*13) XM_014121438.2;XP_013976913.1; published as c.843delT; coordinates in the table have been updated to a recent reference genome and / or transcript 2015 25551667 Breed and p. information obtained from Katz et al. (2017) Neurobiol Dis. doi: 10.1016/j.nbd.2017.08.017; genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn.
1148 OMIA:001962-9685 domestic cat Domestic Shorthair (Cat) Neuronal ceroid lipofuscinosis, 7 MFSD8 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.96630789del XM_045055884.1:c.780del XP_044911819.1:p.(Q262Kfs*33) published as c.780delT 2020 31860737 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1754 OMIA:001962-9615 dog Basset Bleu de Gascogne (Dog) Small Swiss Hound (Dog) Neuronal ceroid lipofuscinosis, 7 MFSD8 duplication Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 19 NC_049240.1:g.13811543_13830361dup XM_038564680.1:c.202-519_1365dup 2024 39434657
1374 OMIA:002465-9615 dog Italian Cane Corso (Dog) Dental-skeletal-retinal anomaly MIA3 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated CanFam3.1 38 g.16920529_16920530del c.3822+3_3822+4del p.(V1238_K1274del) XM_005640835.3; XP_005640892.1; published as g.16920529_16920530delAT, leads to skipping of two exons: XM_005640835.3:r.3712_3822del 2021 34680893
644 OMIA:001565-9913 taurine cattle Ayrshire (Cattle) Abortion and stillbirth due to mutation in MIMT1 MIMT1 deletion, gross (>20) Naturally occurring variant Not currently evaluated 18 a 110 kb deletion in the MIMT1 gene 2010 21152099
1287 OMIA:002309-9646 giant panda Cataract MIP substitution missense Naturally occurring variant Not currently evaluated c.686G>A p.(S229N) 2021 33530927
385 OMIA:001401-10036 golden hamster Waardenburg syndrome, type 2A MITF substitution splicing Naturally occurring variant Not currently evaluated A T>A base substitution in intron 6 of MITF leads to the skipping of exon 7 and a premature termination. 2003 12871913
505 OMIA:000755-93934 Japanese quail Osteopetrosis MITF deletion, small (<=20) Naturally occurring variant Not currently evaluated same MITF variant as for silver, as reported in 1998 2001 11169846
503 OMIA:000915-93934 Japanese quail Feather colour, silver MITF deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated "a two-base deletion resulting in premature termination of the polypeptide in the region following the zipper region" = 2 bp deletion in exon 11 1998 9576828
678 OMIA:001931-9913 taurine cattle Holstein (black and white) (Cattle) Depigmentation associated with microphthalmia MITF deletion, gross (>20) Naturally occurring variant Not currently evaluated 22 a de novo deletion of a 19.1 Mb region of BTA22 from 28 835 247-47 983 179 2014 25199536
1727 OMIA:002679-8839 Mallard White Pekin (Duck (domestic)) Feather colour, white, MITF-related MITF insertion, gross (>20) Naturally occurring variant Not currently evaluated 13 intronic insertion of a 6634bp retrotransposon  2018 30018292
1378 OMIA:001401-9823 pig Bama Xiang Zhu, China (Pig) Waardenburg syndrome, type 2A MITF substitution missense Chemical mutagenesis (ENU) Not currently evaluated 13 c.740T>C p.(L247S) 2017 29094203
837 OMIA:001680-9913 taurine cattle Holstein (black and white) (Cattle) Glass-eyed albino MITF deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.2 22 g.31628127_31628129del p.(R211del) UMD3.1 position g.31746506_31746508del rs5334474965 2017 28904385 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1547 OMIA:001401-9913 taurine cattle Angus (Cattle) White coat colour MITF deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.2 22 g.31628133_31628135del c.668_670del p.(R224del) ENSBTAT00000080989.1; ENSBTAP00000059022.1; published as chr22.g.31628127_31628128del and delR217 - coordinates have been changed to HGVS nomenclature in this table 2023 37062854
189 OMIA:001680-9913 taurine cattle Fleckvieh-Simmental, Germany (Cattle) Dominant white with bilateral deafness MITF substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 22 NC_037349.1:g.31628131C>A NM_001001150.2:c.629G>T NP_001001150.1:p.(R210I) UMD3.1 position is g.31746502 rs5334474903 2011 22174915 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
424 OMIA:000214-9615 dog Coat colour, white spotting MITF delins, gross (>20) regulatory Naturally occurring variant Not currently evaluated CanFam3.1 20 g.21836232_21836427delinsN[198] This 198bp SINEC-Cf insertion is the first of three possible regulatory variants described by Karlsson et al. (2007). 2007 17906626 The genomic location was kindly provided by Professor Claire Wade in August 2018.
1023 OMIA:000214-9796 domestic horse American Paint (Horse) White spotting, blue eyes and deafness MITF SW5 deletion, gross (>20) Naturally occurring variant Not currently evaluated EquCab3.0 16 NC_009159.3:g.21503211_21566617del "~63-kb deletion spanning exons 6-9 of the MITF gene" 2019 30644113
1180 OMIA:000214-9796 domestic horse American Paint (Horse) Splashed white MITF SW6 deletion, gross (>20) Naturally occurring variant Not currently evaluated EquCab3.0 16 NC_009159.3:g.21551060_21559770del NC_009159.3:g.21551060-21559770del (Magdesian et al., 2020) 2020 32242630
1626 OMIA:000214-9796 domestic horse Thoroughbred (Horse) Splashed white MITF SW8 deletion, gross (>20) Naturally occurring variant Not currently evaluated EquCab3.0 16 NC_009159.3:g.21555811_21558139delinsAAAT 2023 37697831
166 OMIA:000214-9796 domestic horse American Trotter (Horse) White MITF MITF^244Glu substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 16 NC_009159.3:g.21556522C>T NM_001163874.1:c.1031G>A NP_001157346.1:p.(G344E) Published as XM_005600318.1:c.731G>A; XP_005600375.1:p.Gly244Glu) - updated in this table to reflect recent transcript ID rs3435075789 2017 27592871 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124
1606 OMIA:000214-9796 domestic horse Purebred Spanish (Horse) Splashed white MITF SW9 substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 16 NC_009159.3:g.21559940T>A NM_001163874.1:c.961A>T NP_001157346.1:p.(N321Y) NM_001163874.1; NP_001157346.1; published as c.993A>T, variant associated with increased depigmentation 2023 37406837
1488 OMIA:000214-9796 domestic horse American Paint (Horse) Quarter Horse (Horse) Splashed white MITF SW7 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated EquCab3.0 16 NC_009159.3:g.21559953_21559955del NM_001163874.1:c.949_951del NP_001157346.1:p.R317del NM_001163874.1; NP_001157346.1; published as c.949_951delTCT 2022 35672910
156 OMIA:000214-9796 domestic horse Freiberger (Horse) Macchiato MITF macchiato substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 16 NC_009159.3:g.21564980T>C NM_001163874.1:c.629A>G NP_001157346.1:p.(N310S) rs5334475186 2012 22511888 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 
793 OMIA:000214-9796 domestic horse Quarter Horse (Horse) Splashed white MITF SW3 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated EquCab3.0 16 NC_009159.3:g.21567245_21567249del NM_001163874.1:c.837_841del NP_001157346.1:p.(C280Sfs*20) NM_001163874.1; NP_001157346.1; published as c.837_841delGTGTC 2012 22511888
792 OMIA:000214-9796 domestic horse American Miniature Horse (Horse) American Paint (Horse) Appaloosa (Horse) Icelandic Horse (Horse) Morgan (Horse) Quarter Horse (Horse) Shetland Pony (Horse) Tori hobune, Estonia (Horse) Trakehner (Horse) Splashed white MITF SW1 delins, small (<=20) Naturally occurring variant Not currently evaluated EquCab3.0 16 NC_009159.3:g.21579201delinsATAATAACCTA g.20117302Tdelins11 rs5334475212 2012 22511888 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
806 OMIA:000214-9796 domestic horse American Trotter (Horse) Arab (Horse) Belgian Draft (Horse) Cavall Menorquí, Spain (Horse) Clydesdale (Horse) Freiberger (Horse) Icelandic Horse (Horse) Morgan (Horse) Quarter Horse (Horse) Shetland Pony (Horse) Thoroughbred (Horse) Warmblood (Horse) Welsh Pony (Horse) White splashing MITF substitution regulatory Naturally occurring variant Not currently evaluated EquCab3.0 16 NC_009159.3:g.21608936C>T Published as g.20147039C>T (EquCab2.0); may not be causal as the variant was identified to be a common variant across multiple breeds in a later study: PMID: 38600096 2017 28084638 Breed information updated based on PMID: 38600096
1205 OMIA:001680-452646 American mink Hedlund MITF h substitution splicing Naturally occurring variant Not currently evaluated MusPutFur1.0.86 c.33+1G>A GL896899.1:18635719 G/A (MITF-M C.33 + 1 G > A (Manakhov et al., 2017) 2019 30872653
849 OMIA:001401-9823 pig Rongchang, China (Pig) Waardenburg syndrome, type 2A MITF insertion, small (<=20) regulatory Naturally occurring variant Not currently evaluated Sscrofa11.1 13 NC_010455.5:g.51377987_51377988insTTTAGTTTAAAAAA a 14 bp insertion "in the non-regulatory region of the melanocyte-specific promoter of microphthalmia-associated transcription factor (MITF) gene generated a novel silencer" rs5334475179 2016 27349893
409 OMIA:000214-89462 water buffalo Swamp buffalo (Buffalo) White spotting MITF substitution splicing Naturally occurring variant Not currently evaluated UOA_WB_1 21 NC_037565.1:g.31613452A>T XM_025273060.1:c.1179+2T>A Published as c.840+2T>A, coordinates in the table have been updated to reflect a recent reference genome. 2015 26417640
341 OMIA:000214-89462 water buffalo Swamp buffalo (Buffalo) White spotting MITF substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated UOA_WB_1 21 NC_037565.1:g.31637770G>A XM_025273060.1:c.649C>T XP_025128845.1:p.(R217*) Published as  c.328C>T , p.(R110*), coordinates in the table have been updated to reflect a recent reference genome.

2015 26417640
976 OMIA:002146-9615 dog Bull Terrier (Dog) Miniature Bull Terrier (Dog) Lethal acrodermatitis MKLN1 substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 14 g.5731405T>G c.400+3A>C p.(G105Sfs*10) This variant is "located within the 5’-splice site of intron 4 of the MKLN1 gene" 2018 29565995
1209 OMIA:001654-8932 rock pigeon Almond MLANA st repeat variation Naturally occurring variant Not currently evaluated "The CNV captures a 77-kb segment of the reference genome (ScoHet5_227: 5,181,467–5,259,256), with an additional increase in coverage in a nested 25-kb segment (ScoHet5_227: 5,201,091–5,226,635). Read-depth analysis confirmed 7 copies of the outer 77-kb segment and 14 copies of the inner 25-kb segment in the genomes of female (ZStW) Almond pigeons, which have an St locus on only one chromosome. We used PCR to amplify across the outer and inner CNV breakpoints of Almond pigeons and determined that the CNV consists of tandem repeats of the 77-kb and nested 25-kb segments (Fig 3)." (Bruders et al., 2020) 2020 32433666
1014 OMIA:002145-9544 Rhesus monkey Colorectal cancer, MLH1-related MLH1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated 2 c.1029C<G p.(Y343*) Dray et al. (2018): "a de novo stop codon in the coding region of MLH1. This de novo stop codon occurs in exon 11 out of 19 in the MLH1 gene, and thus would produce a dramatically truncated and possibly non-functional protein". Ozirmak Lermi et al. (2022) reported the c. and p. coordinates of this variant. 2018 30108684
1013 OMIA:002145-9544 Rhesus monkey Colorectal cancer, hereditary nonpolyposis, MLH1-related MLH1 deletion, small (<=20) Naturally occurring variant Not currently evaluated 2 g.99561829_99561830del Brammer et al. (2018): "a heterozygous deletion in the putative promoter region of the MLH1 gene (rheMac2: 2:99,561,829– 99,561,830; hg19: ∼3:37,034,780; c.−258_259)" 2018 29490919
672 OMIA:000031-452646 American mink Coat colour, silver-blue MLPH deletion, gross (>20) Naturally occurring variant Not currently evaluated deletion of exon 8 2013 23747352
653 OMIA:001445-93934 Japanese quail Feather colour, lavender MLPH deletion, gross (>20) Naturally occurring variant Not currently evaluated a large deletion in the region of the quail MLPH gene 2002 12011184
1683 OMIA:000031-9669 domestic ferret Coat colour, silver MLPH deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated p.(S327Tfs*46)  an inversion of two nucleotides and a single nucleotide deletion in the 9th exon of MLPH 2023 38189891
1617 OMIA:002758-51751 ball python Skin colour, Ghost MLPH delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated c.4919_4923del p.(Q350Ilefs*15) OR035642 2023 37637270
807 OMIA:001445-9031 chicken Five gray MLPH substitution missense Naturally occurring variant Not currently evaluated 7 g.4727070A>G c.1909A>G 2016 27173258
553 OMIA:000031-9913 taurine cattle Belgian Blue (Cattle) Coat colour, cool gray MLPH deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 3 NC_037330.1:g.116966611_116966620del NM_001081597.1:c.87_96del NP_001075066.1:p.(E32Dfs*1) rs5334474900 2016 26582259 The genomic location on ARS-UCD1.2 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries.
1216 OMIA:000031-9615 dog Chihuahua (Dog) Italian Greyhound (Dog) Mudi (Dog) Pekingese (Dog) Pumi (Dog) Shetland Sheepdog (Dog) Shih Tzu (Dog) Tibetan Mastiff (Dog) Yorkshire Terrier (Dog) Dilute MLPH d^3 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 25 g.48150749_50insC c.667_668insC p.(H223Pfs*41) "(NM_001103219.2: c.667_668insC or chr25: g.48150749_50insC" (van Buren et al. (2020) 2020 32531980
360 OMIA:000031-9615 dog American Staffordshire Terrier (Dog) Beagle (Dog) Belgian Shepherd Dog, Malinois (Dog) Doberman Pinscher (Dog) German Pinscher (Dog) Huntaway (Dog) Large Munsterlander (Dog) Miniature Pinscher (Dog) New Zealand Heading Dog (Dog) Rhodesian Ridgeback (Dog) Dilute MLPH d^1 substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 25 NC_006607.3:g.48121642G>A NM_001103219.2:c.-22G>A Additional breeds based on PMID:40965331 2007 17519392 Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool
948 OMIA:000031-9615 dog Chow Chow (Dog) Sloughi (Dog) Thai Ridgeback (Dog) Dilute MLPH d^2 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 25 NC_006607.3:g.48150787G>C NM_001103219.2:c.705G>C NP_001096689.2:p.(Q235H) 2018 29349785
495 OMIA:000031-9685 domestic cat Coat colour, dilute MLPH d deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 C1 NC_058375.1:g.218197448del NM_001079655.1:c.83del NP_001073123.1:p.(L28Rfs*12) rs5334475121 2006 16860533 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
8 OMIA:001445-9031 chicken Feather colour, lavender MLPH substitution missense Naturally occurring variant Not currently evaluated GRCg6a 7 g.4833305G>A c.103C>T p.(R35W) 2008 18197963 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1204 OMIA:000031-452646 American mink Silverblue MLPH p substitution splicing Naturally occurring variant Not currently evaluated MusPutFur1.0.86 g.662639G>A c.901+1G>A GL896909.1:662639 G/A (MLPH C.901 + 1 G > A) (Manakhov et al., 2019) 2019 30872653
1561 OMIA:001445-9135 common canary Feather colour, Opal / Mogno MLPH deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated NW_022042652.1 g.66493407_66493413del p.(A237fs) XP_009086443.1 2023 37194440
1560 OMIA:001445-9135 common canary Feather colour, Onyx MLPH substitution missense Naturally occurring variant Not currently evaluated NW_022042652.1 g.66497548C>T p.(R111K) XM_009088195.3; XP_009086443.1 2023 37194440
1217 OMIA:000031-9940 sheep Jacob (Sheep) Lilac MLPH substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 1 NC_040252.1:g.3580535C>A NM_001146271.1:c.40G>T NP_001139743.1:p.(E14*) Oar_v4.0 position is NC_019458.2:g.3451931C>A; NP_001139743.1:p.Glu14* (Posbergh et al., 2020) 2020 32512769
932 OMIA:000031-9986 rabbit Lionhead Dwarf Loh Netherland dwarf (Rabbit) Coat colour, dilute MLPH deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated OryCun2.0 NW_003159466.1 g.549853del c.586del p.(E196fs) NM_001297485.1; NP_001284414.1; published as g.549853delG, c.585delG, p.(L195Lfs*123) - information in this table has been updated to reflect HGVS nomenclature recommendations 2013 24376820
1690 OMIA:002849-9940 sheep Manech Tête Rousse, France (Sheep) Methylmalonyl-CoA mutase deficiency MMUT substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 20 NC_040271.1:g.23776347G>A XM_004018875.4:c.1225C>T XP_004018923.1:p.(Q409*) 2024 38424485
1433 OMIA:000884-9031 chicken Rose comb MNR2 R2 complex rearrangement Naturally occurring variant Not currently evaluated galGal3 7 g.16499781_16499782ins[23881384_23790414inv;16499583–16499781] predicted to be the result of a recombination event between the wild-type allele and the R1 allele: "R2 does not carry the entire inversion but instead has two duplicated segments, one 91 kb fragment (23,790,414–23,881,384 bp) that represents a remaining fragment of the inverted region together with a small duplicated fragment of 198 bp (16,499,583–16,499,781 bp)" 2012 22761584
745 OMIA:000884-9031 chicken Rose comb MNR2 R1 inversion Naturally occurring variant Not currently evaluated galGal3 7 g.16499782_23881391delins23881384_16499781 published as a 7.38 Mb inversion 2012 22761584
492 OMIA:001819-9913 taurine cattle Brown Swiss (Cattle) Original Swiss Brown (Cattle) Tiroler Grauvieh (Cattle) Xanthinuria, type II MOCOS deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 24 NC_037351.1:g.20911933del XM_024984177.1:c.1881del XP_024839945.1:p.(S628Vfs9*) Published using UMD3.1 position: g.21222030delC; cDNA and protein positions are given transcript: ENSBTAT00000048768. Positions for a second transcript (ENSBTAT00000065375) were given in the paper: c.1782del and p.(S595Vfs9*). Variant was initially described in Tyrolean Grey cattle and later reported in Brown Swiss cattle (PMID: 37675885) rs5334474910 2016 27919260 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
446 OMIA:001819-9913 taurine cattle Japanese Black, Japan (Cattle) Xanthinuria, type II MOCOS deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.3 24 NC_037351.1:g.20936257_20936259del NM_174081.2:c.769_771del NP_776506.1:p.(Y257del) published as c.769_771delTAC 2000 10801779 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1355 OMIA:001819-9615 dog Manchester Terrier (Dog) Xanthinuria, type II MOCOS substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 7 g.53995018C>A c.232G>T p.(G48_Y77del) ENSCAFT00000028243.4; “Ensembl VEP determined the consequence of the variant to be a missense, splice region variant … the variant results in the removal of all 90 bp (30 amino acids) of exon 2 (p.Gly48_Tyr77del); the genomic position is based on supplementary table S3 (Tate et al., 2021)”; transcript ENSCAFT00000028243.4 2021 34584846
1356 OMIA:001819-9615 dog Cavalier King Charles Spaniel (Dog) English Cocker Spaniel (Dog) Xanthinuria, type II MOCOS deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 7 NC_006589.3:g.53989863del XM_547604.6:c.383del XP_547604.4:p.(A128Gfs*30) c.383delC; transcript ENSCAFT00000028243.4; genomic position based on supplementary table S3 (Tate et al., 2021) 2021 34584846
1357 OMIA:001819-9615 dog Dachshund (Dog) Xanthinuria, type II MOCOS substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 7 NC_006589.3:g.54001790A>G XM_547604.6:c.137T>C XP_547604.4:p.(L46P) transcript ENSCAFT00000028243.4; genomic position based on supplementary table S3 (Tate et al., 2021) 2021 34584846
483 OMIA:001541-9913 taurine cattle Simmental (Cattle) Arachnomelia, BTA23 MOCS1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 23 g.13837657_13837658del c.1224_1225del p.(H408Qfs*51) 220110: changed g.13837654_13837655del to g.13837657_13837658del based on HGVS 3'rule. ENSBTAT00000013792.6:c.1224_1225del ENSBTAP00000013792.5:p.His408GlnfsTer51 rs383500843 2011 21255426 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446.
326 OMIA:001366-9031 chicken Retinal dysplasia and degeneration MPDZ substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated GRCg6a Z NC_006127.5:g.31023848G>A NM_001256123.1:c.1372C>T NP_001243052.1:p.(R458*) 2011 21862650 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
342 OMIA:002028-9615 dog Italian Hound (Dog) Myeloperoxidase deficiency MPO substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 9 NC_006591.3:g.32929382G>A XM_847352.4:c.1936C>T XP_852445.2:p.(R646*) XM_847352.4; XP_852445.2; published as c.1987C>T (Ensembl transcript ID:ENSCAFT00000027699) 2016 27296514
1592 OMIA:002739-9615 dog Golden Retriever (Dog) Polyneuropathy, hypomyelinating, MPZ-related MPZ substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 38 NC_049259.1:g.22037876T>C XM_038585926.1:c.434T>C XP_038441854.1:p.(I145T) XM_038585926.1; XP_038441854.1; heterozygous in a single affected dog 2023 37400349
491 OMIA:001452-9913 taurine cattle Belgian Blue (Cattle) Tail, crooked MRC2 deletion, small (<=20) nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.2 19 g.47095176_47095177del c.2904_2905del p.(G934*) rs5334475077 2009 19779552 Breed and some variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) 210908 the entry g.47740473delAG can't be correct because if two bases have been deleted, the g. notation must include the two relevant base positions. FN BLASTED the sequence CCAGACCTGCCGCCCACAG obtained from Fig 3 against UMD3.1.1, and determined that the entry should be g.47740474_47740475del
208 OMIA:001452-9913 taurine cattle Belgian Blue (Cattle) Tail, crooked MRC2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.47089627T>G NM_001192670.1:c.1906T>G NP_001179599.1:p.(C636G) rs466131011 2012 22497452 Breed and some variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1417 OMIA:002518-9913 taurine cattle Brown Swiss (Cattle) Original Swiss Brown (Cattle) Haplotype with homozygous deficiency BH14 MRPL55 BH14 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 7 NC_037334.1:g.2996436C>T NM_001303490.1:c.169C>T NP_001290419.1:p.(R57*) NM_001303490.1 rs461014370 2021 34915862
1015 OMIA:002160-9544 Rhesus monkey Colorectal cancer, hereditary nonpolyposis, MSH6-related MSH6 substitution missense Naturally occurring variant Not currently evaluated Dray et al. (2018): "a heterozygous missense mutation in MSH6 that has a CADD score of 22.8, indicating that it would be among the <1% most deleterious mutations possible in the human genome (if that variant occurred in the human MSH6 gene" 2018 30108684
1189 OMIA:000319-9823 pig Ear size MSRB3 repeat variation Naturally occurring variant Not currently evaluated Sscrofa11.1 5 "the 38.7-kb CNV . . . starts at 349,577 bp and ends at 388,246 bp of the corrected contig (MK028166) . . . , covering the last two exons 6 and 7 of the MSRB3 gene" (Chen et al., 2018) 2018 30587124
618 OMIA:000683-9913 taurine cattle Maine-Anjou (Cattle) Muscular hypertrophy (double muscling) MSTN nt419(del7-ins10) delins, small (<=20) nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.2 2 g.6281243_6281249delinsAAGCATACAA c.419_425delinsAAGCATACAA p.(F140*) cDNA and protein positions based on NM_001001525.3 and NP_001001525.1, retrospectively rs5334475091 1998 9501304 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Variant coordinates updated based on Johnsson and Jungnickel (2021)
212 OMIA:000683-9913 taurine cattle Gelbvieh (Cattle) Muscular hypertrophy (double muscling) MSTN substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.6279187T>C NM_001001525.3:c.191T>C NP_001001525.1:p.(L64P) UMD3.1 position is g.6213889T>C rs449270213 2015 25515003 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
771 OMIA:000683-9913 taurine cattle Angus (Cattle) Limousin (Cattle) Muscular hypertrophy (double muscling) MSTN substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.6279278C>A NM_001001525.3:c.282C>A NP_001001525.1:p.(F94L) UMD3.1 position is g.6213980A>C rs110065568 1998 9501304 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
772 OMIA:000683-9913 taurine cattle Parthenais (Cattle) Muscular hypertrophy (double muscling) MSTN substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.6279310C>G NP_001001525.1:c.314C>G NP_001001525.1:p.(S105C) UMD3.1 position is g.6214012C>G rs5334475047 2002 Reference not in PubMed; see OMIA 000683-9913 for reference details Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
773 OMIA:000683-9913 taurine cattle Maine-Anjou (Cattle) Muscular hypertrophy (double muscling) MSTN D182N substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.6281368G>A NM_001001525.3:c.544G>A NP_001001525.1:p.(D182N) rs5334475067 2002 Reference not in PubMed; see OMIA 000683-9913 for reference details The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
299 OMIA:000683-9913 taurine cattle Blonde d'Aquitaine (Cattle) Charolais (Cattle) Limousin (Cattle) Muscular hypertrophy (double muscling) MSTN substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.6281434C>T NM_001001525.3:c.610C>T NP_001001525.1:p.(Q204*) UMD3.1 position is g.6216138C>T rs110344317 1998 9501304 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
300 OMIA:000683-9913 taurine cattle Maine-Anjou (Cattle) Marchigiana (Cattle) Muscular hypertrophy (double muscling) MSTN substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.6281500G>T NM_001001525.3:c.676G>T NP_001001525.1:p.(E226*) UMD3.1 position is g.6216204G>T rs5334474940 1998 9501304 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
489 OMIA:000683-9913 taurine cattle Angus (Cattle) Asturian Valley (Cattle) Belgian Blue (Cattle) Blonde d'Aquitaine (Cattle) Braford (Cattle) Japanese Black, Japan (Cattle) Limousin (Cattle) Murray Grey (Cattle) Parthenais (Cattle) Santa Gertrudis (Cattle) South Devon (Cattle) Muscular hypertrophy (double muscling) MSTN deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.6283674_6283684del NM_001001525.3:c.818_828del NP_001001525.1:p.(D273Rfs*14) UMD3.1 position is g.6218379delATGAACACTCC; c. previously listed as c.821_831del - updated to recent transcript ID and incorrect EVA rs382669990 replaced [29/08/2024]  rs5384554823 1997 9288100 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Protein coordinates updated based on Johnsson and Jungnickel (2021). Additional breeds added based on recent publications: PMID: 40170586.
301 OMIA:000683-9913 taurine cattle Maine-Anjou (Cattle) Marchigiana (Cattle) Muscular hypertrophy (double muscling) MSTN substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.6283727G>T NM_001001525.3:c.871G>T NP_001001525.1:p.(E291*) UMD3.1 position is g.6218432G>T; c.1004G>T updated to c.871G>T [29/08/2024] rs5334475075 2013 22497537 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
203 OMIA:000683-9913 taurine cattle Gascon (Cattle) Parthenais (Cattle) Piedmont (Cattle) Muscular hypertrophy (double muscling) MSTN substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.6283794G>A NM_001001525.3:c.938G>A NP_001001525.1:p.(C313Y) UMD3.1 position is g.6218499G>A rs5334475012 1997 9314496 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
470 OMIA:000683-9615 dog Whippet (Dog) Muscular hypertrophy (double muscling) MSTN deletion, small (<=20) nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 37 g.729362_729363del c.939_940delTG p.(C313*) NM_001002959.1; NP_001002959.1; published as c.939_940delTG; genomic coordinates in accordance with HGVS 3'-rule 2007 17530926 Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn.
435 OMIA:000683-9940 sheep Texel (Sheep) Muscular hypertrophy (double muscling), Texel MSTN substitution regulatory Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 2 g.129065977G>A c.*1232G>A "G to A transition in the 3' UTR that creates a target site for mir1 and mir206, microRNAs (miRNAs)" rs408469734 2006 16751773 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1019 OMIA:002161-9823 pig Large White (Pig) Leg weakness, MSTN-related MSTN substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Sscrofa11.1 15 NC_010457.5:g.94623834C>A NM_214435.2:c.820G>T NP_999600.2:p.(E274*) rs3473215843 2019 30699111
441 OMIA:000683-9823 pig Pietrain (Pig) Muscular hypertrophy (double muscling) MSTN substitution regulatory Naturally occurring variant Not currently evaluated Sscrofa11.1 15 NC_010457.5:g.94629236T>C Stinckens et al. (2008) describe polymorphism located at position 447 of the porcine MSTN promoter, EF490986 EF490990 g.447A>G rs332188828 2008 18822098
1459 OMIA:001508-9615 dog Boykin Spaniel (Dog) Myotubular myopathy 1 MTM1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 X g.118903496C>T c.1467C>T p.(R512*) ENSCAFP00000028221.3 2020 32417001
63 OMIA:001508-9615 dog Labrador Retriever (Dog) Myotubular myopathy 1 MTM1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 X NC_006621.3:g.118885117C>A XM_005641935.3:c.465C>A XP_005641992.1:p.(N155K) XM_005641935.3; XP_005641992.1 rs1152388426 2010 20682747 Genomic coordinates in CanFam3.1 and EVA ID provided by Robert Kuhn
91 OMIA:001508-9615 dog Rottweiler (Dog) Myotubular myopathy 1 MTM1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 X NC_006621.3:g.118901282A>C XM_005641935.3:c.1151A>C XP_005641992.1:p.(Q384P) XM_005641935.3; XP_005641992.1 2015 25664165 Genomic position in CanFam3.1 provided by Robert Kuhn and Mateo Etcheveste.
1475 OMIA:001508-9685 domestic cat Maine Coon (Cat) Myotubular myopathy 1 MTM1 substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 X NC_058386.1:g.122964931C>T XM_023249466.2:c.455C>T XP_023105234.1:p.(A152V) 2022 35962713 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1591 OMIA:002727-9615 dog Golden Retriever (Dog) Polyneuropathy, hypomyelinating, MTMR2-related MTMR2 substitution splicing Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 21 NC_049242.1:g.5387227G>A XM_038568229.1:c.1479+1G>A XM_038568229.1, reported in two dogs 2023 37400349
1524 OMIA:001467-9615 dog Golden Retriever (Dog) Neuropathy, sensory ataxic MTTY deletion, small (<=20) Naturally occurring variant Not currently evaluated M m.5304del 2009 19492087
14 OMIA:001534-9031 chicken Resistance to myxovirus MX1 substitution missense Naturally occurring variant Not currently evaluated GRCg6a 1 g.110260061G>A c.1892G>A p.(S631N) rs313590198 2002 11932243 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
217 OMIA:001978-9913 taurine cattle Holstein Friesian (Cattle) Arthrogryposis, distal, type 1B MYBPC1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.65446598T>G NM_001110773.1:c.884T>G NP_001104243.1:p.(L295R) rs5369172067 2015 26289121 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
902 OMIA:002951-9685 domestic cat American Bobtail (Cat) American Bobtail Shorthair (Cat) Highlander (Cat) Munchkin (Cat) Ragamuffin (Cat) Ragdoll (Cat) Cardiomyopathy, hypertrophic (autosomal dominant) MYBPC3 substitution missense Naturally occurring variant P F.catus_Fca126_mat1.0 D1 NC_058377.1:g.99269394C>T XM_019812397.2:c.2453C>T XP_019667956.2:p.(R818W) published as p.(R820W); coordinates in the table have been updated to a recent reference genome and / or transcript 2007 17521870 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Additional breeds reported based on PMID:35709088. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
901 OMIA:002952-9685 domestic cat Maine Coon (Cat) Maine Coon Polydactyl (Cat) Munchkin (Cat) Pixiebob Longhair (Cat) Ragdoll (Cat) Scottish Fold (Cat) Siberian (Cat) Cardiomyopathy, hypertrophic (autosomal recessive) MYBPC3 substitution missense Naturally occurring variant P F.catus_Fca126_mat1.0 D1 NC_058377.1:g.99280283C>G XM_019812397.2:c.91G>C XP_019667956.2:p.(A31P) variant initially reported in Main Coon cats and in a later study (Akiyama et al., 2023) identified in other breeds. 2005 16236761 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Additional breeds reported based on PMID:35709088 and 38371598. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
973 OMIA:002141-9796 domestic horse Belgian Draft (Horse) Quarter Horse (Horse) Welsh Pony (Horse) Immune-mediated myositis MYH1 substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 11 NC_009154.3:g.53345548T>C NM_001081759.1:c.959A>G NP_001075228.1:p.(E320G) The location of this likely causal variant was given as chr11:52,993,878T>C by Finno et al. (2018) in relation to the EquCab2.0 assembly. Applying NCBI's remap gives the EquCab3.0 coordinate as chr11:53,345,548 and p.(E320G) rs3435577028 2018 29510741 Breed information updated based on PMID: 38600096
1500 OMIA:002590-9913 taurine cattle Limousin (Cattle) Cleft palate MYH3 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 19 g.[29609605-29609615del;29609623A>G] c.[2864T>C;2872_2882del] c.[I955T; p.L958Tfs*5] NM_001101835.1 2022 36309651
556 OMIA:002039-9913 taurine cattle Belgian Blue (Cattle) Abortion (embryonic lethality), MYH6-related MYH6 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.2 10 g.21538917_21538919del p.(K1730del) 2016 27646536 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1810 OMIA:002212-9823 pig Yucatan Miniature, United States of America (Pig) Cardiomyopathy, hypertrophic MYH7 substitution missense Transgenesis via somatic cell nuclear transfer (SCNT) Not currently evaluated p.(R403Q) 2018 30104387
1121 OMIA:002212-9685 domestic cat Domestic Shorthair (Cat) Cardiomyopathy, hypertrophic, MYH7-related MYH7 substitution missense Naturally occurring variant LP/P F.catus_Fca126_mat1.0 B3 NC_058373.1:g.73871470C>T XM_006932746.5:c.5647G>A XP_006932808.1:p.(E1883K) rs3166775194 2019 31164718 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1798 OMIA:002212-9823 pig Cardiomyopathy, hypertrophic MYH7 substitution missense Base-editing Not currently evaluated Sscrofa11.1 7 NC_010449.5:g.75656919C>T NM_213855.2:c.1357C>T NP_999020.2:p.(R453C) 2024 38862020
1799 OMIA:002212-9823 pig Cardiomyopathy, hypertrophic MYH7 substitution missense Genome-editing (TALEN) Not currently evaluated Sscrofa11.1 7 NC_010449.5:g.75660381C>G NM_213855.2:c.2167C>G NP_999020.2:p.(R723G) 2018 29555974
598 OMIA:001200-9823 pig Tremor, high-frequency (Campus syndrome) MYH7 insertion, small (<=20) insertion (in-frame) Naturally occurring variant Not currently evaluated Sscrofa11.1 7 NC_010449.5:g.75668348_75668349insCCCGCC NM_213855.2:c.4320_4321insCCCGCC NP_999020.2:p.(A1440_A1441insPA) Genomic coordinates in OMIA were previously listed as g.75668349_75668350insGGCGGG, corrected 29/01/2025 2012 23153285 The genomic location on Sscrofa10.2 was determined by Stephanie Shields (27/05/2020) and updated to the genomic Sscrofa11.1 location by Imke Tammen
55 OMIA:001608-9615 dog Pug (Dog) May-Hegglin anomaly MYH9 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 10 NC_006592.3:g.28120346G>A NM_001110767.1:c.5521G>A NP_001104237.1:p.(E1841L) NM_001110767.1; NP_001104237.1; previously incorrectly listed in OMIA as p.(Q1841L) (corrected 11/2/2022) 2011 21554370 Genomic coordinates in CanFam3.1 provided by Robert Kuhn.
1372 OMIA:001501-9615 dog Dachshund, Miniature (Dog) Coat colour dilution and neurological defects MYO5A insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 30 g.18004551_18004552insT c.4973_4974insA p.(N1658Kfs*28). cDNA and protein positions based on XM_022412522.1 and XP_022268230.1, respectively 2021 34680875
510 OMIA:001501-9796 domestic horse Arab (Horse) Lavender foal syndrome MYO5A deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated EquCab3.0 1 NC_009144.3:g.139290592del XM_023617258.1:c.4249del XP_023473026.1:p.(R1417Afs*13) XM_023617258.1; XP_023473026.1; published as g.138235715delC; coordinates in the table have been updated to a recent reference genome 2010 20419149 The genomic position in EquCab3.0 was provided by Gracie Zinsmeister, working under the guidance of Professor Ernie Bailey in April 2022
1079 OMIA:002148-9615 dog Doberman Pinscher (Dog) Deafness, bilateral, and vestibular dysfunction MYO7A substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 21 NC_006603.3:g.21563111C>T XM_022407643.1:c.3719G>A XP_022263351.1:p.(R1240Q) 2019 31097876
1316 OMIA:002148-9823 pig Duroc (Pig) Vestibular dysfunction MYO7A substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Sscrofa11.1 9 NC_010451.4:g.11280403C>T NM_001099928.1:c.541C>T NP_001093398.1:p.(Q181*) cDNA position is based on transcript NM_001099928.1 rs5334475170 2021 33955556
519 OMIA:001342-8790 emu Mucopolysaccharidosis IIIB NAGLU deletion, small (<=20) Naturally occurring variant Not currently evaluated c.1098_1099delGG 2001 11414757
202 OMIA:001342-9913 taurine cattle Santa Gertrudis (Cattle) Mucopolysaccharidosis IIIB NAGLU substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.42624367G>A NM_001102226.2:c.1354G>A NP_001095696.1:p.(E452K) rs5334475071 2007 17458708 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
956 OMIA:001342-9615 dog Schipperke (Dog) Mucopolysaccharidosis IIIB NAGLU insertion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 9 g.20407670_20407671ins[A[(40_70)];20407660_20407670] c.2110_2111ins[A[(40_70)];2100_2110] XM_548088; an insertion of 40 to 70 A nucleotides and an 11bp duplication of the sequence directly upstream of the poly-A 2020 32081995
986 OMIA:001788-9615 dog Great Dane (Dog) Rottweiler (Dog) Leukoencephalomyelopathy NAPEPLD insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 18 g.16987327_16987328insC c.345_346insC p.(E116Rfs*186) 2018 29643404
985 OMIA:001788-9615 dog Leonberger (Dog) Leukoencephalomyelopathy NAPEPLD substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 18 NC_006600.3:g.16987520G>C XM_022405227.1:c.538G>C NP_033360935.2:p.(A180P) 2018 29643404
1469 OMIA:002557-9913 taurine cattle Cikasto govedo, Slovenia (Cattle) Leber optic neuropathy ND4L substitution missense Naturally occurring variant Not currently evaluated M m.10432T>C Novosel et al. (2022): "two “mutant” Cika cattle animals (GenBank acc. Nos. MZ901663 and MZ MZ901663)" 2019 Reference not in PubMed; see OMIA 002557-9913 for reference details
1315 OMIA:002348-9615 dog English Cocker Spaniel (Dog) Retinal dysplasia NDP insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 X g.37950668_37950668insC c.653_654insC p.(M114Hfs*16) 2021 33945575
1064 OMIA:002189-8932 rock pigeon Barless NDP c not known start-lost Naturally occurring variant Not currently evaluated Cliv_1.0 Vickrey et al. (2018): "a nonsynonymous protein-coding change at the start codon of NDP". 2018 30014848
474 OMIA:002120-9615 dog Greyhound (Dog) Polyneuropathy NDRG1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 13 g.29691070_29691079del c.1080_1089del p.(R361Sfs*60) NM_001284434.1; NP_001271363.1, 2010 20582309 Genomic position in CanFam3.1 provided by Robert Kuhn and Mateo Etcheveste.
73 OMIA:002120-9615 dog Alaskan Malamute (Dog) Polyneuropathy NDRG1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 13 NC_006595.3:g.29714606C>A NM_001284434.1:c.293G>T NP_001271363.1:p.(G98V) NM_001284434.1; NP_001271363.1 2013 23393557 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1679 OMIA:002840-9615 dog Chihuahua (Dog) Mixed Breed (Dog) Leigh syndrome NDUFS7 substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 20 NC_049241.1:g.57913322C>T XM_038568001.1:c.535G>A XP_038423929.1:p.(V179M) Changed from NC_049241.1:g.57913322G>A to NC_049241.1:g.57913322C>T [09/06/2025] 2024 38316835
961 OMIA:002137-9615 dog American Bulldog (Dog) Nemaline myopathy, NEB-related NEB substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 19 g.52734272G>T p.(S8042*) NP_001258137.1 2016 27215641
1083 OMIA:002198-9615 dog Giant Schnauzer (Dog) Progressive retinal atrophy, NECAP1-related NECAP1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 27 NC_006609.3:g.37468611G>A XM_543832.5:c.544G>A XP_543832.2:p.(G182R) 2019 31117272
1908 OMIA:003061-9615 dog Belgian Shepherd Dog, Malinois (Dog) Leukoencephalomyelopathy NECAP1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 27 NC_049248.1:g.8636271G>A XM_038576681.1:c.142C>T XM_038576681.1:c.142C>T (p.R48*) 2026 42366163
316 OMIA:000545-93934 Japanese quail Hypotrophic axonopathy NEFL substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.352C>T p.(Q114*) 1993 8468353
632 OMIA:000218-9615 dog Collie eye anomaly NHEJ1 deletion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 37 g.25698028_25705826del c.588+462_588+8260del XM_005640671.1; a deletion of 7799bp in the NHEJ1 gene; for limitations on the utility of testing for the published likely causal variant, see the results of Fredholm et al. (2016) and Brown et al. (2018) 2007 17916641
756 OMIA:000690-9615 dog Beagle (Dog) Brussels Griffon (Dog) Chihuahua (Dog) Dachshund, Miniature Wire-Haired (Dog) French Bulldog (Dog) Mixed Breed (Dog) Newfoundland (Dog) Pembroke Welsh Corgi (Dog) Myoclonus epilepsy of Lafora NHLRC1 repeat variation Naturally occurring variant Not currently evaluated 35 19 to 26 copies of a sequence of 12 nucleotides (12-mer; dodecamer) in the canine EPM2B gene (now called NHLRC1) 2005 15637270 Additional breeds based on PMID: 34357061
766 OMIA:002103-9913 taurine cattle Angus (Cattle) Developmental duplications NHLRC2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 26 NC_037353.1:g.34340886T>C NM_001083723.2:c.932T>C NP_001077192.1:p.(V311A) rs5334474969 2014 Reference not in PubMed; see OMIA 002103-9913 for reference details Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
679 OMIA:001936-9913 taurine cattle Romagnola (Cattle) Cataract, recessive, Romagnola NID1 deletion, gross (>20) Naturally occurring variant Not currently evaluated 28 "an 855 bp deletion across the exon 19/intron 19 border of the bovine nidogen 1 (NID1) gene (c.3579_3604+829del)" 2014 25347398
563 OMIA:001980-9615 dog American Bulldog (Dog) American Bully (Dog) Ichthyosis, NIPAL4-related NIPAL4 deletion, small (<=20) nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 4 g.52737379del c.744delC p.(I249*) 2017 28122049
622 OMIA:000938-9615 dog Weimaraner (Dog) Spinal dysraphism NKX2-8 delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 8 g.15149895delinsAA c.449delinsTT p.(A150Vfs*6) XM_847109.4; XP_852202.1 2013 23874236
1370 OMIA:002464-9823 pig Large White (Pig) Cryopyrin-associated periodic syndrome NLRP3 haplotype missense Genome editing (CRISPR/Cpf1) Not currently evaluated 2 p.(R259W) 2020 32958688
1096 OMIA:002206-9615 dog Alaskan Malamute (Dog) Ciliary dyskinesia, primary, NME5-related NME5 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 11 NC_006593.3:g.25792084del XM_003639378.4:c.43delA XP_003639426.1:p.(T15Lfs*56) XM_003639378.4:c.43delA; XP_003639426.1:p.(Thr15LeufsTer56) 2019 31479451
1718 OMIA:002874-9913 taurine cattle Montbéliarde (Cattle) Haplotype with homozygous deficiency, NOA1-related NOA1A insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 6 NC_037333.1:g.72359797_72359798insG NM_001038188.2:c.1086_1087insC NP_001033277.1:(p.D363Rfs*9) Published as ENSBTAT00000071135.1:p.D400RfsX9 rs5411279036 2023 39343954 Reference not in PubMed; see OMIA 002874-9913 for reference details
664 OMIA:001101-9031 chicken Polymorphic Nucleolar [PNU] strain, United States of America (Chicken) Ribosomal RNA deficiency NOR deletion, gross (>20) Naturally occurring variant Not currently evaluated "Embryos exhibiting a nucleolar phenotype of one large and one very small nucleolus (Pp) are heterozygous for a reduced rDNA cluster (+/p1) and were shown in the present study to contain about 66% of the complement of rRNA genes in normal individuals (+/+) that show two large equal-sized nucleoli (PP)" 1994 8014461
1244 OMIA:000725-9913 taurine cattle Angus (Cattle) Niemann-Pick type C1 NPC1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 24 NC_037351.1:g.33099467C>G NM_174758.2:c.2969C>G NP_777183.1:p.(P990R) NM_174758.2:c.2969C>G rs482882512 2020 32970694
134 OMIA:000725-9685 domestic cat Domestic Shorthair (Cat) Niemann-Pick disease, type C1 NPC1 substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 D3 NC_058379.1:g.46059888C>G NM_001009829.2:c.2864G>C NP_001009829.2:p.(C955S) rs5334475149 2003 12809639 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
146 OMIA:000725-9685 domestic cat Domestic Shorthair (Cat) Niemann-Pick disease, type C1 NPC1 substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 D3 NC_058379.1:g.46075921T>G NM_001009829.2:c.1322A>C NP_001009829.2:p.(H441P) rs5334475146 2017 28233346 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1572 OMIA:002065-9685 domestic cat Japanese Domestic (Cat) Siamese (Cat) Niemann-Pick disease, type C2 NPC2 substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B3 NC_058373.1:g.119395559C>T XM_003987833.6:c.376G>A XP_003987882.1:p.(V126M) Changed from g.121865210G>A to NC_018728.3:g.121865210C>T [09/06/2025]
c. coordinates corrected from XM_003987833.6:c.367G>A to XM_003987833.6:c.376G>A based on feedback from M.C. Temizkan [12/12/2025]
2023 37458497 Updated to F.catus_Fca126_mat1.0 by Bella Bartner. 
420 OMIA:002065-9685 domestic cat Niemann-Pick disease, type C2 NPC2 substitution splicing Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B3 NC_058373.1:g.119403305C>T XM_003987833.6:c.82+5G>A XP_003987882.1:p.(G28_S29ins35) rs5334475124 2014 25396745 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
634 OMIA:001455-9615 dog Dachshund, Miniature Wire-Haired (Dog) Dachshund, Standard Wire-Haired (Dog) Cone-rod dystrophy, Standard Wire-haired Dachshund NPHP4 deletion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 5 g.59912991_59913168del c.479_526+130del NM_001135788.1; 178-bp deletion in exon/intron 5 of NPHP4 (nephronophthisis 4, also known as nephroretinin) 2008 18687878
1171 OMIA:002254-9615 dog Mixed Breed (Dog) Glucocorticoid resistance NR3C1 insertion, gross (>20) frameshift Naturally occurring variant Not currently evaluated 2 c.2032_2033insN[69] An insertion of "69 nucleotides between nucleotides 2032 and 2033 compared with dog wild type GR [i.e. NR3C1]. These extra 69 nucleotides matched a part of the nucleotide sequence of dog genomic DNA corresponding to intron 6 . . . . Insertion of these extra 69 nucleotides between exons 6 and 7 introduced a frameshift and a premature termination codon (TGA) 15 bp downstream of the insertion. This insertion is thus predicted to result in a truncated protein of 682 amino acids, compared to the normal (wild type) 780 amino acids" (Yamanaka et al., 2019) The cause of this splice variant could not be determined in genomic DNA. 2019 31651346
1264 OMIA:002296-9615 dog Yorkshire Terrier (Dog) XY difference of sexual development, NR5A1-related NR5A1 deletion, gross (>20) Naturally occurring variant Not currently evaluated 9 "a large deletion consisting of four exons of the NR5A1 gene" (Nowacka-Woszuk et al., 2020) 2020 33128907
790 OMIA:002117-9615 dog Labrador Retriever (Dog) CHILD-like syndrome NSDHL deletion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 X g.120749179_120763577del c.507+220_*9662del XM_005641965.1; deletion of 14,399bp 2017 28739597
1268 OMIA:002117-9615 dog Chihuahua (Dog) Verrucous epidermal keratinocytic nevi NSDHL deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 X g.120752486_120752490del c.718_722delGAACA p.(E240Pfs*17) NC_006621.3: g.120,752,486_120,752,490delGAACA; XM_014111859.2:c.718_722delGAACA; XP_013967334.1:p.(Glu240Profs*17) (Christen et al., 2020) 2020 33143176
1243 OMIA:002117-9615 dog Chihuahua (Dog) Verrucous epidermal keratinocytic nevi NSDHL substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 X NC_006621.3:g.120752468G>A XM_014111859.2:c.700G>A XP_013967334.1:p.(G234R) CanFam3.1 ChrX:120,752,468G>A; XM_014111859.2:c.700G>A; XP_013967334.1: p.Gly234Arg 2019 31571289
1055 OMIA:002117-9685 domestic cat Domestic Shorthair (Cat) Inflammatory linear verrucous epidermal nevi NSDHL substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 X NC_058386.1:g.124922544A>G XM_004000985.6:c.397A>G XP_004001034.1:p.(S133G) 2019 30474267 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1686 OMIA:002117-9615 dog Appenzeller Sennenhund (Dog) Verrucous epidermal keratinocytic nevi NSDHL deletion, gross (>20) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 X UU_Cfam_GSD_1.0;  large heterozygous deletion of at least 120 kb at ChrX:121.96-122.08 Mb; a more complex structural rearrangement is possible 2024 38659285
1410 OMIA:002509-9913 taurine cattle Simmental (Cattle) Haplotype with homozygous deficiency SH9 NUBPL SH9 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 21 NC_037348.1:g.42154344C>A NM_001193042.1:c.428C>A NP_001179971.1:p.(S143Y) NM_001193042.1 rs5335823597 2021 34944310
1468 OMIA:002556-9913 taurine cattle Chianina (Cattle) Double-outlet right ventricle NUMB substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 10 NC_037337.1:g.84751870G>A NM_001101951.1:c.416C>T NP_001095421.1:p.(T139M) NM_001101951.1; NP_001095421.1 2022 35748177
555 OMIA:002035-9913 taurine cattle Jersey (Cattle) Abortion (embryonic lethality), OBFC1-related OBFC1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 26 g.24461804_24461805del c.379_380del p.(K127Vfs*29) rs455647476 2016 27646536 220110: Changed from g.24461803_24461804del to g.24461804_24461805del to adhere to HGVS 3'rule ENSBTAT00000019995.6:c.379_380del ENSBTAP00000019995.5:p.Lys127ValfsTer29 210909: FN changed c.379_380delAA to c.379_380del. He also added the ref sequence, based on the words in the text "Sequence reads were aligned to the bosTau6 reference genome". FN also checked the g. location against Suppl Material S2, which lists the location as 24720154. However, a search of the UMD assembly confirms that the AA del is actually as given, i.e. g.24720155_24720156del
1242 OMIA:001595-9940 sheep Merino (Sheep) Brachygnathia, cardiomegaly and renal hypoplasia syndrome OBSL1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 2 NC_040253.1:g.236304072del XM_027965226.1:c.1716del XP_027821027.1:p.(V573Wfs*119) XM_027965226.1:c.1716delC 2020 32933480 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries. 210906 To conform with HGVS notation, FN removed the nucleotide from g.236304072delG and c.1716delC
1793 OMIA:001595-9823 pig Growth disorder OBSL1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Sscrofa11.1 15 NC_010457.5:g.121576507_121576511del XM_021076298.1:c.2009_2013del XP_020931957.1:p.Y670Cfs69* 2024 38198533
865 OMIA:002130-94885 corn snake Coat colour, oculocutaneous albinism, OCA2-related OCA2 insertion, gross (>20) Naturally occurring variant Not currently evaluated LTR retrotransposon in the 11th intron 2015 26597053
1602 OMIA:002130-9544 Rhesus monkey Coat colour, oculocutaneous albinism OCA2 substitution missense Naturally occurring variant Not currently evaluated c.2363C>T p.(S788L) 2020 32259106
846 OMIA:002130-9615 dog German Spitz (Dog) Coat colour, oculocutaneous albinism, OCA2-related OCA2 substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 3 NC_006585.3:g.31715704A>C "LOC100855460 (XM_005618224.1:c.377+2T>G LT844587.1:c.-45+2T>G) . . . Comparative sequence analyses revealed that LOC100855460 actually represents the 5'-end of the canine OCA2 gene. The CanFam 3.1 reference genome assembly is incorrect and separates the first two exons from the remaining exons of the OCA2 gene. We amplified a canine OCA2 cDNA fragment by RT-PCR and determined the correct full-length mRNA sequence (LT844587.1)." 2017 28973042
1749 OMIA:002130-9823 pig Bama Xiang Zhu, China (Pig) Albinism, oculocutaneous, type II OCA2 substitution missense Chemical mutagenesis (ENU) Not currently evaluated Sscrofa11.1 15 NC_010457.5:g.56825733C>T NM_214094.2:c.2228 C>T NP_999259.2:p.(S743L) 2019 31636960
1776 OMIA:002130-8084 green swordtail Oculocutaneous albinism, OCA2-related oca2 insertion, gross (>20) Naturally occurring variant Not currently evaluated Xiphophorus_hellerii-4.1 9 approximate 480 bp insertion in the oca2 gene which introduces a premature stop codon 2025 39896652
1715 OMIA:002871-9544 Rhesus monkey Optic atrophy OPA1 substitution missense Naturally occurring variant Not currently evaluated Mmul_10 2 NC_041755.1:g.4364931C>A XM_015132523.2:c.22G>T XP_014988009.1:p.(A8S) 2024 38969634
288 OMIA:000162-9913 taurine cattle Holstein Friesian (Cattle) Red Holstein, Switzerland (Cattle) Simmental (Cattle) Swiss Fleckvieh (Cattle) Cardiomyopathy, dilated OPA3 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 18 NC_037345.1:g.53152213G>A NM_001245934.1:c.343C>T NP_001232863.1:p.(Q115*) UMD3.1 position is g.53546443C>T; cDNA position based on ENSBTAT00000064088.2 rs479222100 2011 20923700 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Additional breeds based on PMID:40312951
1141 OMIA:002227-9940 sheep Istrska pramenka (Sheep) Otocephaly OTX2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 7 NC_040258.1:g.71478714G>A XM_015097088.2:c.265C>T XP_014952574.2:p.(R89*) Paris et al. (2020): XM_015097088.2:c.265C > T 2020 31969185
454 OMIA:001564-9615 dog Greater Swiss Mountain Dog (Dog) Bleeding disorder, P2RY12-related P2RY12 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated CanFam3.1 23 g.45909987_45909989del c.516_518del p.(S173del) NM_001003365.1; NP_001003365.1; c.516_518delCTC; "a 3 base-pair deletion predicted to result in elimination of a serine from the extracellular domain was identified in the gene encoding P2RY12" 2011 21554368
103 OMIA:002031-9615 dog Lundehund (Dog) New Zealand Heading Dog (Dog) Lundehund syndrome P3H2 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 34 NC_006616.3:g.22046092C>G XM_535843.6:c.1849G>C XP_535843.2:p.(E617Q) XM_535843.6; XP_535843.2. Additional breeds based on PMID:40965331 2016 27485430
428 OMIA:001437-9913 taurine cattle Brown Swiss (Cattle) Beta-lactoglobulin, aberrant low expression PAEP substitution regulatory Naturally occurring variant Not currently evaluated ARS-UCD1.2 11 g.103255964C>A c.-215C>A "C to A transversion at position 215 bp upstream of the translation initiation site" rs5334475105 2006 17033029 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
1605 OMIA:001688-9796 domestic horse Purebred Spanish (Horse) Splashed white PAX3 SW10 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated EquCab3.0 6 NC_009149.3:g.11196181G>A XM_005610643.3:c.583C>T XP_005610700.1:p.(R195*) XM_005610643.3; XP_005610700.1; association with increased depigmentation, published as c.927C>T 2023 37406837
791 OMIA:001688-9796 domestic horse Lipizzan horse (Horse) Noric (Horse) Quarter Horse (Horse) Splashed white PAX3 SW2 substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 6 NC_009149.3:g.11199026C>T XM_001495160.4:c.209G>A XP_001495210.1:p.(C70Y) rs5334475189 2012 22511888 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
978 OMIA:001688-9796 domestic horse Appaloosa (Horse) Splashed white PAX3 SW4 substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 6 NC_009149.3:g.11199140G>C XM_001495160.4:c.95C>G XP_001495210.1:p.(P32R) rs5334475206 2013 23659293
1659 OMIA:001688-9685 domestic cat Maine Coon (Cat) Blue eye colour, dominant PAX3 DBE^RE substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 C1 NC_051841.1:g.205787310G>A XM_019838731.3:c.937C>T XP_019694290.1:p.(Q313*) 2024 38869246
1685 OMIA:001688-9685 domestic cat Celestial (Cat) Maine Coon (Cat) Siberian (Cat) Blue eye colour, dominant PAX3 DBE^CEL insertion, gross (>20) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 C1 NC_058375.1:g.205833101_205833102insN[395] 2024 38644700 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1704 OMIA:001688-9685 domestic cat Altai (Cat) British Longhair (Cat) British Shorthair (Cat) Persian (Cat) Ragdoll (Cat) Sphynx (Cat) Blue eye colour, dominant PAX3 DBE^ALT insertion, gross (>20) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 C1 NC_058375.1:g.205834854_205834855insN[433] 2024 38997957 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1811 OMIA:001688-9685 domestic cat Maine Coon (Cat) Blue eye colour, dominant PAX3 DBE^AGO deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Felis_catus 9.0 C1 NC_018730.3:g.207001835del XM_011285657.3:c.160del XP_011283959.1:p.(H54Tfs*108) 2025 40459211
1915 OMIA:003069-9823 pig Diabetes mellitus, PAX4-related PAX4 delins, small (<=20) nonsense (stop-gain) Genome-editing (CRISPR-Cas9) Not currently evaluated Sscrofa11.1 18 NC_010460.4:g.20678532_20678533delinsAA XM_021078737.1:c.908_909delinsAA XP_020934396.1:p.(W303*) 2026 42449928
1740 OMIA:002889-481883 Leopard gecko Skin colour, Mack Super Snow morph PAX7 mss deletion, small (<=20) Naturally occurring variant Not currently evaluated MPM_Emac_v1.0 17 NC_072806.1:g.1828552_1828564del 13-nucleotide deletion spans the last six nucleotides of exon 4 and the first seven nucleotides of intron 4 2024 38976731
583 OMIA:001575-9615 dog Gordon Setter (Dog) Irish Setter (Dog) Old Danish Pointing Dog (Dog) Polish Lowland Sheepdog (Dog) Polish Tatra Sheepdog (Dog) Poodle, Miniature (Dog) Poodle, Standard (Dog) Tibetan Terrier (Dog) Rod-cone dysplasia 4 PCARE insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 17 g.22907394_22907395insG c.3149_3150insC p.(C1051Vfs*90) NM_001284459.1; NP_001271388.1; genomic position adjusted based on HGVS 3' rule; EVA variant with equivalent alleles: rs397510935 rs1152388416 2013 22686255
1443 OMIA:002548-9913 taurine cattle Holstein Friesian (Cattle) Deficiency of haplotype HH35 PCDH15 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 26 NC_037353.1:g.5325675C>G XM_059881970.1:c.2599C>G XP_059737953.1:p.(L867V) XM_015460562.2; XP_015316048.2 rs469553146 2022 35361830
1885 OMIA:003048-9925 goat Bunte Deutsche Edelziege (Goat) Vestibular disease PCDH15 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS1 26 NC_030833.1:g.46369302G>A XM_005698150.2:c.415C>T XP_005698207.2:p.(R139*) 2026 41907450
1515 OMIA:002606-9615 dog Vizsla (Dog) skeletal dysplasia 3 PCYT1A substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 33 NC_049254.1:g.30067814A>G XM_038583131.1:c.673T>C XP_038439059.1:p.Y225H XM_038583131.1; XP_038439059.1 2022 36553621
1662 OMIA:002728-9615 dog Saarloos Wolfhond (Dog) PCYT2 deficiency PCYT2 substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 9 NC_049230.1:g.1207490A>G XM_038546296.1:c.4A>G XP_038402224.1:p.(I2V) XM_038546296.1; XP_038402224.1 2024 38277988
475 OMIA:001314-9615 dog Cardigan Welsh Corgi (Dog) Chinese Crested (Dog) Pomeranian (Dog) Rod-cone dysplasia 3 PDE6A deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 4 NC_006586.3:g.59145362del NM_001003073.1:c.1847del NP_001003073.1:p.(N616Tfs*29) NM_001003073.1; NP_001003073.1; published as c.1940delA (based on GenBank Z68340); variant initially identified in Cardigan Welsh Corgi and later reported in additional breeds: PMID:27525650 1999 10393029 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
582 OMIA:001669-9615 dog Sloughi (Dog) Rod-cone dysplasia 1a PDE6B insertion, small (<=20) nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 3 g.91747685_91747686insACTTCAGG c.2448_2449insTGAAGTCC p.(K817*) NM_001002934.2; NP_001002934.2; "an 8-bp insertion after codon 816" of the PDE6B gene 2000 11124530
528 OMIA:001674-9615 dog American Staffordshire Terrier (Dog) Cone-rod dystrophy 1 PDE6B deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated CanFam3.1 3 g.91747728_91747730del c.2404_2406del p.(802del) NM_001002934.1; NP_001002934.1 2013 24045995
1230 OMIA:002282-9615 dog Spanish Water Dog (Dog) PRA, PDE6B-related PDE6B deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated CanFam3.1 3 g.91749865_91749870del c.2218-2223del p.(F740_F741del) NM_001002934.1; NP_001002934.1 2020 32639685
282 OMIA:000882-9615 dog Irish Setter (Dog) Rod-cone dysplasia 1 PDE6B substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 3 NC_006585.3:g.91747713C>T NM_001002934.1:c.2421G>A NP_001002934.1:p.(W807*) NM_001002934.1; NP_001002934.1 1993 8387203
1022 OMIA:002163-9544 Rhesus monkey Cone dystrophy 4, PDE6C-related PDE6C substitution missense Naturally occurring variant Not currently evaluated Mmul_8.0.1 9 p.(R565Q) 2019 30667376
1841 OMIA:003012-9913 taurine cattle Holstein Friesian (Cattle) Dwarfism, primordial disproportionate and craniofacial dysmorphism PDGFRA substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 6 NC_037333.1:g.69749162T>C NM_001192345.2:c.1685T>C NP_001179274.1:p.(I562T) 2025 40999323
1820 OMIA:002972-9615 dog Bifid nose PDGFRA substitution splicing Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 13 NC_049234.1:g.47440160A>C XM_038556087.1:c.1122-2A>C 2025 40127928
281 OMIA:001406-9615 dog Clumber Spaniel (Dog) Sussex Spaniel (Dog) Pyruvate dehydrogenase deficiency PDP1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 29 NC_006611.3:g.38788845C>T XM_005638127.1:c.829C>T XP_005638184.1:p.(Q277*) XM_005638127.1; XP_005638184.1; published as c.754C>T, p.(Q252*); coordinates in the table have been updated to a recent reference genome and / or transcript 2007 17095275
966 OMIA:000913-9031 chicken Silkie (Chicken) Silky/Silkie feathering PDSS2 PDSS2(-103C-G) substitution regulatory Naturally occurring variant Not currently evaluated GRCg6a 3 g.67850419C>G c.-103C>G Feng et al. (2014): "a C to G transversion at 70,486,623 bp (ss666793747)" "The ss666793747 mutation is 103 bp upstream of the initiator codon ATG of PDSS2". The reported location was with respect to the galGal2 assembly. In the intervening years, ss666793747 has become rs316090093, from which the present location is taken. rs316090093 2014 25166907
1461 OMIA:002552-9940 sheep Pancreatic agenesis PDX1 deletion, gross (>20) Genome-editing (CRISPR-Cas9) Not currently evaluated Oar_rambouillet_v1.0 10 NC_040261.1:g.33940517_33940724del XM_027973895.1:c.195_403del XM_027973895.1; 208bp deletion 2017 29234093
1278 OMIA:002303-9685 domestic cat Cerebral dysgenesis PEA15 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 F1 NC_058384.1:64395109del XM_045049170.1:c.176del XP_044905105.1:p.(N59Tfs*29) published as felCat9 chrF1:66768323 GT -> G; c.176delA by Graff et al. (2020) rs5334475160 2020 33290415 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
820 OMIA:001827-9913 taurine cattle Montbéliarde (Cattle) Vorderwälder, Germany (Cattle) Abortion due to haplotype MH1 PFAS substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.27895397C>T NM_001256564.1:c.3613C>T NP_001243493.1:p.(R1205C) rs455876205 2017 28803020 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
271 OMIA:000421-9615 dog American Cocker Spaniel (Dog) English Springer Spaniel (Dog) Whippet (Dog) Glycogen storage disease VII PFKM substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 27 NC_006609.3:g.6620819C>T NM_001003199.1:c.2228G>A NP_001003199.1:p.(W473*) NM_001003199.1; NP_001003199.1 1996 8702726 Genomic and protein coordinates in CanFam3.1 provided by Robert Kuhn
45 OMIA:000421-9615 dog Deutscher Wachtelhund (Dog) Glycogen storage disease VII PFKM substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 27 NC_006609.3:g.6631627G>A NM_001003199.1:c.550C>T NP_001003199.1:p.(R184W) NM_001003199.1; NP_001003199.1 2012 22446493 Genomic coordinates in CanFam3.1 provided by Robert Kuhn and Zoe Shmidt.
1288 OMIA:001128-9823 pig Duroc (Pig) Pale soft exudative meat PHKG1 substitution splicing Naturally occurring variant Not currently evaluated Sscrofa11.1 3 NC_010445.4:g.16830320C>A NM_001293144.1:c.919-5C>A ENSSSCT00000008491.4:c.919-5C>A Ma et al. 2014: "a point mutation (C>A) in a splice acceptor site of intron 9, resulting in a 32-bp deletion in the open reading frame and generating a premature stop codon" rs330928088 2014 25340394
406 OMIA:001953-9913 taurine cattle Belgian Blue (Cattle) Arthrogryposis, lethal syndrome PIGH substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 10 NC_037337.1:g.79469727G>C NM_001038116.2:c.211-10C>G rs451004237 2015 25895751 Variant information gleaned from or confirmed by Table 1 of  Sharma et al. (2017) Animal Genetics 48(3):369-370
109 OMIA:002084-9615 dog Soft Coated Wheaten Terrier (Dog) Dyskinesia, paroxysmal, PIGN PIGN substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 1 NC_006583.3:g.14705240C>T XM_022415750.1:c.398C>T XP_022271458.1:p.(T133I) XM_022415750.1; XP_022271458.1 2016 27891564 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1305 OMIA:002324-9615 dog Parson Russell Terrier (Dog) Epilepsy, mitochondrial dysfunction and neurodegeneration PITRM1 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated CanFam3.1 2 NC_006584.3:g.32188565_32188570del XM_535200.6:c.172_177del XP_535200.2:p.(L58_S59del) Previously listed as ENSCAFT00000008673: c.175_180del; ENSCAFT00000008673.4:p.(L59_S60del) - updated to NCBI transcript [23_02_2026] 2021 33835239
1212 OMIA:002270-8932 rock pigeon Feathered shank PITX1 deletion, gross (>20) Naturally occurring variant Not currently evaluated "a 44-kb deletion (from 6.719–6.763 Mb)" (Domyan et al., 2016) 2016 26977633
1211 OMIA:002270-9031 chicken Feathered shanks PITX1 deletion, gross (>20) Naturally occurring variant Not currently evaluated GRCg6a 13 g.16089993_16107660del a 17.7kb deletion upstream of PITX1. 2020 32344431 32344429
232 OMIA:000649-9940 sheep Texel (Sheep) Microphthalmia PITX3 substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 22 NC_040273.1:g.25497953C>G NM_001178053.1:c.338G>C NP_001171524.1:p.(R113P) Oar_v3.1 position is g.22045744C>G 2010 20084168 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1404 OMIA:000807-9823 pig Polycystic kidney disease PKD1 PKD1^insG/+ insertion, small (<=20) Genome-editing (CRISPR-Cas9) Not currently evaluated 3 c.152_153insG 2022 34980882
1406 OMIA:000807-9823 pig Polycystic kidney disease PKD1 PKD1^Tins/+ insertion, small (<=20) Genome-editing (ZFN) Not currently evaluated 3 c.642_643insT 2015 25798056
1405 OMIA:000807-9823 pig Polycystic kidney disease PKD1 PKD1^TGCTins/+ insertion, small (<=20) Genome-editing (ZFN) Not currently evaluated 3 c.642_643insTGCT 2015 25798056
1883 OMIA:000807-9541 crab-eating macaque Polycystic kidney disease PKD1 substitution missense Naturally occurring variant Not currently evaluated XM_015442355.1:c.1144G>C p.(E382Q) 2023 36876010
72 OMIA:000807-9615 dog Bull Terrier (Dog) Polycystic kidney disease PKD1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 6 NC_006588.3:g.38856816G>A NM_001006650.1:c.9772G>A NP_001006651.1:p.(E3258K) rs397509460 2011 21818326 Variant coordinates were initially obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool but updated to recent transcripts [1/8/2026]
1610 OMIA:000807-9685 domestic cat Scottish Fold (Cat) Polycystic kidney disease PKD1 delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 E3 NC_058383.1:g.39421688del XM_023247051.2 c.4923del XP_023102819.2 p.(G1641fs) variant reported in a single cat, published as  c.5250delC/p.(G1641fs)  - updated to recent transcript information [11/07/2025] 2023 37489504 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1611 OMIA:000807-9685 domestic cat American Shorthair (Cat) Polycystic kidney disease PKD1 substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 E3 NC_058383.1:g.39423246C>T XM_023247051.2:c.6481C>T XP_023102819.2:p.(R2161W) variant reported in a single cat, published as c.6808C>T, p.(R2162W) - updated to recent transcript information [11/07/2025] 2023 37489504 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
314 OMIA:000807-9685 domestic cat American Shorthair (Cat) Exotic Shorthair (Cat) Himalayan (Cat) Maine Coon (Cat) Munchkin (Cat) Persian (Cat) Ragdoll (Cat) Scottish Fold (Cat) Scottish Straight (Cat) Siberian (Cat) Sphynx (Cat) Polycystic kidney disease PKD1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 E3 NC_058383.1:g.39431089C>A XM_023247051.2:c.9864C>A XP_023102819.2:p.(C3288*) This variant was published as c.10063C>A, p.(C3284*) and was previously listed here as c.9882C>A/p.(C3294*) - updated to recent transcript information [11/07/2025] rs5334475162 2004 15466259 The varaint has been initially identified in Persian cats but has since been reported in other breeds, e.g. PMID:31155548; PMID:37489504; PMID:35709088; PMID:39486512. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1585 OMIA:000807-9615 dog Lagotto Romagnolo (Dog) Polycystic kidney disease PKD1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 6 NC_049227.1:g.39295382G>T NM_001006650.1:c.7195G>T NP_001006651.1:p.(E2399*) 2023 37372390
1523 OMIA:002525-9823 pig PKD2 overexpression PKD2 insertion, gross (>20) Genome-editing (CRISPR-Cas9) Not currently evaluated insertion of transgene vector pCAG-muhPKD2 (c.1532A > T/p.511D > V)-3 × FLAG-floxP-neo-pH11 into the pH11 safe harbor site 2022 36452154
1424 OMIA:002525-9685 domestic cat Siberian (Cat) Polycystic kidney disease 2 PKD2 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.132521077del XM_011281830.4:c.2211del XP_011280132.2:(p.K737Nfs*2) published as c.2211delG 2021 33785770 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
898 OMIA:000844-9615 dog West Highland White Terrier (Dog) Pyruvate kinase deficiency of erythrocyte PKLR duplication duplication (in-frame) Naturally occurring variant Not currently evaluated CanFam3.1 7 g.42269752_42269757dup c.1333_1338dup p.(K445_T446dup) NM_001256018.1; NP_001242947.1; the original publication described "a 6 base pair insertion in exon 10". In accordance with HGVS recommendations, the variant is annotated in this table as a 6 bp duplication and updated a recent reference sequences. This shifts the position of the predicted amino acid change by about 21 amino acids. 1999 10490091
897 OMIA:000844-9615 dog Basenji (Dog) Pyruvate kinase deficiency of erythrocyte PKLR deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 7 NC_006589.3:g.42267825del NM_001256262.1:c.433del NP_001243191.1:p.(P145Rfs*23) 1994 7520391
896 OMIA:000844-9615 dog Labrador Retriever (Dog) Pyruvate kinase deficiency of erythrocyte PKLR substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 7 NC_006589.3:g.42268632C>T NM_001256262.1:c.799C>T NP_001243191.1:p.(Q267*) 2012 22805166 20181218 Thanks to Maarten de Groot for advising FN of the genomic location
894 OMIA:000844-9615 dog Pug (Dog) Pyruvate kinase deficiency of erythrocyte PKLR substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 7 NC_006589.3:g.42268681T>C NM_001256262.1:c.848T>C NP_001243191.1:p.(V283A) 2012 22805166
1860 OMIA:000844-9615 dog Miniature Schnauzer (Dog) Pyruvate kinase deficiency of erythrocyte PKLR substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 7 NC_006589.3:g.42268906G>T NM_001256262.1:c.975G>T NP_001243191.1:p.(F323Cfs*4) The premature stop codon is predicted to alter pre-mRNA splicing through a mechanism known as nonsense-associated altered splicing resulting in skipping of exon 8 and a frameshift.  2025 41463922
895 OMIA:000844-9615 dog Beagle (Dog) Pyruvate kinase deficiency of erythrocyte PKLR substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 7 NC_006589.3:g.42268927G>A NM_001256262.1:c.994G>A NP_001243191.1:p.(G332S) 2012 22805166
899 OMIA:000844-9685 domestic cat Abyssinian (Cat) Bengal (Cat) Caracal (Cat) Chausie (Cat) Egyptian Mau (Cat) European Shorthair (Cat) Highlander (Cat) Highlander Shorthair (Cat) LaPerm (Cat) Lykoi (Cat) Maine Coon (Cat) Maine Coon Polydactyl (Cat) Minuet Longhair (Cat) Munchkin (Cat) Neva Masquerade (Cat) Norwegian Forest Cat (Cat) Pixiebob Longhair (Cat) Savannah (Cat) Siberian (Cat) Singapura (Cat) Toyger (Cat) Pyruvate kinase deficiency of erythrocyte PKLR substitution splicing Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 F1 NC_058384.1:g.67876039G>A XM_023247386.2:c.707-53G>A XM_023247386.1:c.707-53G>A; published as c.693+304G>A rs5334475134 2012 23110753 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770); Grahn et al. (2012) reported that the variant is present in many breeds and suggested genotyping in Bengals, Egyptian Maus, La Perms, Maine Coon cats, Norwegian Forest cats, Savannahs, Siberians, and Singapuras. Additional breeds reported based on PMID:35709088. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
417 OMIA:001864-9615 dog Chesapeake Bay Retriever (Dog) Golden Retriever (Dog) Ectodermal dysplasia/skin fragility syndrome PKP1 substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 7 NC_006589.3:g.1966531C>G NM_001287161.1:c.202+1G>C 2012 22384142 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1670 OMIA:001701-60463 Fischer's lovebird Feather colour, blue PKS substitution missense Naturally occurring variant Not currently evaluated c.1930C>T p.(R644W) 2024 38528953
1671 OMIA:001701-60466 yellow-collared lovebird Feather colour, blue PKS substitution missense Naturally occurring variant Not currently evaluated c.1930C>T p.(R644W) 2024 38528953
1863 OMIA:001701-9228 Rose-ringed parakeet Feather colour, blue PKS substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.2005G>T p.(E668*) 2025 39820005
1865 OMIA:001701-232655 Alexandrine parakeet Feather colour, blue PKS substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.2647A>T p.(K883*) 2025 39820005
1864 OMIA:001701-9228 Rose-ringed parakeet Feather colour, blue PKS substitution missense Naturally occurring variant Not currently evaluated c.334G>A p.(G112R) 2025 39820005
1867 OMIA:001701-176024 Eclectus parrot Feather colour, blue PKS substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.5869C>T p.(H1957*) 2025 39820005
1866 OMIA:001701-232655 Alexandrine parakeet Feather colour, blue PKS substitution missense Naturally occurring variant Not currently evaluated c.727G>A p.(R243K) 2025 39820005
1868 OMIA:001701-176039 galah Feather colour, blue PKS haplotype missense Naturally occurring variant Not currently evaluated c.[1284T>C;2374A.G] p.[(N428K;T792A)] 2025 39820005
113 OMIA:002105-9615 dog Papillon (Dog) Neuroaxonal dystrophy, PLA2G6-related PLA2G6 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 10 NC_006592.3:g.26544820G>A XM_005625890.3:c.1579G>A XP_005625947.1:p.(T527A) 2017 28107443 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1267 OMIA:002105-9940 sheep Swaledale, United Kingdom of Great Britain and Northern Ireland (Sheep) Neuroaxonal dystrophy, PLA2G6-related PLA2G6 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 3 NC_040254.1:g.230750869G>A XM_027968104.1:c.1186C>T XP_027823905.1:p.(Q396*) Oar_rambouillet_v1.0: g.230750869G>A; XM_027968104.1 [shorter transcript] and XM_012175630.3 [longer transcript]: c.1186C>T; XP_027823905.1: p.Gln396* in the shorter transcript; XP_012031020.2: p.Leu396Phe in the longer transcript (Letko et al., 2020). Only the former variant peptide is tabulated here. 2021 33159255
1266 OMIA:002105-9940 sheep Swaledale, United Kingdom of Great Britain and Northern Ireland (Sheep) Neuroaxonal dystrophy, PLA2G6-related PLA2G6 substitution splicing Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 3 NC_040254.1:g.230766713T>C XM_004006987.4:c.336-2A>G XP_012031020.2:p.(L71Wfs*3) 2021 33159255
339 OMIA:001935-9913 taurine cattle Simmental (Cattle) Zinc deficiency-like syndrome PLD4 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.2 21 g.69352995G>A c.702G>A p.(W234*) UMD3.1 position is g.71001232G>A rs378824791 2014 25052073 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; rsID gleaned from or confirmed by Table 1 of  Sharma et al. (2017) Animal Genetics 48(3):369-370. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
351 OMIA:002080-9615 dog Eurasier (Dog) Epidermolysis bullosa, simplex, PLEC PLEC substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 13 NC_006595.3:g.37461941C>T XM_539204.6:c.3947G>A XP_539204.2:p.(W1316*) CanFam3 chr13: g.37461941G>A; XM_539204.6:c.3947G>A; XP_539204.2:p.Trp1316Stop: 2016 27878870 Updated variant coordinates kindly provided by Tosso Leeb on 8 May 2020
412 OMIA:002020-9615 dog Scottish Terrier (Dog) Ligneous membranitis PLG substitution splicing Naturally occurring variant Not currently evaluated 1 c.1256+2T>A possibly NM_001286960.1 c.1262+2T>A; CanFam3.1 g.49514382A>T 2015 26360520
1338 OMIA:002020-9615 dog Maltese (Dog) Ligneous membranitis PLG deletion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 1 g.49534880_49540865del c.-5645_49+292del XM_005615560.1; a deletion of 5986 bp involving exon 1 and the flanking region 2021 34370320
1078 OMIA:002195-9615 dog Welsh Springer Spaniel (Dog) Cardiomyopathy, dilated, PLN-related PLN substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 1 NC_006583.3:g.58588129G>A NM_001003332.1:c.26G>A NP_001003332.1:p.(R9H) Changed from g.58588129C>T to g.58588129G>A [09/06/2025] 2019 30794913 c. coordinate kindly provided by Tosso Leeb
165 OMIA:001982-9796 domestic horse Thoroughbred (Horse) Warmblood (Horse) Fragile Foal Syndrome PLOD1 substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 2 NC_009145.3:g.39927817C>T XM_001491331.6:c.2032G>A XP_001491381.1:p.(G678R) rs1136065234 2015 25637337 rsID and Variant coordinates obtained from Zhang et al. (2020): "g.39927817C>T (rs1136065234; NC_009145.3, Equ-Cab3.0)" c. and p. coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
248 OMIA:000770-9986 rabbit Chinchilla (Rabbit) Tremor, X-linked PLP1 pt substitution missense Naturally occurring variant Not currently evaluated X T>A 1994 7525875
82 OMIA:000770-9615 dog Springer Spaniel (Dog) Tremor, X-linked PLP1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 X NC_006621.3:g.77200833A>C NM_001013334.2:c.110A>C NP_001013856.1:p.(H37P) 1990 1723945 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1879 OMIA:000770-9615 dog English Cocker Spaniel (Dog) Tremor, X-linked PLP1 substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 X NC_049260.1:g.77750774T>A NM_001013834.2:c.92T>A NP_001013856.1:p.(L31Q) 2026 41701830
1493 OMIA:002578-9913 taurine cattle Holstein (black and white) (Cattle) Mast cell tumour, congenital PLP2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 X NC_037357.1:g.87216480C>T NM_203363.1:c.50C>T NP_976239.1:p.(T17I) NM_203363.1; XP_005642144.1 2022 36139188
697 OMIA:000211-9615 dog Classic Merle PMEL M insertion, gross (>20) Naturally occurring variant Not currently evaluated 10 "an insertion of a tRNA-derived SINE . . . . The insertion occurs at the boundary of intron 10 and exon 11 and is flanked by a 15-bp target site duplication . . . . The SINE insertion is in reverse orientation, with the 5' end closer to exon 11." Allele M (265-269bp); phenotype = Classic Merle = "standard" of Murphy et al. (2018) 2006 16407134
1103 OMIA:000211-9615 dog No Merle pattern - solid coat PMEL Mc insertion, gross (>20) Naturally occurring variant Not currently evaluated 10 Mc (208-230bp); phenotype = No Merle pattern – solid coat; = "cryptic" of Murphy et al. (2018) 2018 30235206
1104 OMIA:000211-9615 dog No Merle pattern - solid coat PMEL Mc+ insertion, gross (>20) Naturally occurring variant Not currently evaluated 10 Mc+ (231-245bp); phenotype = No Merle pattern – solid coat; = "cryptic" of Murphy et al. (2018) 2018 30235206
1105 OMIA:000211-9615 dog No Merle pattern - diluted - brownish hue PMEL Ma insertion, gross (>20) Naturally occurring variant Not currently evaluated 10 Ma (247-254bp); phenotype = No Merle pattern – diluted–brownish hue; = "cryptic" of Murphy et al. (2018) 2018 30235206
1106 OMIA:000211-9615 dog Muted, undefined, diluted - brownish hue PMEL Ma+ insertion, gross (>20) Naturally occurring variant Not currently evaluated 10 Ma+ (255-264bp); phenotype = Muted, undefined, diluted–brownish hue = "dilute" of Murphy et al. (2018) 2018 30235206
1107 OMIA:000211-9615 dog Minimal Merle, areas deleted to white, tweed PMEL Mh insertion, gross (>20) Naturally occurring variant Not currently evaluated 10 Mh (269-277bp); phenotype = Minimal Merle, areas deleted to white, tweed = "harlequin" of Murphy et al. (2018) 2018 30235206
540 OMIA:001545-30521 domestic yak Coat colour, dilution PMEL deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated c.50_52del p.(L18del) 2014 24989079
1071 OMIA:002191-93934 Japanese quail Yellowish plumage PMEL substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated g.811370G>A p.(W149*) Ishishita et al. (2018): g.811370G>A (NC_029544.1); Trp149* 2018 30425278
1909 OMIA:002884-31155 adder Colour patter, dorsal stripe PMEL substitution missense Naturally occurring variant Not currently evaluated 2 KN633923.1:g.55190G>A p.(G206S) 2026 42360275
1166 OMIA:001544-9913 taurine cattle Rat-tail syndrome PMEL deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.2 5 g.57345302_57345304del c.50_52del p.(L19del) rs385468954 2016 27037038
484 OMIA:001545-9913 taurine cattle Charolais (Cattle) Galloway (Cattle) Hereford (Cattle) Highland (Cattle) Japanese Brown, Japan (Cattle) Simmental (Cattle) Coat colour, dilution PMEL deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 g.57345303_57345305del NM_001080215.2:c.53_55del NP_001073684.2:p.(L19del) Published as 'three-base (CTT) deletion at nucleotide 54 in exon 1 of the PMel17 gene'; previously listed in OMIA as ARS-UCD1.2:g.57345302_57345304del, c.50_52del, p.(L19del) based on the inforamtion provided by "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170); updated to reflect HGVS recommendation (3'-rule) on [03/09/2024] rs385468954 2008 18408794
774 OMIA:001545-9913 taurine cattle Charolais (Cattle) Coat colour, dilution PMEL substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.57345315G>A NM_001080215.2:c.64G>A NP_001073684.2:p.(G22R) rs718553050 2007 17705851 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
903 OMIA:001438-9796 OMIA:000733-9796 domestic horse American Miniature Horse (Horse) Ardennes (Horse) Comtois (Horse) Icelandic Horse (Horse) Missouri Fox Trotter, Germany (Horse) Morgan (Horse) Rocky Mountain, United States of America (Bighorn sheep) Shetland Pony (Horse) Coat colour, silver AND Multiple congenital ocular anomalies PMEL substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 6 NC_009149.3:g.74569773G>A NM_001163889.1:c.1849C>T NP_001157361.1:p.(R617C) NM_001163889.1; NP_001157361.1; previously listed in OMIA as g.73665304 and published a C (wild type) to T (Silver) transition, p.Arg618Cys, as well as p.(R625C); coordinates in this table have been updated to a recent reference genome and / or transcript rs3448111155 2006 17029645 The genomic position in EquCab3.0 was provided by Mary Katherine Easterwood, working under the guidance of Professor Ernie Bailey in April 2022. Breed information updated based on PMID: 38600096
600 OMIA:000373-9031 chicken White Leghorn (Chicken) Feather colour, dominant white PMEL I insertion, small (<=20) insertion (in-frame) Naturally occurring variant Not currently evaluated GRCg6a 33 g.7095476_7095477insCTGGGCACC c.2021_2022insCTGGGCACC p.(L674_L675insWAP) ENSGALT00000077972.2; ENSGALP00000051268.2; published as a 9-bp (3aa) insertion (WAP) in exon 10; AY636127 2004 15579702
601 OMIA:000373-9031 chicken Feather colour, Dun PMEL D delins, small (<=20) delins (in-frame) Naturally occurring variant Not currently evaluated GRCg6a 33 g.7095492_7095507delinsC c.2037_2052delinsC p.(L680_A684del) ENSGALT00000077972.2; ENSGALP00000051268.2; published as "a deletion of five amino acids [LGTAA] in the transmembrane region"; AY636129 2004 15579702
602 OMIA:000373-9031 chicken White Leghorn (Chicken) Feather colour, Smoky PMEL S haplotype Naturally occurring variant Not currently evaluated GRCg6a 33 g.[7093782_7093793del;7095476_7095477insCTGGGCACC] c.[839_850del;2021_2022insCTGGGCACC] p.[(P280_T283del;L674_L675insWAP)] ENSGALT00000077972.2; ENSGALP00000051268.2; published as a 9-bp insertion in exon 10 shared with Dominant white and a deletion of 12 nucleotides in exon 6, eliminating four amino acids (PTVT); AY636128 2004 15579702
1736 OMIA:002884-94885 corn snake Skin colour, Terrazzo PMEL tz haplotype splicing Naturally occurring variant Not currently evaluated UNIGE_PanGut_3.0 NW_023010713:g.[13272041A>T;13272043G>C] XM_034412587.1:c.[1594C>G;1594+2T>A] "a multi-nucleotide polymorphism, from ACG to TCC (Super-scaffold 85; position 13,272,041) falls at the end of exon 8 (one nucleotide – A to T) and on the donor site of intron 8 of the Premelanosome Protein (PMEL) gene (two nucleotides – CG to CC)" 2024 39227572
1054 OMIA:002183-9823 pig Landrace (Pig) Embryonic lethality PNKP substitution missense Naturally occurring variant Not currently evaluated Sscrofa11.1 6 NC_010448.4:g.54880241T>C XM_005664749.3:c.287A>G XP_005664806.3:p.(Q96R) Derks et al. (2019): "deleterious missense mutation in the PNKP gene (6:g.54880241G>T), predicted to be strongly deleterious by SIFT (0.02) and PROVEAN (-2.9). The missense mutation causes a glutamine to arginine amino acid substitution (ENSSSCP00000003467:p.Gln96Arg)" rs5334475176 2019 30875370
616 OMIA:001588-9615 dog Golden Retriever (Dog) Ichthyosis, PNPLA1-related PNPLA1 delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 12 g.5417388_5417390delinsTACTACTA c.1445_1447delinsTACTACTA p.(N482Ifs*11) NM_001290109.2; NP_001277038.2 2012 22246504
1775 OMIA:001588-9615 dog Labrador Retriever (Dog) Ichthyosis, PNPLA1-related PNPLA1 duplication frameshift Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 12 NC_049233.1:g.5596853_5602951dup NM_001290109.2:c.1361_1671dup NP_001277038.2:p.(E558Lfs*17) 2025 40150930
765 OMIA:000827-9913 taurine cattle Brown Swiss (Cattle) Carora, Venezuela (Bolivarian Republic of) (Cattle) Progressive degenerative myeloencephalopathy (Weaver syndrome) PNPLA8 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 4 NC_037331.1:g.49600585C>T XM_005205444.4:c.1703G>A XP_005205501.2:p.(S568N) rs800397662 2016 26992691 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1470 OMIA:000827-9615 dog Australian Shepherd (Dog) hereditary ataxia PNPLA8 duplication frameshift Naturally occurring variant Not currently evaluated CanFam3.1 18 g.12143242_12143243dup c.1169_1170dup p.(H391Ffs*4) XM_005630935.2; XP_005630992.1 2022 35864734
845 OMIA:000483-30521 domestic yak Polled, Mongolian allele POLLED P[sub]M or P[sub]219ID complex rearrangement Naturally occurring variant Not currently evaluated "a complex 219-bp duplication-insertion (P219ID) beginning at 1,976,128 bp and a 7-bp deletion and 6-bp insertion (P1ID) located 621 bp upstream of this position . . . . This rearrangement results in duplication of an 11-bp motif (5'-AAAGAAGCAAA-3') that is entirely conserved among Bovidae . . . and that is also duplicated in the 80-kb duplication responsible for Friesian polledness" 2017 28135247
1070 OMIA:000483-9913 taurine cattle Nelore (Cattle) Polled, Guarani POLLED P[sub]G duplication Naturally occurring variant Not currently evaluated ARS-UCD1.2 1 g.2614828_2724315dup "a novel duplication variant" in the region BTA1:1,893,790–2,004,553 (Utsunomiya et al., (2019) 2019 30644114 Randhawa et al. (2019): ARS-UCD1.2 g.2614828_2724315dup
867 OMIA:000483-9913 taurine cattle Holstein (black and white) (Cattle) Polled, Friesian POLLED P[sub]F OR P(sub)80kbID duplication Naturally occurring variant Not currently evaluated ARS-UCD1.2 1 g.2629113_2709240dup 2013 23717440 In relation to assembly UMD v3.1.1, Utsunomiya et al. (2019) described this variant as "a duplication of CHR1:1,909,352–1,989,480". Randhawa et al. (2019): ARS-UCD1.2 g.2629113_2709240dup
866 OMIA:000483-9913 taurine cattle Brahman (Cattle) Polled, Celtic POLLED P[sub]C OR P[sub]202ID complex rearrangement Naturally occurring variant Not currently evaluated ARS-UCD1.2 1 g.[2429327_2429336del;2429109_2429320dupins] UMD3.1: g.1706051_1706060 delins170583 2012 22737241 Coordinates in OMIA were previously shown based on Randhawa et al. (2019) as ARS-UCD1.2 g.[22429326_2429335del;2429109_2429320dupins]. After review of the original publication the coordinates have been corrected in OMIA to g.[2429327_2429336del;2429109_2429320dupins] [18/9/2022]
844 OMIA:000483-9913 taurine cattle Kazakh (Cattle) Polled, Mongolian POLLED P[sub]M OR P[sub]219ID complex rearrangement Naturally occurring variant Not currently evaluated ARS-UCD1.2 1 g.[2695261_2695267delinsTCTGAA;2695889_2696047dupins] "a complex 219-bp duplication-insertion (P219ID) beginning at 1,976,128 bp and a 7-bp deletion and 6-bp insertion (P1ID) located 621 bp upstream of this position . . . . This rearrangement results in duplication of an 11-bp motif (5'-AAAGAAGCAAA-3') that is entirely conserved among Bovidae . . . and that is also duplicated in the 80-kb duplication responsible for Friesian polledness" In relation to assembly UMD v3.1.1, Utsunomiya et al. (2019) described this variant as "a complex duplication starting at CHR1:1,976,128". 2017 28135247 Randhawa et al. (2019): ARS-UCD1.2 g.[2695261_2695267delinsTCTGAA;2695889_2696047dupins]
1052 OMIA:002181-9823 pig Landrace (Pig) Embryonic lethality POLR1B substitution splicing Naturally occurring variant Not currently evaluated Sscrofa11.1 3 NC_010445.4:g.43952776T>G Derks et al. (2019): "Skipping of exon 14 introduces a glutamic acid and a premature stop codon in the second codon of the terminal exon, lacking the final 370 amino acids located in the conserved subunit 2, hybrid-binding domain (binding to the DNA strand)" rs5334475168 2019 30875370
1291 OMIA:002315-9615 dog Karelian Bear Dog (Dog) Pituitary dwarfism POU1F1 substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 31 NC_006613.3:g.784534C>A NM_001006949.1:c.605-3C>A Kyöstilä et al. (2021) "the NNSPLICE 0.9 splice prediction tool (Reese et al. 1997) predicted this variant to weaken the splice acceptor of POU1F1 intron 4 from a score of 0.97 to 0.67." 2021 33550451
157 OMIA:000327-9796 domestic horse Quarter Horse (Horse) Ehlers-Danlos syndrome PPIB substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 1 NC_009144.3:g.129307092G>A NM_001099761.1:c.115G>A NP_001093231.1:p.(G39R) rs396329681 2007 17498917 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
588 OMIA:000161-9913 taurine cattle Polled Hereford (Cattle) Cardiomyopathy and woolly haircoat syndrome PPP1R13L duplication frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 18 g.53013747_53013753dup c.956-962dupACAGGCG p.(G335Efs*36) 2009 19016676 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1068 OMIA:001311-9615 dog Miniature Schnauzer (Dog) Photoreceptor dysplasia PPT1 PPT1^dci complex rearrangement Naturally occurring variant Not currently evaluated CanFam3.1 15 g.2874661_2875048con2877563_2877607inv 2019 30541930
579 OMIA:001504-9615 dog Dachshund (Dog) Neuronal ceroid lipofuscinosis, 1 PPT1 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 15 g.2883477_2883478insC c.736_737insC p.(F246Lfs*29) NM_001010944.1; NP_001010944.1 2010 20494602 p. information obtained from Katz et al. (2017) Neurobiol Dis. doi: 10.1016/j.nbd.2017.08.017; genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn.
423 OMIA:001504-9615 dog Italian Cane Corso (Dog) Neuronal ceroid lipofuscinosis, 1 PPT1 substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 15 NC_006597.3:g.2860424G>A NM_001010944.1:c.124+1G>A 2017 28008682
1353 OMIA:001504-9940 sheep Neuronal ceroid lipofuscinosis, 1 PPT1 delins, small (<=20) nonsense (stop-gain) Genome-editing (CRISPR-Cas9) Not currently evaluated Oar_rambouillet_v1.0 1 NC_040252.1:g.15235231_15235231delinsTTA XP_004001885.2:p.(R151*) 2019 31289301
76 OMIA:001298-9615 dog American Cocker Spaniel (Dog) Australian Cattle Dog (Dog) Australian Shepherd (Dog) Australian Stumpy Tail Cattle Dog (Dog) Chesapeake Bay Retriever (Dog) Chihuahua (Dog) Chinese Crested (Dog) English Cocker Spaniel (Dog) Entlebucher Mountain Dog (Dog) Finnish Lapphund (Dog) Golden Retriever (Dog) Karelian Bear Dog (Dog) Kuvasz (Dog) Labrador Retriever (Dog) Lapponian Herder (Dog) Norwegian Elkhound (Dog) Nova Scotia Duck Tolling Retriever (Dog) Poodle, Miniature (Dog) Poodle, Toy (Dog) Portuguese Podengo (Dog) Portuguese Water Dog (Dog) Spanish Water Dog (Dog) Swedish Lapphund (Dog) Swedish White Elkhound (Dog) Yorkshire Terrier (Dog) Progressive rod-cone degeneration PRCD substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 9 NC_006591.3:g.4188663C>T XM_022422503.1:c.5G>A XP_022278211.1:p.(C2Y) ENSCAFT00845030294.1; ENSCAFP00845023755.1; ROS_Cfam_1.0:g.4864649C>T; Portuguese Podengo and Swedish White Elkhound were reported in PMID: 37582787 rs852451717 2006 16938425 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1840 OMIA:003013-9913 taurine cattle Angus (Cattle) Dwarfism, primordial disproportionate PRDM10 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 29 NC_037356.1:g.36138136G>A NM_001191168.1:c.866C>T NP_001178097.1:p.(P289L) 2025 40999323
1553 OMIA:002693-9940 sheep Cheviot (Sheep) Achondroplasia, PRICKLE1-related PRICKLE1 deletion, small (<=20) Naturally occurring variant Not currently evaluated 3 10 bp deletion in the open reading frame 2016 Reference not in PubMed; see OMIA 002693-9940 for reference details
175 OMIA:001085-9823 pig Meat quality (Rendement Napole) PRKAG3 RN- substitution missense Naturally occurring variant Not currently evaluated Sscrofa11.1 15 NC_010457.5:g.120863533C>T NM_214077.1:c.749G>A NP_999242.1:p.(R250Q) The paper by Milan et al. (2000) reported this variant as c.599G>A and p.R200Q rs1109104772 2000 10818001 The genomic location on Sscrofa11.1 was determined and the effect was confirmed with Ensembl VEP in the following transcript: ENSSSCT00000017641.4 by Stephanie Shields (27/05/2020)
176 OMIA:001085-9823 pig Meat quality (Rendement Napole) PRKAG3 RN- substitution missense Naturally occurring variant Not currently evaluated Sscrofa11.1 15 NC_010457.5:g.120863537C>T NM_214077.1:c.745G>A NP_999242.1:p.(V249I) Pigs that are homozygous for the p.I249 have less glycogen in the muscle. rs1108399077 2001 11729159 The genomic location on Sscrofa11.1 was determined and the effect was confirmed with Ensembl VEP in the following transcript: ENSSSCT00000017641.4 by Stephanie Shields (27/05/2020)
283 OMIA:000220-9615 dog Jack Russell Terrier (Dog) Severe combined immunodeficiency disease, autosomal PRKDC substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 29 NC_006611.3:g.49588C>A NM_001006651.2:c.10849G>T NP_001006652.2:p.(E3617*) NM_001006651.2; NP_001006652.2 ; published as c.10879G>T; p.(E3627*); coordinates in the table have been updated to a recent reference genome and / or transcript 2002 11867233
511 OMIA:000220-9796 domestic horse Arab (Horse) Severe combined immunodeficiency disease, autosomal PRKDC deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated EquCab3.0 9 NC_009152.3:g.36395752_36395756del NM_001163858.1:c.9478_9482del NP_001157330.1:p.(N3160fs*3) A 5bp deletion giving rise to a frameshift in PRKDC The following details (from which the coordinate fields were populated) were provided by Meredith O’Connell, Tanya German, Isabella Pisani and Karalie Andrews, under the supervision of Professor Ernie Bailey. 20 Feb 2019 NC_009152.3 g.36395752-36395976del; NM_001163858 c.9478_9482del; NP_001157330 p.N3160fs*3. The g. coordinates were previously listed incorrectly in this table
as g.36395752_36395759del [03/06/2024]
1997 9103416
291 OMIA:001485-9913 taurine cattle Angus (Cattle) Dwarfism, Angus PRKG2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.2 6 g.95896205G>A c.1573C>T p.(R525*) rs109639251 2009 19887637 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
352 OMIA:001485-9913 taurine cattle Angus (Cattle) Dwarfism, Angus PRKG2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 6 NC_037333.1:g.95896205G>A NM_001144099.1:c.2032C>T NP_001137571.1:p.(R678*) ENSBTAT00000003877.4:c.2032C>T ENSBTAP00000003877.4:p.Arg678Ter rs109639251 2009 19887637 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
1373 OMIA:001485-9615 dog Dogo Argentino (Dog) Dwarfism, disproportionate PRKG2 substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 32 NC_006614.3:g.5299068C>A XM_022413533.1:c.1634+1G>T cDNA position based on XM_022413533.1 2021 34680883
1857 OMIA:001485-9615 dog Dalmatian (Dog) Dwarfism, disproportionate PRKG2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 32 NC_049253.1:g.34701558T>G XM_038582312.1:c.1601T>G XP_038438240.1:p.(L534*) 2025 41296694
216 OMIA:000441-9913 taurine cattle Holstein Friesian (Cattle) Jersey (Cattle) Simmental (Cattle) Hairy PRL substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 23 NC_037350.1:g.35332871A>C NM_173953.2:c.661A>C NP_776378.2:p.(C221G) ENSBTAT00000020313.4:c.661T>G ENSBTAP00000020313.3:p.Cys221Gly rs520582588 2014 25519203 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
719 OMIA:000380-9031 chicken Feathering, Z-linked PRLR duplication Naturally occurring variant Not currently evaluated Z The tandem duplication of this region results in the partial duplication of two genes; the prolactin receptor and the gene encoding sperm flagellar protein 2. 2008 18713476
1447 OMIA:001372-9913 taurine cattle Criollo Lechero Tropical, Mexico (Cattle) Slick hair PRLR SLICK4 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 20 NC_037347.1:g.39099113C>G NM_001039726.2:c.1281C>G NP_001034815.1:p.(Y427*) 2021 33259090
544 OMIA:001372-9913 taurine cattle Blanco Orejinegro, Colombia (Cattle) Carora, Venezuela (Bolivarian Republic of) (Cattle) Chino Santandereano, Colombia (Cattle) Costeno con Cuernos (Cattle) Criollo Caqueteño, Colombia (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) Romosinuano, Venezuela (Bolivarian Republic of) (Cattle) Senepol (Cattle) Tropicarne, Mexico (Cattle) Slick hair PRLR SLICK1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 20 NC_037347.1:g.39099214del NM_001039726.2:c.1382del NP_001034815.1:p.(A461Vfs*2) rs517047387 2014 25519203 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; some variant information gleaned from or confirmed by Table 1 of Sharma et al. (2017) Animal Genetics 48(3):369-370, breed infromation updated based on PMID:39377537
974 OMIA:001372-9913 taurine cattle Criollo Lechero Tropical, Mexico (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) Slick hair PRLR SLICK3 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 20 NC_037347.1:g.39099226C>A NM_001039726.2:c.1394C>A NP_001034815.1:p.(S465*) rs5334474999 2018 29527221 Breed infromation updated based on PMID:39377537
1448 OMIA:001372-9913 taurine cattle Blanco Orejinegro, Colombia (Cattle) Carora, Venezuela (Bolivarian Republic of) (Cattle) Chino Santandereano, Colombia (Cattle) Costeno con Cuernos (Cattle) Criollo Caqueteño, Colombia (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) Romosinuano, Venezuela (Bolivarian Republic of) (Cattle) Slick hair PRLR SLICK5 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 20 NC_037347.1:g.39099228A>T NM_001039726.2:c.1396A>T NP_001034815.1:p.(K466*) 2021 33259090 Breed infromation updated based on PMID:39377537
1449 OMIA:001372-9913 taurine cattle Carora, Venezuela (Bolivarian Republic of) (Cattle) Costeno con Cuernos (Cattle) Criollo Caqueteño, Colombia (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) Romosinuano, Venezuela (Bolivarian Republic of) (Cattle) Senepol (Cattle) Tropicarne, Mexico (Cattle) Slick hair PRLR SLICK6 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 20 NC_037347.1:g.39099267C>T NM_001039726.2:c.1435C>T NP_001034815.1:p.(Q479*) 2021 33259090 Breed infromation updated based on PMID:39377537
975 OMIA:001372-9913 taurine cattle Baoulé (Cattle) Caracu, Brazil (Cattle) Carora, Venezuela (Bolivarian Republic of) (Cattle) Casanareño, Colombia (Cattle) Chino Santandereano, Colombia (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) Romosinuano, Venezuela (Bolivarian Republic of) (Cattle) West African Zebu (Cattle) Slick hair PRLR SLICK2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 20 NC_037347.1:g.39099321C>T NM_001039726.2:c.1489C>T NP_001034815.1:p.(R497*) rs5334474702 2018 29527221 Breed infromation updated based on PMID:39377537 and PMID:39710878
977 OMIA:000380-9103 turkey Feathering, Z-linked PRLR deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Turkey_5.1 Z g.9426018_9426022delTTGGT p.(E726Dfs*7) 2018 29566646
1507 OMIA:000944-447135 Bank vole Susceptibility to atypical scrapie PRNP not known missense Naturally occurring variant Not currently evaluated p.(M109I) 2022 35731839
33 OMIA:001454-9615 dog Great Dane (Dog) Harlequin PSMB7 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 9 NC_006591.3:g.58530295T>G XM_022422504.1:c.146T>G XP_022278212.1:p.(V49G) XM_022422504.1; XP_022278212.1 2011 21256207 Genomic position in CanFam3.1 provided by Mateo Etcheveste.
698 OMIA:001515-9615 dog Great Dane (Dog) Colorectal hamartomatous polyposis and ganglioneuromatosis PTEN duplication Naturally occurring variant Not currently evaluated 26 "Duplication of PTEN" 2011 20952721
988 OMIA:002196-9615 dog Doberman Pinscher (Dog) Deafness, unilateral and vestibular dysfunction PTPRQ insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 15 g.22989897_22989898insA c.9230_9231insA p.(N3077Kfs*24) XM_022428131.1; XP_022283839.1; published as an A insertion at CFA15: 22 989 894 and p.(N2032Kfs*24) based on ENSCAFT00000009346.4 - renamed due to HGVS 3'rule and RefSeq IDs 2018 29460419
1688 OMIA:001139-9913 taurine cattle Red Angus (Cattle) Glycogen storage disease V PYGM substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 29 NC_037356.1:g.42989581G>A NM_175786.2 c.1948C>T NP_786980.1:p.(R650*) published as c.2257C>T in ARS-UCD1.2 2024 38678201
193 OMIA:001139-9913 taurine cattle Charolais (Cattle) Glycogen storage disease V PYGM substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 29 NC_037356.1:g.42991370G>A NM_175786.2:c.1468C>T NP_786980.1:p.(R490W) rs5334475023 1996 8845714 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
388 OMIA:001139-9940 sheep Merino (Sheep) Glycogen storage disease V PYGM substitution splicing Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 21 NC_040272.1:g.44787090C>T NM_001009192.2:c.2380-1G>A a G>A substitution at the 3' splice site of intron 19, cDNA position based on NM_001009192.2 rs402505013 1997 9267848 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1689 OMIA:002848-9913 taurine cattle Brown Swiss (Cattle) Spermatogenic failure, QRICH2-related QRICH2 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.55436710del XM_002696205.5:c.4929del XP_002696251.3:C1644Afs*52 Coordinates in this table consider 3' rule of HGVS recommendation 2022 35255804
88 OMIA:001913-9615 dog Gordon Setter (Dog) Old English Sheepdog (Dog) Ataxia, cerebellar, in Old English Sheepdogs and Gordon Setters RAB24 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 4 NC_006586.3:g.36055678A>C XM_005619162.3:c.113A>C XP_005619219.1:p.(Q38P) XM_005619162.3; XP_005619219.1 2014 24516392 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1826 OMIA:001913-9615 dog Mixed Breed (Dog) Ataxia, cereballar, RAB24-related RAB24 substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 4 NC_049225.1:g.36943081G>T XM_038534663.1:c.239G>T XP_038390591.1:p.(G80V) 2025 40869982
1256 OMIA:002292-452646 American mink Moyle coat colour RAB38 deletion, small (<=20) Naturally occurring variant Not currently evaluated NNQGG.v01 1 g.16075438_16075453del c.574-589del "We identified a homozygous 16-bp deletion [FNWR01000007.1:16075438–16075453del (RAB38:c.574-589del)], hereinafter referred to as RAB383del, in the Moyle sample, at the third exon of RAB38 gene. We found a homozygous 2-bp duplication NWR01000007.1:16132224_16132225dupCT (RAB38:c.20-21dup)], hereinafter referred to as RAB381dup, in the Violet sample, at the first exon of the RAB38 gene. Both mutations potentially resulted in the loss of function of RAB38 protein" (Manakhov et al., 2020) 2020 32985525
1257 OMIA:002292-452646 American mink Moyle coat colour RAB38 duplication Naturally occurring variant Not currently evaluated NNQGG.v01 1 g.16132224_16132225dupCT c.20-21dup "We identified a homozygous 16-bp deletion [FNWR01000007.1:16075438–16075453del (RAB38:c.574-589del)], hereinafter referred to as RAB383del, in the Moyle sample, at the third exon of RAB38 gene. We found a homozygous 2-bp duplication NWR01000007.1:16132224_16132225dupCT (RAB38:c.20-21dup)], hereinafter referred to as RAB381dup, in the Violet sample, at the first exon of the RAB38 gene. Both mutations potentially resulted in the loss of function of RAB38 protein" (Manakhov et al., 2020) 2020 32985525
730 OMIA:001970-9615 dog Alaskan Husky (Dog) Polyneuropathy, ocular abnormalities and neuronal vacuolation RAB3GAP1 insertion, gross (>20) splicing Naturally occurring variant Not currently evaluated CanFam3.1 19 g.37903870_37903871insN[218] c.614_615insN[218] XM_851254.3; published as 218 bp SINE insertion in exon 7; sequence of the mutant allele was submitted to ENA (accession LN864704); transcript analysis identified a new internal splice acceptor site within the SINE insertion resulting in a novel “exon 7” 2015 26596647
546 OMIA:001970-9615 dog Black Russian Terrier (Dog) Rottweiler (Dog) Polyneuropathy, ocular abnormalities and neuronal vacuolation RAB3GAP1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 19 g.37908634del c.743del p.P248Lfs*4 XM_022406115.1; XP_022261823.1, published as c.743delC rs851283827 2016 26607784 Genomic coordinates in CanFam3.1 and EVA ID provided by Zoe Shmidt and Robert Kuhn.
221 OMIA:002037-9913 taurine cattle Holstein Friesian (Cattle) Abortion (embryonic lethality), RABGGTB RABGGTB substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 3 NC_037330.1:g.69060748T>C NM_001015646.1:c.584A>G NP_001015646.1:p.(Y195C) ENSBTAT00000024551.6:c.584A>G ENSBTAP00000024551.6:p.Tyr195Cys rs1118263722 2016 27646536 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1123 OMIA:001547-9031 chicken Wingless-2 RAF1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated GRCg6a 12 g.5374854G>A c.175C>T p.(R59*) NC_006099.5:g.5374854G>A ENSGALT00000033956.3:c.175C>T ENSGALP00000033314.3:p.Arg59Ter rs314452077 2019 31075853
284 OMIA:001574-9615 dog Frisian Water Dog (Dog) Severe combined immunodeficiency disease, autosomal, T cell-negative, B cell-negative, NK cell-positive RAG1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 18 NC_006600.3:g.31631772C>A XM_540538.2:c.2893G>T XP_540538.1:p.(E965*) 2011 21293384 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1621 OMIA:002763-9541 crab-eating macaque Severe combined immunodeficiency disease RAG1 substitution nonsense (stop-gain) Base-editing Not currently evaluated Macaca_fascicularis_5.0 14 g.30840789G>T c.181C>T p.(Q61*) XM_005578172.2; XP_005578229.1 2023 37661226
1613 OMIA:002757-9615 dog Belgian Shepherd Dog (Dog) Ataxia, cerebellar, RALGAPA1-related RALGAPA1 deletion, gross (>20) frameshift Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 8 g.14468376_14473136del c.6080-2893_6944+1003del p.(V2027Qfs*7) XM_038544497.1; XP_038400425.1; published as g.14,468,376_14,473,136del4761 2023 37628572
1369 OMIA:002458-9796 domestic horse Thoroughbred (Horse) Hypoparathyroidism RAPGEF5 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated EquCab3.0 4 NC_009147.3:g.54108297G>T XM_023639352.1:c.2624C>A XP_023495120.1:p.(S875*) 2020 32986719
209 OMIA:002433-9913 taurine cattle Holstein Friesian (Cattle) Simmental (Cattle) Swiss Fleckvieh (Cattle) Thrombopathia RASGRP2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 29 NC_037356.1:g.42978791A>G NM_001099946.1:c.701T>C NP_001093416.1:p.(L234P) Additional breeds based on PMID:40312951 rs385444696 2007 18039909 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
585 OMIA:002433-9615 dog American Eskimo Dog (Dog) Thrombopathia RASGRP2 duplication frameshift Naturally occurring variant Not currently evaluated CanFam3.1 18 g.52417256dup c.452dup p.(D151Efs) XM_849829.5; XP_854922.1; published as c.452-453insA 2007 17656327
477 OMIA:002433-9615 dog Basset Hound (Dog) Thrombopathia RASGRP2 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated CanFam3.1 18 g.52417313_52417315del c.509_511del p.(F170del) XM_849829.5; XP_854922.1 2007 17656327
285 OMIA:002433-9615 dog Landseer (Dog) Thrombopathia RASGRP2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 18 NC_006600.3:g.52419245C>T XM_849829.5:c.982C>T XP_854922.1:p.(R328*) XM_849829.5; XP_854922.1 2007 17656327
1780 OMIA:002055-9615 dog Nova Scotia Duck Tolling Retriever (Dog) Encephalopathy, degenerative RB1CC1 substitution missense Naturally occurring variant Not currently evaluated Dog10K_Boxer_Tasha 29 NC_006611.4:g.4891014C>T XM_014109241.3:c.4507G>A XP_013964716.1:p.(G1503R) 2025 40149422
1833 OMIA:003010-9615 dog Basset Hound (Dog) Glycogen storage disease myopathy RBCK1 substitution splicing Naturally occurring variant Not currently evaluated U_Cfam_GSD_1.0 24 NC_049245.1:g.20935568C>A XM_038571894.1:c.1044+1G>T 2025 40939526
1323 OMIA:002365-9615 dog Giant Schnauzer (Dog) Schnauzer, Standard (Dog) Cardiomyopathy, dilated RBM20 deletion, gross (>20) frameshift Naturally occurring variant Not currently evaluated 28 22 bp deletion and frame shift in exon 11 of RBM20 2014 Reference not in PubMed; see OMIA 002365-9615 for reference details
913 OMIA:000876-9031 chicken Riboflavinuria RBP substitution splicing Naturally occurring variant Not currently evaluated 8 A "deletion in the rd ribBP cDNA correspond[ing] precisely to an exon. The splice site following this exon contains a G-->A mutation at position 1 of the downstream 5'-splice donor sequence. 1993 8226844
993 OMIA:002151-9615 dog Irish Soft Coated Wheaten Terrier (Dog) Microphthalmia, isolated, with coloboma RBP4 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated CanFam3.1 28 g.7830265_7830267del c.90_92del p.(K31del) XM_534969.6; XP_534969.3; published as c.282_284delGAA and p.(K30del); coordinates in the table have been updated to a recent reference genome and transcript, and are in accordance with the HGVS 3'-rule 2018 29847795
710 OMIA:001260-9615 dog Collie (Dog) Rod-cone dysplasia 2 RD3 insertion, gross (>20) Naturally occurring variant Not currently evaluated 7 "22 bp insertion changes the last 61 amino acids of the encoded protein" 2009 19130129
1377 OMIA:002469-9685 domestic cat Retinopathy RDH5 substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B4 NC_058374.1:g.82298824G>T XM_019835050.2:c.542G>T XP_019690609.1:p.(G181V) 2021 34726233 Genomic position in Felis_catus_9.0 provided by Joshua Khamis. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1663 OMIA:001867-9940 sheep Poll Dorset (Sheep) Lissencephaly and cerebellar hypoplasia RELN substitution missense Naturally occurring variant Not currently evaluated Oar_Rambouillet_v1.0 4 NC_040255.1:g.50288685C>T NM_001306121.1:c.7088G>A NP_001293050.1:p.(R2363H) Entry has been created to generate an OMIAvariantID for a variant that is currently in the process of being published. Information will be updated once manuscript has been published. 2024 39394905
673 OMIA:001867-9940 sheep Spanish Churro (Sheep) Lissencephaly and cerebellar hypoplasia RELN deletion, gross (>20) frameshift Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 4 NC_040255.1:g.50313243_50313273del NM_001306121.1:c.5410_5440del A deletion of 31 bp (GATGTAAGTTCCCATTGAAATCATCTTTAAG) in predicted exon 36 of RELN would lead to a truncated protein of 1817 amino acids (1803 amino acids of normal reelin followed by 14 missense amino acids and a premature termination codon) 2013 24260534 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1580 OMIA:001867-9615 dog White Swiss Shepherd Dog (Dog) Lissenecephaly and cerebellar hypoplasia RELN deletion, small (<=20) nonsense (stop-gain) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 18 g.16909944del c.2839del p.(V947*) XM_038562771.1; XP_038418699.1; reported as g.16909942TG>T - information in this table has been updated to reflect HGVS nomenclature. 2023 37334487
1888 OMIA:003051-9615 dog Nova Scotia Duck Tolling Retriever (Dog) Addison’s disease and multiple autoimmune syndrome RESF1 substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 27 NC_049248.1 g.29736795C>T XM_038577211.1:c.3170C>T XP_038433139.1:p.(P1057L) 2026 41813921
1522 OMIA:002609-9615 dog Huntaway (Dog) Labrador Retriever (Dog) Modifier of copper toxicosis RETN substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 20 NC_006602.3:g.52434480C>T XM_849220.5:c.19C>T XP_854313.1:p.(L7F) Additional breeds based on PMID:40965331 rs852470997 2020 33142854
1717 OMIA:002873-9913 taurine cattle Normande (Cattle) Haplotype with homozygous deficiency, RFC5-related RFC5 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.3 17 NC_037344.1:g.57188407_57188409del NM_001075358.1:c.573_575del NP_001068826.1:p.(E192del)  Published as ENSBTAT00000085991.1:p.E369del rs5366807285 2023 Reference not in PubMed; see OMIA 002873-9913 for reference details
1099 OMIA:002209-7950 Atlantic herring Adaptation to a red-shifted light environment rho substitution missense Naturally occurring variant Not currently evaluated p.(F261Y) 2019 31451650
29 OMIA:001346-9615 dog English Mastiff (Dog) Autosomal dominant PRA RHO substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 20 NC_006602.3:g.5637394G>C XM_005632035.3:c.11C>G XP_005632092.1:p.(T4R) 2002 11972042 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1709 OMIA:002865-9986 rabbit New Zealand White (Rabbit) Cerebral palsy, RHOB-related RHOB delins, small (<=20) missense Genome-editing (CRISPR-Cas9) Not currently evaluated OryCun2.0 2 NC_013670.1:g.169569191_169569192delinsTT XM_008254781.2:c.218_219delinsTT XP_008253003.1:p.(S73F) 2024 39080495
1442 OMIA:002547-9913 taurine cattle Holstein-Friesian, Switzerland (Cattle) Haplotype HH25 deficiency RIOX1 deletion, gross (>20) deletion (in-frame) Naturally occurring variant Not currently evaluated ARS-UCD1.2 10 g.84938408_84938437del c.396_425del p.(A133_E142del) NM_001099702.1; NP_001093172.1; published as c.396_425delGGCGCAGACCCCGGCGGCACGCTTGGTGGA 2022 35361830
1796 OMIA:002945-8128 Nile tilapia Hypogonadism rln3b deletion, gross (>20) Genome-editing (CRISPR-Cas9) Not currently evaluated >500 bp deletion 2024 38729472
676 OMIA:001901-9913 taurine cattle Nordic Red (Cattle) Abortion due to deletion of RNASEH2B RNASEH2B deletion, gross (>20) Naturally occurring variant Not currently evaluated ARS-UCD1.2 12 g.20007546_20691454del A 662kb deletion encompases the gene RNASEH2B, lack of which creates embryonic lethality. 2014 24391517 Genomic position gained from Mesbah-Uddin et al. (2021) - structural variant id esv4015629 (Database of Genomic Variants archive extracted from Ensembl release 94 - http://ftp.ensembl.org/pub/release-94/).
376 OMIA:001686-9913 taurine cattle Belgian Blue (Cattle) Dwarfism, proportionate, with inflammatory lesions RNF11 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 3 NC_037330.1:g.95015373T>C NM_001077953.1:c.124-2A>G NM_001077953.1 rs3423159409 2012 22438830 Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1726 OMIA:002876-9615 dog Miniature American Shepherd (Dog) Neuroaxonal dystrophy, RNF170-related RNF170 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 16 NC_049237.1:g.23653872del XM_038559916.1:c.367del XP_038415844.1:p.(A123Qfs*11) 2024 39177409
344 OMIA:002038-9913 taurine cattle Holstein Friesian (Cattle) Abortion (embryonic lethality), RNF20 RNF20 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 8 NC_037335.1:g.91297797A>T NM_001081587.1:c.2077A>T NP_001075056.1:p.(K693*) rs5334474936 2016 27646536 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1297 OMIA:002317-9986 rabbit Sauteur d'Alfort Sauteur RORB s^am substitution splicing Naturally occurring variant Not currently evaluated OryCun2.0 1 g.61103503G>A This variant corresponds to a change from GT to AT in the 5’ donor site of intron 9 (Carneiro et al., 2021) rs3166922596 2021 33764968
611 OMIA:002029-9913 taurine cattle Angus (Cattle) Belgian Blue (Cattle) Charolais (Cattle) Gelbvieh (Cattle) Holstein Friesian (Cattle) Maine-Anjou (Cattle) Normande (Cattle) Red Angus (Cattle) Simmental (Cattle) Swiss Fleckvieh (Cattle) Retinitis pigmentosa 1 RP1 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 14 g.22340665_22340666insA p.(R791Kfs*13) 2016 27510606 Additional breeds based on PMID:40312951
858 OMIA:002134-9913 taurine cattle Ayrshire (Cattle) Abortion due to haplotype AH2 RPAP2 substitution splicing Naturally occurring variant Not currently evaluated 3 a splice acceptor variant at 51,267,548 bp [reference sequence not specified] in RPAP2 2017 Reference not in PubMed; see OMIA 002134-9913 for reference details
468 OMIA:001222-9615 dog Briard (Dog) Leber congenital amaurosis (congenital stationary night blindness) RPE65 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 6 g.76893207_76893210del c.460_463del p.(K154Lfs*53) NM_001003176.1; NP_001003176.1; 4 bp AAGA deletion in RPE65 1998 9808841
688 OMIA:000831-9615 dog Weimaraner (Dog) Progressive retinal atrophy, X-linked, type 1 RPGR deletion, gross (>20) Naturally occurring variant Not currently evaluated X "a large deletion [maximum size 5,006 bp] comprising the first four exons of the X-linked retinitis pigmentosa GTPase regulator (RPGR) gene" 2016 27398221
481 OMIA:001518-9615 dog Mixed Breed (Dog) Progressive retinal atrophy, X-linked, type 2 RPGR deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ROS_Cfam_1.0 X g.33126437_33126438del c.3472_3473del p.(E1158Gfs*212) published as "a two-nucleotide deletion (delGA) in c.1084-1085" [GenBank accession no. AF385629] in the exon ORF15 of the canine RPGR gene; updated c.DNA and protein positions kindly provided by Leonardo Murgiano [15/2/20022] 2002 11978759
480 OMIA:000831-9615 dog Samoyed (Dog) Siberian Husky (Dog) Progressive retinal atrophy, X-linked, type 1 RPGR deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ROS_Cfam_1.0 X g.33126490_33126494del c.3416_3420del p.(R1139Ifs*2) published as a "five-nucleotide deletion (delGAGAA) between 1028 and 1032" in exon ORF15 of the canine RPGR gene [GenBank accession no. AF385629]; updated c.DNA and protein positions kindly provided by Leonardo Murgiano [15/2/20022] 2002 11978759
699 OMIA:001432-9615 dog Dachshund, Miniature Long-Haired (Dog) Cone-rod dystrophy 4 RPGRIP1 insertion, gross (>20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 15 g.18332036_18332037ins[A[29];GGAAGCAACAGGATG] c.142_143ins[A[29];GGAAGCAACAGGATG] p.(I49Kfs*26) NM_001313773.1; NP_001300702.1; published as a 44-bp insertion in exon 2 of the RPGRIP1 gene; comprising a poly(A) stretch flanked by a perfect 15-bp duplication: g.8228_8229insA29GGAAGCAACAGGATG; see PMID:38752391 for additional breed information 2006 16806805
416 OMIA:002041-9913 taurine cattle Belgian Blue (Cattle) Abortion (embryonic lethality), RPIA-related RPIA substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 11 NC_037338.1:g.47355110C>T NM_001035433.2:c.826+1G>A rs5334475111 2016 27646536 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
703 OMIA:001498-9615 OMIA:001531-9615 dog Dachshund (Dog) Portuguese Water Dog (Dog) Furnishings (moustache and eyebrows) RSPO2 insertion, gross (>20) regulatory Naturally occurring variant Not currently evaluated 13 a 167bp insertion "within the 3'UTR at position 11,634,766", which leads to a threefold increase in transcription of RSPO2 in muzzle skin of dogs with furnishings; absence of this variant causes 'improper coat' in some breeds  2009 19713490
1269 OMIA:002297-9913 taurine cattle Holstein Friesian (Cattle) Tetradysmelia RSPO2 delins, gross (>20) Naturally occurring variant Not currently evaluated ARS-UCD1.2 14 g.56451029_56501201delinsTGACAA a 50-kb deletion spanning three exons of the R-spondin 2 (RSPO2) gene 2020 33176673
926 OMIA:000483-9940 sheep Polled RXFP2 insertion, gross (>20) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 10 "1833-bp genomic insertion located in the 30-UTR region of RXFP2 present in polled animals only" 2015 26103004
54 OMIA:000621-9615 dog Collie (Dog) Doberman Pinscher (Dog) German Shepherd Dog (Dog) Labrador Retriever (Dog) Malignant hyperthermia RYR1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 1 NC_006583.3:g.114562165A>G XM_022425933.1:c.1643T>C XP_022281641.1:p.(V548A) XM_022425933.1 c.1643C>T; XP_022281641.1; published as c.1640T>C ; p.(V547A) "The nucleotide sequences of canine regions I and II have been submitted to GenBank (accession No. A302128 and AF302129, respectively)" (Roberts et al., 2001) 2001 11575546
1759 OMIA:000621-9615 dog Mixed Breed (Dog) Malignant hyperthermia RYR1 substitution missense Naturally occurring variant Not currently evaluated Dog10K_Boxer_Tasha 1 NC_006583.4:g.113934594C>T XM_003638834.5:c.7123G>A XP_003638882.1:p.(G2375R) Changed from NC_006583.4:g.113934594G>A to NC_006583.4:g.113934594C>T [09/06/2025] 2024 39516111
1760 OMIA:000621-9615 dog Golden Retriever (Dog) Malignant hyperthermia RYR1 substitution missense Naturally occurring variant Not currently evaluated Dog10K_Boxer_Tasha 1 NC_006583.4:g.113974548G>A XM_003638834.5:c.455C>T XP_003638882.1:p.(P152L) reported as de novo germline mutation; changed from NC_006583.4:g.113974548C>T tp NC_006583.4:g.113974548G>A [09/06/2025] 2024 39516111
159 OMIA:000621-9796 domestic horse American Paint (Horse) Appaloosa (Horse) Quarter Horse (Horse) Malignant hyperthermia RYR1 substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 10 NC_009153.3:g.9678680C>G XM_023649662.1:c.7363C>G XP_023505430.1:p.(R2455G) XM_023649662.1; XP_023505430.1; published as c.7360C>G and p.(R2454G); coordinates in the table have been updated to a recent reference genome and / or transcript 2004 15318347 The genomic position in EquCab3.0 was provided by Hailey Anderson, working under the guidance of Professor Ernie Bailey in April 2022. Additional breed inforamtion based on PMID:40298507
174 OMIA:000621-9823 pig Danish Landrace (Pig) Duroc (Pig) Finnish Landrace (Pig) Landrace (Pig) Pietrain (Pig) Poland China (Pig) Yorkshire (Pig) Malignant hyperthermia RYR1 substitution missense Naturally occurring variant Not currently evaluated Sscrofa11.1 6 NC_010448.4:g.47357966T>C NM_001001534.1:c.1843C>T NP_001001534.1:p.(R615C) NM_001001534.1: c.1843C>T; p.(R615C) Interestingly, the reference allele in the Sscrofa11.1 assembly is T rather than C, meaning that the Duroc animal that is the basis of this reference genome assembly has the causal variant for malignant hyperthermia! rs344435545 1991 1862346 Effect was confirmed with Ensembl VEP in the following transcript: NM_001001534.1 by Stephanie Shields (27/05/2020)
1627 OMIA:002780-9615 dog Great Pyrenees (Dog) Ataxia, spastic, SACS-related SACS delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated ENSCAFT00030020331.1 25 c.12731_12734del p.(V4244Afs*32) Published as ENSCAFT00030020331.1:c.12731_12734delTTAG - CanFam3.1 and CanFam4 are annotated incorrectly for this gene 2023 37758910
359 OMIA:001876-9615 dog Basenji (Dog) Progressive retinal atrophy, Basenji SAG substitution extension (stop-lost) Naturally occurring variant Not currently evaluated CanFam3.1 25 NC_006607.3:g.44843440T>C XM_022409547.1:c.1216T>C XP_022265255.1:p.(*405Rext*25) 2013 24019744 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1233 OMIA:002284-9615 dog Miniature Schnauzer (Dog) Polyneuropathy, SBF2-related SBF2 substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 21 g.33080022C>A c.2363+1G>T p.(G775Vfs*5) 2019 31772832
1558 OMIA:001252-9135 common canary Feather colour, recessive white SCARB1 substitution splicing Naturally occurring variant Not currently evaluated NW_022042652.1 g.27474120A>C Variant in located in the splice-donor site immediately downstream of exon 4 and results in transcript isoforms. Genomic coordinates as listed by Bovo et al., 2023, PMID:37194440. 2017 28465440
552 OMIA:002016-9615 dog Wire Fox Terrier (Dog) Van den Ende-Gupta syndrome SCARF2 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 26 g.30237714_30237715del c.1873_1874del p.(S625Gfs*15) XM_022410347.1; XP_022266055.1; published as c.865_866delTC, p.(S289Gfs*15); coordinates in the table have been updated to a recent reference genome and / or transcript 2016 27187611
162 OMIA:000785-9796 domestic horse Quarter Horse (Horse) HYPP SCN4A H substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 11 NC_009154.3:g.15474228C>G NM_001081761.1:c.4248C>G NP_001075230.1:p.(F1416L) NM_001081761.1; NP_001075230.1; ECA11 (NC_009154.3) g.15474228C>G; NM_001081761.1: c.4248C>G; NP_001075230.1: F1416L; Sift Score 0.01. The above information (from which the coordinate fields were populated) was provided by Tatyana German and Meredith O’Connell, working under the supervision of Professor Ernie Bailey. rs1148998534 1992 1338908
1077 OMIA:002194-9615 dog Alpine Dachsbracke (Dog) Ataxia, spinocerebellar, SCN8A-related SCN8A substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 27 NC_006609.3:g.3179029C>A XM_022411523.1:c.4898G>T XP_022267231.1:p.(G1633V) 2019 31083464
1526 OMIA:002616-9615 dog Mixed Breed (Dog) Congenital insensitivity to pain SCN9A substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 36 NC_049257.1:g.11652662G>A XM_038584713.1:c.2761C>T XP_038440641.1:p.(R921C) XM_038584713.1; XP_038440641.1 2023 36630088
990 OMIA:002149-9913 taurine cattle Holstein (black and white) (Cattle) Abortion due to haplotype HH6 SDE2 substitution start-lost Naturally occurring variant Not currently evaluated ARS-UCD1.3 16 NC_037343.1:g.29020700A>G NM_001099065.2:c.2T>C NP_001092535.1:p.(M1?) ENSBTAT00000016992.6:c.2T>C ENSBTAP00000016992.5:p.Met1? "This A-to-G transition changes the initiator ATG (methionine) codon to ACG because the gene is transcribed on the reverse strand. . . . Initiation of translation at the closest in-frame Met codon would truncate SDE2 by 83 amino acids, including an 8-amino acid motif conserved among eukaryotes" rs434666183 2018 29680649
1540 OMIA:002659-9615 dog Chihuahua (Dog) Ichthyosis, non-epidermolytic SDR9C7 substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 10 NC_049231.1:g.1471341G>A XM_038549505.1:c.454C>T XP_038405433.1:p.(R152W) XM_038549505.1; XP_038405433.1 2023 36967672
1427 OMIA:002531-74940 Chinook salmon XY female sdY substitution missense Naturally occurring variant Not currently evaluated p.(I183N) 2022 35100376
28 OMIA:001692-9615 dog Finnish Hound (Dog) Ataxia, cerebellar, progressive early-onset SEL1L substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 8 NC_006590.3:g.53778458A>G XM_022422296.1:c.1972T>C XP_022278004.1:p.(S658P) 2012 22719266 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1819 OMIA:002272-9796 domestic horse Thoroughbred (Horse) Thrombasthenia, atypical SEL1L substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 24 NC_009167.3:g.26081856T>C NM_001317264.1:c.1810A>G NP_001304193.1:p.Ile604Val 2025 40654876
1334 OMIA:002367-9615 dog Belgian Shepherd Dog (Dog) CNS atrophy with cerebellar ataxia SEPP1 deletion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 4 g.66946539_66963863del c.-6582_*516del NM_001115118.1; ; 17325bp deletion includes the entire protein coding sequence of SELENOP (also called SEPP1) 2021 34339417
1581 OMIA:001468-9615 dog Kerry Blue Terrier (Dog) Multiple system degeneration SERAC1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated 1 c.1536G>A p.(W512*) XM_038654522.1; initially published in a conference proceeding by Guo et al. (2013) , coordinates in this table as reported by Stee et al. 2023 (PMID:37341581)  2024 39596578
1582 OMIA:001468-9615 dog Chinese Crested (Dog) Multiple system degeneration SERAC1 deletion, small (<=20) splicing Naturally occurring variant Not currently evaluated 1 c.182+1_182+4del XM_038654522.1; initially published in a conference proceeding by Guo et al. (2013) , coordinates in this table as reported by Stee et al. 2023 (PMID:37341581). Variant results in skipping of exon 4. 2024 39596578
1911 OMIA:001468-9615 dog Mixed Breed (Dog) Multiple system degeneration SERAC1 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 1 NC_049222.1:g.48,138,835dupT XM_038526434.1:c.211dupA XP_038382362.1:p.(M71Nfs*14) 2026 42442369
965 OMIA:001897-9796 domestic horse Connemara Pony (Horse) Hoof wall separation syndrome SERPINB11 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated EquCab3.0 8 NC_009151.3:g.83600643_83600644insC XM_001491598.3:c.504_505insC XP_001491648.1:p.(T169Hfs*3) rs3447216148 2015 25875171 FN thanks Daniel J. Schmidt, working under the supervision of Professor Ernie Bailey, for updating the coordinates to EquCab3.0.
1812 OMIA:002967-9615 dog English Springer Spaniel (Dog) Welsh Springer Spaniel (Dog) Hyperfibrinolysis SERPINE1 duplication frameshift Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 6 NC_049227.1:g.8640592dup NM_001197095.1:c.101dup NP_001184024.1:p.(A35Gfs*56) 2025 40470612
25 OMIA:001483-9615 dog Dachshund (Dog) Osteogenesis imperfecta_Dachshund SERPINH1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 21 NC_006603.3:g.23033735A>G XM_005633296.3:c.977T>C XP_005633353.1:p.(L326P) 2009 19629171 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1902 OMIA:003058-9615 dog Jack Russell Terrier (Dog) Ataxia, SETX-related SETX insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 9 NC_049230.1:g.52007169_52007170dup XM_038548937.1:c.1160_1161dup XP_038404865.1:p.(N388Lfs*9) published as chr9:52007168C > CCT, updated in this table to HGVS nomenclature 2026 42105303
1280 OMIA:002305-9615 dog Dachshund, Miniature (Dog) Muscular dystrophy, limb-girdle, type R3 SGCA substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 9 NC_006591.3:g.26166312G>A XM_005624636.3:c.224G>A XP_005624693.1:p.(W75*) 2021 33407862
652 OMIA:002211-10036 golden hamster Cardiomyopathy, hypertrophic SGCD deletion, gross (>20) Naturally occurring variant Not currently evaluated a large deletion in the delta-SG gene 1997 9097966
651 OMIA:000162-10036 golden hamster Cardiomyopathy, dilated SGCD deletion, gross (>20) Naturally occurring variant Not currently evaluated genomic deletion was found to be located at 6.1 kb 5' upstream of the second exon of δ-SG gene, and its 5' upstream region of more than 27.4 kb, including the authentic first exon of δ-SG gene, was deleted 1997 9391120
802 OMIA:002122-9615 dog Boston Terrier (Dog) Muscular dystrophy, limb-girdle, type 2F SGCD deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 4 g.53353932_53353933del c.534_535del p.(E178Dfs*3) XM_005619257.3; XP_005619314.1, published as c.534_535delGA 2017 28702169 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
928 OMIA:002122-9615 dog Boston Terrier (Dog) Muscular dystrophy, limb-girdle, type 2F SGCD delins, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 4 g.[53262018_53262020delinsCC;53262030_53281432del] g.[53262018_53262020delinsCC;53262030_53281432del] 2017 28702169
1612 OMIA:002122-9615 dog Lagotto Romagnolo (Dog) Limb-girdle muscular dystrophy, recessive SGCD substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 4 NC_049225.1:g.54154870A>G XM_038534930.1:c.725T>C XP_038390858.1:p.(L242P) XM_038534930.1; XP_038390858.1, variant detected in a single dog 2023 37628692
1063 OMIA:001279-9615 dog Scottish Deerhound (Dog) Hypotrichosis, recessive SGK3 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 29 g.16351976_16351977insT c.137_138insT p.(E47Gfs*3) NM_001190428.1; NP_001177357.1 2019 30927068 Genomic position in CanFam3.1 provided by Mateo Etcheveste and Robert Kuhn.
564 OMIA:001279-9615 dog American Hairless Terrier (Dog) Hypotrichosis, recessive SGK3 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 29 g.16366702_16366705del c.287_290delTTAG p.(V96Gfs*50) 2017 27994129
577 OMIA:001309-9615 dog Huntaway (Dog) Mucopolysaccharidosis IIIA SGSH insertion, small (<=20) nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 9 g.1544321_1544322insA c.685_686insA p.(Y229*) NM_001003114.1; NP_001003114.1; published as c.708-709insA (which are mRNA and not cDNA coordinates) 2002 11829484
954 OMIA:001309-9615 dog Dachshund (Dog) Mucopolysaccharidosis IIIA SGSH deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated CanFam3.1 9 g.1544376_1544378delCCA c.740_742delCCA p.(T247del) NM_001003114.1; NP_001003114.1; published as c.737_739delCCA; coordinates in the table have been updated in accordance with the HGVS 3' rule 2000 10950929 Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn.
1593 OMIA:002740-9615 dog Golden Retriever (Dog) Polyneuropathy, hypomyelinating, SH SH3TC2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 4 NC_049225.1:g.60798310C>T XM_038535081.1:c.1924C>T XP_038391009.1:p.(R642*) XM_038535081.1; XP_038391009.1; reported in one affected dog with coordinates relating to a different transcript as XM_038568229.1:c.1479G>A 2023 37400349
1444 OMIA:000810-9615 dog Beagle (Dog) Belgian Shepherd Dog, Malinois (Dog) Cocker Spaniel (Dog) Huntaway (Dog) Lundehund (Dog) New Zealand Heading Dog (Dog) Poodle, Standard (Dog) Rottweiler (Dog) Schnauzer, Standard (Dog) Shetland Sheepdog (Dog) Shih Tzu (Dog) Yorkshire Terrier (Dog) Dew claws SHH DC-2 substitution regulatory Naturally occurring variant Not currently evaluated CanFam3.1 16 g.19380592C>T Additional breeds based on PMID:40965331 2008 18689889 Thank you to Heidi Anderson for suggesting to add this variant [8/4/2022]
1445 OMIA:000810-9615 dog Sapsari (Dog) Tosa (Dog) Dew claws SHH DC-1 substitution regulatory Naturally occurring variant Not currently evaluated CanFam3.1 16 g.19380829C>T 2008 18689889 Thank you to Heidi Anderson for suggesting to add this variant [8/4/2022]
836 OMIA:000810-9031 chicken Polydactyly SHH substitution regulatory Naturally occurring variant Not currently evaluated GRCg6a 2 g.8553470G>T published as "single SNP in a highly conserved cis-regulatory region of Sonic Hedgehog was significantly associated with polydactyly" rs80659072 2010 20064842
686 OMIA:002013-9796 domestic horse Shetland Pony (Horse) Skeletal atavism SHOX Del-1 deletion, gross (>20) Naturally occurring variant Not currently evaluated PAR 160−180 kb deletion in the pseudoautosomal region (PAR) of chromosome X/Y; removing the entire coding region of the short stature homeobox (SHOX) gene and parts of the cytokine receptor-like factor 2 (CRLF2) gene located downstream of SHOX 2016 27207956
1455 OMIA:002013-9796 domestic horse Shetland Pony (Horse) Skeletal atavism SHOX Del-2 deletion, gross (>20) Naturally occurring variant Not currently evaluated PAR 60−80 kb deletion in the pseudoautosomal region (PAR) of chromosome X/Y; removing parts of the cytokine receptor-like factor 2 (CRLF2) gene located downstream of SHOX 2016 27207956
1098 OMIA:002208-9615 dog Golden Retriever (Dog) Eye malformation, congenital SIX6 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 8 NC_006590.3:g.35566504C>T XM_547840.6:c.487C>T XP_547840.3:p.(Q163*) XM_547840.6:c.487C>T; XP_547840.3:p.(Gln163*) 2019 31207931
222 OMIA:002444-9913 taurine cattle Japanese Black, Japan (Cattle) Hydrallantois SLC12A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 10 g.62157819G>A p.(P372L) rs5334475056 2016 27613513
1218 OMIA:002279-9615 dog Belgian Shepherd Dog, Malinois (Dog) Ataxia, spinocerebellar, SLC12A6-related SLC12A6 delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 30 g.774122_774125delinsCATCTCACTCAT c.178_181delinsCATCTCACTCAT p.(M60Hfs*14) XM_014109414.2; XP_013964889.1; 12-bp insertion (CATCTCACTCAT) and a 4-bp deletion (ATGA) 2019 31160700
642 OMIA:001400-9615 dog Poodle, Miniature (Dog) Osteochondrodysplasia SLC13A1 deletion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 14 g.60628774_60758561del c.99+3353_*56671del XM_005628770.1; a 129788bp deletion which "ablated all but the first exon of SLC13A1" 2012 23300579
506 OMIA:001400-9940 sheep Texel (Sheep) Chondrodysplasia, Texel SLC13A1 deletion, small (<=20) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 4 NC_040255.1:g.95624809del XM_004008022.4:c.334del Published as JN108880: g.25513delT / c.107delT. Position c.334delT based on ENSOARG00020003399 2012 22742499 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries: g.95624809delA; c.334delT. 210906 After confirming the g location with NCBI BLAST, FN deleted the A and T, to conform with HGVS notation.
578 OMIA:001097-9615 dog Alaskan Husky (Dog) Necrotising encephalopathy, subacute, of Leigh SLC19A3 delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 25 g.40417443delinsTTGCA c.624delinsTGCAA p.(Q208Hfs*13) XM_022409850.1; XP_022265558.1; published as c.624 insTTGC, c.625 C>A; coordinates in the table have been updated to reflect HGVS nomenclature 2013 23469184 Genomic coordinates in CanFam3.1 provided by Robert Kuhn.
1250 OMIA:001097-9615 dog Yorkshire Terrier (Dog) Juvenile-onset necrotizing encephalopathy SLC19A3 delins, gross (>20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 25 g.40417857_40417862delinsN[35] c.205_210delinsN[35] p.(P69Ifs*45) XM_022409850.1; XP_022265558.1; "a 35 bp insertion replacing 6 bp and thereby disturbing the correct reading frame" (Drögemüller et al., 2020) 2020 33081289
811 OMIA:002124-9796 domestic horse Paso Fino (Horse) Tiger eye SLC24A5 Tiger-eye 2 deletion, gross (>20) Naturally occurring variant Not currently evaluated EquCab3.0 1 NC_009144.3:g.143129074_143129702del published as a 628bp deletion: chr1:141660611–141661239; ENSECAT00000019866.1:c.875-340_1081 + 82del 2017 28655738
810 OMIA:002124-9796 domestic horse Paso Fino (Horse) Tiger eye SLC24A5 Tiger-eye 1 substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 1 NC_009144.3:g.143145865A>T XM_023618043.1:c.272A>T XP_023473811.1:p.(F91Y) rs5334475205 2017 28655738 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1853 OMIA:003026-9913 taurine cattle Limousin (Cattle) Porencephaly SLC25A12 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.24733509G>A NM_001101194.2:c.1742G>A NP_001094664.1:p.(R581Q) 2026 42252407
1262 OMIA:002294-9615 dog Dutch Shepherd (Dog) Inflammatory myopathy, SLC25A12-related SLC25A12 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 36 NC_006618.3:g.16219219A>G XM_535962.5:c.1046T>C XP_535962.2:p.(L349P) chr36:g.16,219,219A>G; c.1046T>C; p.L349P (Shelton et al., 2019) 2019 31594244
1471 OMIA:002294-9615 dog Nova Scotia Duck Tolling Retriever (Dog) Cerebellar Degeneration-Myositis Complex SLC25A12 substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 36 NC_049257.1:g.16504064G>A XM_038584842.1:c.1337C>T XP_038440770.1:p.(P446L) XM_038584842.1:c.1337C>T; XP_038440770.1:p.(P446L) 2022 35886006
992 OMIA:002150-9913 taurine cattle Rouge des prés, France (Cattle) Syndrome des veaux tourneurs (Turning calves syndrome) SLC25A46 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 7 g.109742796C>T c.376C>T p.(R126C) rs5334475040 2017 28376083
937 OMIA:001973-9615 dog Great Dane (Dog) Ichthyosis, SLC27A4-related SLC27A4 substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 9 g.55168916C>T c.1250G>A XM_548438.6; XP_548438.3; cDNA sequencing confirmed that a "new acceptor site is created by the A-allele ... that results in a shorter RNA product. ... affected dogs show aberrantly spliced transcript with an in-frame loss of the first 54 bp of exon 8" (Metzger et al., 2015) 2015 26506231 Genomic position in CanFam3.1 provided by Robert Kuhn and Mateo Etcheveste.
1298 OMIA:002416-8932 rock pigeon Pearl-eye SLC2A11B tr substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated AKCR02000030.1 g.1895934G>A p.(W49X) Andrade et al. (2021): "This mutation creates a premature STOP codon in exon 3 of the likely canonical SLC2A11B transcript." 2021 33621224
626 OMIA:000366-9913 taurine cattle Brown Swiss (Cattle) Holstein Friesian (Cattle) Original Swiss Brown (Cattle) Simmental (Cattle) Swiss Fleckvieh (Cattle) Fanconi syndrome SLC2A2 delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 1 NC_037328.1:g.96472797_96472804delinsCATC NM_001103222.1:c.772_779delinsCATC NP_001096692.1:p.(L258fs*16) Previously listed as c.771_778delinsCATC, updated to NCBI transcript [29/08/2024] 2016 27169150 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 210909: FN changed c.771_778delTTGAAAAGinsCATC to c.771_778delinsCATC. Also, since the del is of 8 bp, the g. designation has been changed from g.97239973_97239976delTTGAAAAG (which encompasses a deletion of only 4bp) to g.97239973_97239980delinsCATC. Additional breed inforamtion based on PMID: 40312951
83 OMIA:001033-9615 dog Dalmatian (Dog) German Hunting Terrier (Dog) Majorca Mastiff (Dog) Urolithiasis SLC2A9 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 3 NC_006585.3:g.69456869G>T NM_001130835.2:c.563G>T NP_001124307.2:p.(C188F) NM_001130835.2; NP_001124307.2; variant initially identified in Dalmatians and later reported in Majorca Mastiffs (PMID: 37582787) and German Hunting Terriers (PMID:39173651). rs1152388406 2008 18989453 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1707 OMIA:002862-9940 sheep Manech Tête Rousse, France (Sheep) Haplotype with homozygous deficiency, SLC33A1-related SLC33A1 MTRDHH2 duplication frameshift Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 1 NC_040252.1:g.252649023dupG XM_012100950.3:c.735dupG XP_011956340.1:p.(R246Afs*3) 2024 38922751
187 OMIA:001340-9913 taurine cattle Holstein Friesian (Cattle) Complex vertebral malformation SLC35A3 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 3 NC_037330.1:g.43261945C>A NM_001105386.1:c.538G>T NP_001098856.1:p.(V180F) rs438228855 2006 16344554 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1181 OMIA:001340-9913 taurine cattle Montbéliarde (Cattle) de novo mutation in an AI sire SLC35A3 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 3 NC_037330.1:g.43268369G>T NM_001105386.1:c.73C>A NP_001098856.1:p.(R25S) This variant was detected by Bourneuf et al. (2017) as a de novo mutation from an analysis of whole-genome-sequence of an AI Montbéliarde bull. No information was provided on the descendants of this bull. rs5334475074 2017 28904385
152 OMIA:001263-9796 domestic horse American Cream Draft (Horse) American Miniature Horse (Horse) American Paint (Horse) American Saddle Horse (Horse) Appaloosa (Horse) Kentucky Mountain Saddle, United States of America (Horse) Missouri Fox Trotting Horse (Horse) Quarter Horse (Horse) Tennessee Walking Horse (Horse) Coat colour, champagne SLC36A1 substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 14 NC_009157.3:g.26012449G>C XM_023617382.1:c.188C>G XP_023473150.1:p.(T63R) rs5334475190 2008 18802473 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
263 OMIA:001828-9913 taurine cattle Montbéliarde (Cattle) Vorderwälder, Germany (Cattle) Abortion due to haplotype MH2 SLC37A2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 29 NC_037356.1:g.28510651C>T NM_001024486.1:c.34C>T NP_001019657.1:p.(R12*) rs5358558602 2013 23762392 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
411 OMIA:002244-9615 dog Cairn Terrier (Dog) Scottish Terrier (Dog) West Highland White Terrier (Dog) Craniomandibular osteopathy SLC37A2 substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 5 g.9387327G>A c.1332C>T XM_005619600.3:c.1332C>T (Letko et al., 2020) 2016 27187611 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1158 OMIA:002244-9615 dog Basset Hound (Dog) Craniomandibular osteopathy SLC37A2 substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 5 NC_006587.3:g.9387071C>T XM_005619600.3:c.1446+1G>A NC_006587.3:g.9387071C>T; XM_005619600.3:c.1446+1G>A (Letko et al., 2020) 2020 32033218
372 OMIA:000593-9913 taurine cattle Holstein Friesian (Cattle) Acrodermatitis enteropathica SLC39A4 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD2 14 NC_037341.1:g.537517G>A NM_001046067.1:c.1645+1G>A "a single nucleotide mutation of the splice donor site in intron 10" rs5334475080 2006 16714095
1354 OMIA:000593-9685 domestic cat Turkish Van (Cat) Acrodermatitis enteropathica SLC39A4 substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 F2 NC_058385.1:g.83034002C>G XM_004000173.4:c.1057G>C XP_004000222.2:p.(G353R) rs5334475163 2021 34573291 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
526 OMIA:000256-9615 dog Labrador Retriever (Dog) Cystinuria, type I - A SLC3A1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 10 g.46700948del c.350del p.(G117Afs*41) NM_001003109.1; NP_001003109.1; published as c.350delG 2013 24001348 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
527 OMIA:001879-9615 dog Australian Cattle Dog (Dog) Cystinuria, type II - A SLC3A1 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated CanFam3.1 10 g.46725151_46725156del c.1098_1103del p.(T367_T368del) NM_001003109.1; NP_001003109.1; published as c.1095_1100delCACCAC; p.(T366_T367del); coordinates in the table have been updated to a recent reference genome and / or transcript 2013 24001348 Genomic position in CanFam3.1 provided by Robert Kuhn and Mateo Etcheveste.
268 OMIA:000256-9615 dog Newfoundland (Dog) Cystinuria, type I - A SLC3A1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 10 NC_006592.3:g.46706001C>T NM_001003109.1:c.586C>T NP_001003109.1:p.(R196*) 2000 11129328 Genomic coordinates obtained from EBI's Variant Effect Predictor
1542 OMIA:000256-9615 dog English Bulldog (Dog) French Bulldog (Dog) Cystinuria, type I - A SLC3A1 haplotype Naturally occurring variant Not currently evaluated CanFam3.1 10 NC_006592.3:g.[46705989A>G;46735617A>G] NM_001003109.1:c.[574A>G;2092A>G] NP_001003109.1:p.[(I192V);(S696G)] Several studies report an association between the two variants and cystinuria. 2006 16845473
141 OMIA:000256-9685 domestic cat Domestic Shorthair (Cat) Cystinuria, type I - A SLC3A1 substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A3 NC_058370.1:g.64071673C>T XM_003983937.6:c.1342C>T XP_003983986.3:p.(R448W) rs5334475150 2015 25417848 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1839 OMIA:003020-9913 taurine cattle Holstein Friesian (Cattle) Caudal and thoracic vertebral and viscerocranial malformation SLC40A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.6785954T>A NM_001077970.1:c.323T>A NP_001071438.1:p.(I108N) 2025 40999323
386 OMIA:000370-93934 Japanese quail Feather colour, albinism, sex-linked, imperfect SLC45A2 substitution splicing Naturally occurring variant Not currently evaluated a splice-site mutation in the SLC45A2 gene: "a G>T transversion at the splice acceptor site just preceding exon 4" 2007 17151254
746 OMIA:001821-8090 Japanese medaka Coat colour, albinism, oculocutaneous type IV slc45a2 complex rearrangement Naturally occurring variant Not currently evaluated an inversion of 167 bp, an insertion of 48 bp, and a deletion of 172 bp 2008 18245373
1643 OMIA:000370-9228 Rose-ringed parakeet Feather colour, yellow or white SLC45A2 substitution missense Naturally occurring variant Not currently evaluated c.1195G>A p.(G399R) 2024 37943814
1641 OMIA:000370-232655 Alexandrine parakeet Feather colour, yellow SLC45A2 substitution missense Naturally occurring variant Not currently evaluated c.1195G>A p.(G399R) 2024 37943814
1644 OMIA:000370-9228 Rose-ringed parakeet Feather colour, yellow or white SLC45A2 substitution missense Naturally occurring variant Not currently evaluated c.1400G>T p.(G467V) 2024 37943814
1642 OMIA:000370-9228 Rose-ringed parakeet Feather colour, yellow SLC45A2 substitution missense Naturally occurring variant Not currently evaluated c.158C>T p.(P53L) 2024 37943814
259 OMIA:000370-93934 Japanese quail Feather colour, cinnamon SLC45A2 substitution missense Naturally occurring variant Not currently evaluated c.287C>A p.(A72D) 2007 17151254
1530 OMIA:002628-215402 northern snakehead Skin colour, yellow SLC45A2 YM substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated 19 c.383G>A p.(W128*) 2023 36789536
1640 OMIA:000370-232655 Alexandrine parakeet Feather colour, yellow SLC45A2 substitution missense Naturally occurring variant Not currently evaluated c.539T>C p.(L180P) 2024 37943814
1639 OMIA:000370-232645 Plum-headed parakeet Feather colour, yellow SLC45A2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.73G>T p.(R25*) 2024 37943814
254 OMIA:000213-74535 Bengal tiger Coat colour, white SLC45A2 substitution missense Naturally occurring variant Not currently evaluated C>T p.(A477V) 2013 23707431
847 OMIA:001821-9913 taurine cattle Brown Swiss (Cattle) Coat colour, albinism, oculocutaneous type IV SLC45A2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 20 g.39790069G>A c.134G>A p.(R45Q) Important note by Rothammer et al. (2017): "To determine which of the two mutations or even if the combination of both is causal for oculocutaneous albinism in Braunvieh, it would be necessary to produce additional cases and investigate them more precisely" rs5334474931 2017 28982372 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
848 OMIA:001821-9913 taurine cattle Brown Swiss (Cattle) Coat colour, albinism, oculocutaneous type IV SLC45A2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 20 g.39824417C>T c.1331C>T p.(T444I) Important note by Rothammer et al. 92017): "To determine which of the two mutations or even if the combination of both is causal for oculocutaneous albinism in Braunvieh, it would be necessary to produce additional cases and investigate them more precisely" rs5334474883 2017 28982372 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1846 OMIA:001821-9913 taurine cattle Dexter (Cattle) Coat colour, dilution (chocolate / cream) SLC45A2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 20 NC_037347.1: g.39790189A>C XM_002696386.6: c.398A>C XP_002696432.2: p.(Q133P) 2025 41101985
1761 OMIA:001821-9940 sheep Suffolk (Sheep) Suffolk white fleece SLC45A2 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated ARS-UI_Ramb_v3.0 16 NC_056069.1:g39966131_39966133del XM_004017064.5:c.661_663del XP_004017113.5:p.(F221del) 2025 39608806
675 OMIA:001821-9615 dog Doberman Pinscher (Dog) Coat colour, albinism, oculocutaneous type IV SLC45A2 deletion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 4 g.73867275_73871357del c.1442_*3934del NM_001037947.1; "a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4[ratio]77,062,968-77,067,051)" (g.27141_31223del; CanFam2.0) 2014 24647637
795 OMIA:001821-9615 dog Bull Mastiff (Dog) Coat colour, albinism, oculocutaneous type IV SLC45A2 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 4 NC_006586.3:g.73864860del NM_001037947.1:c.1287del NP_001033036.1:p.(M430Cfs*4) NM_001037947.1; NP_001033036.1; deletion C 2017 28737247
92 OMIA:001821-9615 dog Lhasa Apso (Dog) Mixed Breed (Dog) Pekingese (Dog) Pomeranian (Dog) Coat colour, albinism, oculocutaneous type IV SLC45A2 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 4 NC_006586.3:g.73867311G>A NM_001037947.1:c.1478G>A NP_001033036.1:p.(G493D) NM_001037947.1 2015 25790827 Genomic position in CanFam3.1 provided by Robert Kuhn
1855 OMIA:001821-9793 ass (donkey) Coat colour, cream dilution SLC45A2 substitution missense Naturally occurring variant Not currently evaluated EquAss-T2T_v2 10 NC_091799.1:g.81796057C>T XM_014831209.3:c.1601C>T XP_014686695.1:p.(A534V) published as c.1457C>T, p.A486V 2025 41314234
1140 OMIA:001344-9796 domestic horse Traditional Gypsy Cob, United Kingdom of Great Britain and Northern Ireland (Horse) Coat colour, snowdrop SLC45A2 C^sno substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 21 NC_009164.3:g.31688649G>A XM_001498110.4:c.449G>A XP_001498160.2:p.(R150Q) Bisbee et al. (2020): transcript ENSECAT00000026240.1 in the Ensembl EquCab2.0 assembly, previously listed as c.305G>A and p.(R102Q). Coordinates in this table are based on a recent reference genome and in accordance with HGVS recommendations. rs5334475197 2020 31961951 EquCab3.0 c. and p. coordinates kindly provided by Robin Everts.
153 OMIA:001344-9796 domestic horse Morgan (Horse) Quarter Horse (Horse) Welsh Pony (Horse) Coat colour, cream dilution SLC45A2 C^Cr substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 21 NC_009164.3:g.31690653G>A XM_001498110.4:c.601G>A XP_001498160.2:p.(D201N) Variant published as equCab3  chr21:g. 31,690,653G>A exon 2 c.457G>A p.Asp153Asn; coordinates in this table are based on a recent reference genome and in accordance with HGVS recommendations. rs1140980396 2003 12605854 EquCab3.0 g. coordinates obtained from Table S2 of Holl et al. (2019); c. and p. coordinates kindly provided by Robin Everts. Breed information updated based on PMID: 38600096
1074 OMIA:001344-9796 domestic horse Standardbred x Tennessee Walking Horse cross (Horse) Coat colour, sunshine SLC45A2 C^sun substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 21 NC_009164.3:g.31705404G>A XM_001498110.4:c.712G>A XP_001498160.2:p.(G238R) Variant published as equCab3  chr21:g. 31,705,368G>A exon 3 c.568G>A p.Gly190Arg; genomic coordinates in OMIA were previously incorrectly listed as EquCab3.0 chr21 g.31705726G>A and corrected based on feedback from Robin Everts [12/04/2024]. Coordinates in this table are based on a recent reference genome and in accordance with HGVS recommendations.  rs394940514 2019 31006892 EquCab3.0 g., c. and p. kindly provided by Robin Everts.
1069 OMIA:001344-9796 domestic horse American Paint (Horse) Lusitanian (Horse) Purebred Spanish (Horse) Quarter Horse (Horse) Coat colour, pearl SLC45A2 C^prl substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 21 NC_009164.3:g.31709690G>A XM_001498110.4:c.1129G>A XP_001498160.2:p.(A377T) Variant published as equCab3  chr21:g. 31,709,654G>A exon 4 c.985G>A p.Ala329Thr; coordinates in this table are based on a recent reference genome and in accordance with HGVS recommendations. rs3101690631 2019 30968968 EquCab3 g. coordinate kindly provided by Natalia Sevane; c. and p. coordinates kindly provided by Robin Everts.
861 OMIA:001821-9593 western gorilla Coat colour, albinism, oculocutaneous type IV SLC45A2 substitution missense Naturally occurring variant Not currently evaluated gorGor3.1 17 g.59753498G>C c.1552G>C p.(G518R) 2013 23721540 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
9 OMIA:000370-9031 chicken Feather colour, silver SLC45A2 S*S substitution missense Naturally occurring variant Not currently evaluated GRCg6a Z NC_006127.5:g.10336596G>T NM_001083364.2:c.1039C>A NP_001076833.2:p.(L347M) rs314509501 2007 17151254 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
10 OMIA:000370-9031 chicken White Leghorn (Chicken) Feather colour, silver SLC45A2 S*S substitution missense Naturally occurring variant Not currently evaluated GRCg6a Z NC_006127.5:g.10340909T>C NM_001083364.2:c.830A>G NP_001076833.2:p.(Y277C) rs315357427 2007 17151254 Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool
1894 OMIA:000370-9031 chicken Iris depigmentation, sex linked SLC45A2 deletion, gross (>20) frameshift Genome-editing (MAD7) Not currently evaluated GRCg6a Z NC_006127.5:g.10344223_10344293del NM_001083364.2:c.545_615del NP_001076833.2:p.(K182fs) 2026 41993716
514 OMIA:000370-9031 chicken Sex-linked imperfect albinism SLC45A2 S*AL deletion, small (<=20) Naturally occurring variant Not currently evaluated GRCg6a Z NC_006127.5:g.10345841del NM_001083364.2:c.106del NP_001076833.2:p.(S36fs) 2007 17151254
303 OMIA:001228-9913 taurine cattle Japanese Black, Japan (Cattle) Spherocytosis SLC4A1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 19 NC_037346.1:g.44069903G>A NM_181036.2:c.1990C>T NP_851379.1:p.(R664*) rs5334475039 1996 8621763 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
647 OMIA:002443-9913 taurine cattle Angus (Cattle) Hereford (Cattle) Holstein (black and white) (Cattle) Simmental (Cattle) Osteopetrosis SLC4A2 deletion, gross (>20) Naturally occurring variant Not currently evaluated ARS-UCD1.2 4 g.113638011_113640784del "approximately 2.8-kb deletion mutation in affected calves that encompasses exon 2 and nearly half of exon 3" 2010 20507629 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
575 OMIA:001572-9615 dog Golden Retriever (Dog) Golden Retriever PRA 1 SLC4A3 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 37 g.26145752_26145753insC c.2601_2602insC p.(E859Rfs*104) Genomic coordinates in CanFam3.1 and EVA ID provided by Robert Kuhn rs1152388421 2011 21738669 NM_001289433.1; NP_001276362.1; one of 3 transcripts; second EVA ID for this variant rs852038699 is inconsistent with HGVS 3' rule
158 OMIA:001578-9796 domestic horse Dales (Horse) Fell Pony (Horse) Foal immunodeficiency syndrome in the Fell and Dales Pony SLC5A3 substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 26 NC_009169.3:g.31894278C>T NM_001247992.1:c.1352C>T NP_001234921.1:p.(P451L) NM_001247992.1; NP_001234921.1; previously listed in OMIA as g.30660224G>T in EquCab2.0, c.1337G>T and published as p.(P446L); coordinates in the table have been updated to a recent reference genome and / or transcript 2011 21750681 Briana Moreno, working under the guidance of Professor Ernie Bailey, provided genomic coordinates in EquCab3.0 in April 2022
1037 OMIA:002174-9615 dog Pekingese (Dog) Shih Tzu (Dog) Congenital dyshormonogenic hypothyroidism with goiter SLC5A5 substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 20 NC_006602.3:g.45024672C>T XM_541946.6:c.1172-1G>A XM_541946.4; published as g.45024672G>A, predicted to be a splice site mutation leading to loss of exon 10 and a frameshift.  2018 29777899 Additonal breed information based on PMID:36848397.
904 OMIA:001451-9913 taurine cattle Belgian Blue (Cattle) Congenital muscular dystonia 2 SLC6A5 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 29 g.24366560A>G c.809T>C p.(L270P) rs3423560860 2008 18344998 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
638 OMIA:001594-9615 dog Irish Wolfhound (Dog) Hyperekplexia (Startle disease) SLC6A5 deletion, gross (>20) Naturally occurring variant Not currently evaluated CanFam3.1 21 g.42583699_42587925del c.-52_562+504del XM_005633757.1; "a homozygous 4.2kb [4227bp] microdeletion encompassing exons 2 and 3" 2011 21420493
1080 OMIA:001594-9615 dog Spanish Greyhound (Dog) Hyperekplexia (Startle disease) SLC6A5 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 21 g.42612546_42612547del c.1379_1380delCT p.(S460Ffs*47) XM_022407940.1; XP_022263648.1 2019 30847549 Genomic coordinates in CanFam3.1 provided by Robert Kuhn.
1785 OMIA:001594-9615 dog Old English Sheepdog (Dog) Hyperekplexia (Startle disease) SLC6A5 delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated ROS_Cfam_1.0 21 NC_051825.1:g.43733137del XM_038429613.1:c.1300del XP_038285541.1:p.(Q434Rfs13)* Coordinates in the table are in accordance with Human Genome Variation Society recommendations (3'rule) and differ therefore from published coordinates. 2025 40012122
1534 OMIA:002645-9615 dog English Cocker Spaniel (Dog) English Springer Spaniel (Dog) Paradoxical pseudomyotonia SLC7A10 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ROS_Cfam_1.0 1 NC_051805.1:g.119506784C>A XM_038657580.1:c.126C>A XP_038513508.1:p.(C42*) 2023 36869603
85 OMIA:001880-9615 dog Miniature Pinscher (Dog) Cystinuria, type II - B SLC7A9 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 1 NC_006583.3:g.119211938G>A NM_001048109.1:c.964G>A NP_001041574.1:p.(G322R) NM_001048109.1; NP_001041574.1 2013 24001348 Genomic coordinates in CanFam3.1 provided by Robert Kuhn and Zoe Shmidt.
142 OMIA:002023-9685 domestic cat Cystinuria, type B SLC7A9 substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 E2 NC_058382.1:g.20068434G>A XM_045046541.1:c.706G>A XP_044902476.1:p.(D236N) 2016 27404572 Thank you to Heidi Anderson for feedback on a previous incorrect breed association for this variant. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
143 OMIA:002023-9685 domestic cat Maine Coon (Cat) Maine Coon Polydactyl (Cat) Siamese (Cat) Siberian (Cat) Sphynx (Cat) Cystinuria, type B SLC7A9 substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 E2 NC_058382.1:g.20069793T>A XM_045046541.1:c.881T>A XP_044902476.1:p.(V294E) 2016 27404572 Thank you to Heidi Anderson for feedback on a previous incorrect breed association for this variant. Additional breeds reported based on PMID:35709088. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
144 OMIA:002023-9685 domestic cat Cystinuria, type B SLC7A9 substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 E2 NC_058382.1:g.20078992C>T XM_045046541.1:c.1175C>T XP_044902476.1:p.(T392M) 2016 27404572 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
717 OMIA:000142-9031 chicken Araucana (Chicken) Blue eggshell SLCO1B3 insertion, gross (>20) Naturally occurring variant Not currently evaluated 1 A different location for the same insertion: "a ~4.2 kb [retroviral] EAV-HP insertion in the 5' flanking region of SLCO1B3" but 23bp upstream of where the insertion occurs in Chinese breeds Dongxiang and Lushi 2013 23359636
864 OMIA:000142-9031 chicken Dong, an chicken, China (Chicken) Lushi, China (Chicken) Blue eggshell SLCO1B3 insertion, gross (>20) Naturally occurring variant Not currently evaluated 1 "a ~4.2 kb [retroviral] EAV-HP insertion in the 5' flanking region of SLCO1B3" 2013 23359636
1608 OMIA:002755-9940 sheep South Down (Sheep) Congenital photosensitivity and hyperbilirubinaemia SLCO1B3 substitution missense Naturally occurring variant Not currently evaluated Oar_v3.1 3 NC_019460.1:g.193691915C>T XM_012175224.1:c.1318G>A XP_012030614.1:p.(G440R) XM_012175224.1; XP_012030614.1 2018 29688779
1537 OMIA:002651-499056 Asian vine snakes Skin colour, yellow SMARCE1 substitution missense Naturally occurring variant Not currently evaluated 4 g.43233281C>T c.58C>T p.(P20S) 2023 36895044
211 OMIA:001824-9913 taurine cattle Holstein (black and white) (Cattle) Abortion due to haplotype HH3 SMC2 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 8 NC_037335.1:g.93753358T>C XM_015472668.2:c.3404T>C XP_015328154.1:p.(F1135S) XM_015472668.2; XP_015328154.1 rs456206907 2014 24667746 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1193 OMIA:001795-9685 domestic cat Niemann-Pick disease, type A SMPD1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 D1 NC_058377.1:g.63262260G>A XM_045038859.1:c.1017G>A XP_044894794.1:p.(W339*) 2020 32347185 Genomic position in Felis_catus_9.0 provided by Joshua Khamis. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
557 OMIA:002040-9913 taurine cattle Belgian Blue (Cattle) Abortion (embryonic lethality), SNAPC4-related SNAPC4 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated 11 p.(L1227Afs*134) 2016 27646536
415 OMIA:002034-9615 dog Vizsla (Dog) Cerebellar cortical degeneration, Hungarian Vizsla SNX14 substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 12 g.45530566C>T c.26531G>A 2016 27566131
1917 OMIA:002669-9685 domestic cat Domestic Shorthair (Cat) Sebaceous gland dysplasia SOAT1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 F1 NC_058384.1:g.20904899G>A XM_011291017.4:c.1221G>A XP_011289319.1:p.(W407*) 2026 42575711
1546 OMIA:002669-9685 domestic cat Domestic Shorthair (Cat) Sebaceous gland dysplasia SOAT1 substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 F1 NC_058384.1:g.20914140G>A XM_011291017.4:c.1531G>A XP_011289319.1:p.(G511R) 2023 37060467
36 OMIA:000263-9615 dog American Pit Bull Terrier (Dog) American Water Spaniel (Dog) Anatolian Shepherd Dog (Dog) Australian Shepherd (Dog) Bernese Mountain Dog (Dog) Border Collie (Dog) Borzoi (Dog) Boxer (Dog) Cavalier King Charles Spaniel (Dog) Chesapeake Bay Retriever (Dog) Collie (Dog) Collie Rough (Dog) Czechoslovakian Wolfdog (Dog) English Springer Spaniel (Dog) French Bulldog (Dog) German Shepherd Dog (Dog) Great Pyrenees (Dog) Hovawart (Dog) Huntaway (Dog) Irish Setter (Dog) Irish Wolfhound (Dog) New Zealand Heading Dog (Dog) Pembroke Welsh Corgi (Dog) Poodle (Dog) Poodle, Toy (Dog) Rhodesian Ridgeback (Dog) Romanian Mioritic Shepherd Dog (Dog) Rottweiler (Dog) Saint Bernard (Dog) Shetland Sheepdog (Dog) Shiloh Shepherd (Dog) Soft Coated Wheaten Terrier (Dog) Tibetan Terrier (Dog) White Swiss Shepherd Dog (Dog) Wire Fox Terrier (Dog) Degenerative myelopathy SOD1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 31 NC_006613.3:g.26540342G>A NM_001003035.1:c.118G>A NP_001003035.1:p.(E40K) NM_001003035.1; NP_001003035.1, additional breeds added based on PMID:38081509, PMID:39335301 and PMID: 37106965. PMID: 24524809: The A allele was detected in at least 1 representative from 124 breeds (not all listed in this table). Additional breeds based on PMID:40965331 and PMID:41830531 rs853026434 2009 19188595
1302 OMIA:002322-9615 dog Dutch Tulip Hound (Dog) Paroxysmal dyskinesia, juvenile SOD1 delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated ROS_Cfam_1.0 31 g.26654939delinsCAC c.12delinsCAC p.(K4Nfs*7) NM001003035.1; NP_001003035.1; published p.(K4Dfs*6) updated to HGVS recommendation, genomic coordinates not available for CanFam3.1 2021 33677640
87 OMIA:000263-9615 dog Bernese Mountain Dog (Dog) Degenerative myelopathy SOD1 substitution missense Naturally occurring variant Not currently evaluated ROS_Cfam_1.0 31 NC_051835.1:g.26654979A>T NM_001003035.1:c.52A>T NP_001003035.1:p.(T18S) NM_001003035.1; NP_001003035.1 2011 21848967
1182 OMIA:002258-9913 taurine cattle Charolais (Cattle) Lethality, SOWAHB-related SOWAHB substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 6 g.91735816G>T p.(Q379K) This variant was detected by Bourneuf et al. (2017) as a de novo mutation from an analysis of whole-genome-sequence of a Charolais AI bull. No information was provided on the descendants of this bull. rs5334475088 2017 28904385
1065 OMIA:002190-8932 rock pigeon Recessive red SOX10 e^1 deletion, gross (>20) Naturally occurring variant Not currently evaluated Domyan et al. (2014) reported a 7.5kb deletion that spans "a conserved enhancer element that drives Sox10 expression in melanocytes" 2014 24508169
1066 OMIA:002190-8932 rock pigeon Recessive red SOX10 e^2 deletion, gross (>20) Naturally occurring variant Not currently evaluated Domyan et al. (2014) reported a 2.5kb deletion that spans "a conserved enhancer element that drives Sox10 expression in melanocytes" 2014 24508169
661 OMIA:001569-9031 chicken Dark brown/yellow plumage SOX10 deletion, gross (>20) Naturally occurring variant Not currently evaluated GRCg6a 1 g.51035106_51042744delinsGGTGCGGTGA Gunnarsson et al. (2011): "an 8.3-kb deletion upstream of SOX10" Zhu et al. (2022): "the genome region from 51,035,106 bp to 51,042,744 bp is missing in LY [yellow] chickens, with this region showing a novel 10 bp insertion (GGTGCGGTGA)" 2011 21210960
1367 OMIA:002453-9823 pig Waardenburg syndrome SOX10 duplication frameshift Genome-editing (CRISPR-Cas9) Not currently evaluated Sscrofa11.1 5 NC_010447.5:g.9892647dup NM_001099933.1:c.321dup NP_001093403.1:p.(K108Qfs*45) 2016 26442986
1366 OMIA:002453-9823 pig Bama Xiang Zhu, China (Pig) Waardenburg syndrome SOX10 substitution missense Chemical mutagenesis (ENU) Not currently evaluated Sscrofa11.1 5 NC_010447.5:g.9892651A>T NM_001099933.1:c.325A>T NP_001093403.1:p.(R109W) 2017 28639938
758 OMIA:000782-9031 chicken Japanese Game Bantam (Chicken) Pea comb SOX5 repeat variation Naturally occurring variant Not currently evaluated 1 "Pea-comb is caused by a massive amplification of a duplicated sequence located near evolutionary conserved non-coding sequences in intron 1 of the gene encoding the SOX5 transcription factor." The pea-comb mutant phenotype results from large-scale amplification of this duplication: pea comb alleles typically have 20-40 copies of the duplicated sequence, which must be sufficient to interfere with transcription. 2009 19521496
1040 OMIA:002175-9796 domestic horse Bashkir Curly (Horse) Missouri Fox Trotter, Germany (Horse) Curly coat with/without hypotrichosis SP6 substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 11 NC_009154.3:g.24096309C>T XM_023652659.1:c.1090G>A XP_023508427.1:p.(G364S) Thomer et al. (2018): "SP6; NC_009154.2:g.24022045C>T, ss3021042887" with respect to EquCab2. Updated coordinates in this entry obtained from EVA rs1095048852; 14 Mar 2019. Protein coordinates in this table previously inocrrectly shown as p.(D346N); corrected 13/06/2024. rs1095048852 2018 29686323
206 OMIA:001247-9913 taurine cattle Brown Swiss (Cattle) Original Swiss Brown (Cattle) Red Dane (Cattle) Spinal dysmyelination SPAST substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 11 NC_037338.1:g.14742184G>A NM_001081591.1:c.1964G>A NP_001075060.1:p.(R560Q) rs445770480 2010 19714378 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1856 OMIA:003028-9615 dog Poodle, Standard (Dog) Retinal atrophy, cone-rod dystrophy SPATA7 deletion, gross (>20) frameshift Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 8 NC_049229.1:g.60022583_60040453del XM_038545497.1:r.1,314_1,629delins[g.60018954–60018990] XP_038401425.1:p.(D361Efs*2) 2025 41325489
392 OMIA:002435-9823 pig Sperm, short tail SPEF2 insertion, gross (>20) splicing Naturally occurring variant Not currently evaluated 16 an inserted retrotransposon within an intron 2006 16549801
37 OMIA:001318-9615 dog Mixed Breed (Dog) Elliptocytosis SPTB substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 8 g.39170437G>A c.6119C>T p.(T2020M) NM_001220481.1; NP_001207410.1; published as c.6384C>T and p.(T2110M); coordinates in the table have been updated to a recent reference genome and / or transcript 2009 19228356
457 OMIA:002092-9615 dog Beagle (Dog) Ataxia, spinocerebellar, SPTBN2-related SPTBN2 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 18 g.50666027_50666034del c.5855_5862del p.(I1952Rfs*28) XM_005631422.3; XP_005631479.1; published as chr18:53,691,704_53,691,711del (CanFam2); p.(G1952insRDRGQGRPLLLMHRHGAGAA); coordinates in the table have been updated to a recent reference genome and / or transcript and are updated to HGVS nomenclature 2012 22781464
1149 OMIA:002232-9823 pig Large White (Pig) Myopathy, congenital, SPTBN4-related SPTBN4 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Sscrofa11.1 6 NC_010448.4:g.48801281_48801296del XM_021094394.1:c.5706_5721del XP_020950053.1:p.(T1903fs) Derks et al. (2019): ENSSSCP00000031537:p.Arg1902fs 2019 31850074
659 OMIA:001230-9796 domestic horse American Trotter (Horse) XY sex reversal SRY deletion, gross (>20) Naturally occurring variant Not currently evaluated Y "at least the DNA-binding domain of the SRY gene was deleted from the Y chromosome of the XY mare" 1995 7558880
920 OMIA:001230-9913 taurine cattle Holstein Friesian (Cattle) Japanese Black, Japan (Cattle) Jersey (Cattle) Ovotesticular DSD (Disorder of Sexual Development) SRY deletion, gross (>20) Naturally occurring variant Not currently evaluated Y A deletion of the SRY gene 1996 8978769
354 OMIA:002096-9796 domestic horse Akhal-Teke (Horse) Naked foal syndrome ST14 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated EquCab3.0 7 NC_009150.3:g.39710628G>T XM_005611718.2:c.388G>T XP_005611775.1:p.(E130*) rs5334475187 2017 28235824 (FN thanks Emily Rogers for providing the genomic location (determined using BLAT with the XM_005611718.2 sequence against Equcab 3.0) and the sequence refs for the cDNA and protein variants, working under the supervision of Professor Ernie Bailey; 24 April 2020)
1425 OMIA:002526-9685 domestic cat Alimentary lymphoma, inducer of STAT5B substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 E1 NC_058381.1:g.40866763T>G XM_045044630.1:c.1924A>C XP_044900565.1:p.(N642H) SOMATIC MUTATION 2021 34680385 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1527 OMIA:002623-9615 dog Australian Shepherd (Dog) Primary ciliary dyskinesia, STK-related STK36 substitution splicing Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 37 NC_049258.1:g.25167072G>A XM_038585732.1:c.2868-1G>A XP_038441660.1:p.(M957Pfs*11) XM_038585732.1; XP_038441660.1 2023 36786090
700 OMIA:001297-9615 dog Norwegian Elkhound (Dog) Early retinal degeneration STK38L insertion, gross (>20) Naturally occurring variant Not currently evaluated 27 "a SINE insertion in exon 4 of the canine STK38L/NDR2 gene. The mutation removes exon 4 from STK38L transcripts" 2010 20887780
438 OMIA:001356-9796 domestic horse Coat colour, grey/gray (slow greying) STX17 G2 repeat variation Naturally occurring variant Not currently evaluated EquCab3.0 25 NC_009168.3:g.6625295_6629872dup two tandom copies of a 4.6kb intronic region in STX17, which increase the expression of both STX17 and a neighbouring gene NR4A3 2008 18641652
1732 OMIA:001356-9796 domestic horse Coat colour, grey/gray (fast greying) STX17 G3 repeat variation Naturally occurring variant Not currently evaluated EquCab3.0 25 NC_009168.3:g.6625295_6629872[3] three tandom copies of a 4.6kb intronic region in STX17 which increase the expression of both syntaxin-17 and a neighbouring gene NR4A3 2024 39209879
1438 OMIA:002537-9541 crab-eating macaque Encephalopathy, STXBP1-related STXBP1 substitution missense Base-editing Not currently evaluated Macaca_fascicularis5.0 15 g.101106196C>T c.875G>A p.(R292H) XM_005582167.2; XP_005582224.1 2022 35283272
214 OMIA:001960-9913 taurine cattle Simmental (Cattle) Abortion due to haplotype FH4 SUGT1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 12 NC_037339.1:g.11102143A>G NM_001046203.2:c.949T>C NP_001039668.1:p.(W317R) rs110793536 2015 25927203 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
587 OMIA:000059-9913 taurine cattle Brown Swiss (Cattle) Arachnomelia, BTA5 SUOX insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 5 g.57316723_57316724insG c.363_364insG p.(A124Gfs*42) rs5334475086 2010 20865119 Variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1905 OMIA:003060-9615 dog Mixed Breed (Dog) Phloiokeratosis SUV39H1 deletion, small (<=20) nonsense (stop-gain) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 X NC_049260.1:g.42103621_42103622del XM_038587376 .1:c.543_544del XP_038443304 .1:p.(C181*) 2026 42350566
1904 OMIA:003060-9615 dog Weimaraner (Dog) Phloiokeratosis SUV39H1 substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 X NC_049260.1:g.42103676C>T XM_038587376 .1:c.596C>T XP_038443304 .1:p.(S199L) 2026 42350566
1906 OMIA:003060-9615 dog Border Terrier (Dog) Phloiokeratosis SUV39H1 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 X NC_049260.1:g.42103740_42103745del XM_038587376 .1:c.661_666del XP_038443304.1:p.(E221_C222del) 2026 42350566
1907 OMIA:003060-9615 dog Saluki (Dog) Phloiokeratosis SUV39H1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 X NC_049260.1:g.42111103del XM_038587376 .1:c.1189del XP_038443304 .1:p.(R397Vfs*75) 2026 42350566
970 OMIA:001373-9615 dog Greyhound (Dog) Nasal parakeratosis SUV39H2 deletion, small (<=20) Naturally occurring variant Not currently evaluated CanFam3.1 2 g.21731812_21731815del c.996+3_996+6del XM_005617114.3; deletion AAGT 2018 29423952
86 OMIA:001373-9615 dog Labrador Retriever (Dog) Nasal parakeratosis SUV39H2 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 2 NC_006584.3:g.21731842A>C XM_005617114.3:c.972T>G XP_005617171.1:p.(N324K) XM_005617114.3; XP_005617171.1 rs851549203 2013 24098150
1132 OMIA:002219-9685 domestic cat Domestic Shorthair (Cat) Hypogonadotropic hypogonadism, TAC3-related TAC3 substitution missense Naturally occurring variant VUS F.catus_Fca126_mat1.0 B4 NC_058374.1:g.83380534C>T XM_003988924.6:c.220G>A XP_003988973.1:p.(V74M) 2019 31615056 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1051 OMIA:002180-9823 pig Duroc (Pig) Embryonic lethality TADA2A substitution splicing Naturally occurring variant Not currently evaluated Sscrofa11.1 12 NC_010454.4:g.38922102G>A splice-donor mutation causing retention of intron 13 or exon skipping of exon 13 (Derks et al., 2019) rs5334475174 2019 30875370
670 OMIA:001617-9694 tiger Sweet taste, lack TAS1R2 reference sequence allele Naturally occurring variant Not currently evaluated "a 247-base pair microdeletion in exon 3 and stop codons in exons 4 and 6" 2005 16103917
668 OMIA:001617-32536 cheetah Sweet taste, lack TAS1R2 reference sequence allele Naturally occurring variant Not currently evaluated "a 247-base pair microdeletion in exon 3 and stop codons in exons 4 and 6" 2005 16103917
650 OMIA:001617-9685 domestic cat Sweet taste, lack of TAS1R2 reference sequence allele Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 C1 F.catus_Fca126_mat1.0 the TAS1R2 gene in cats, tigers and cheetahs has "a 247-base pair microdeletion in exon 3 and stop codons in exons 4 and 6 ... cat Tas1r2 is an unexpressed pseudogene" 2005 16103917
1122 OMIA:002213-9447 Ring-tailed lemur Bitter taste TAS2R16 substitution missense Naturally occurring variant Not currently evaluated p.(S282L) 2019 31161904
1620 OMIA:000240-8839 Mallard Crest cushion TAS2R40 substitution regulatory Naturally occurring variant Not currently evaluated 1 published as variant in the 5′UTR of TAS2R40 (123272114_c. G78A) 2023 37652165
1277 OMIA:001972-9793 ass (donkey) Coat colour, dun TBX3 D insertion, small (<=20) Naturally occurring variant Not currently evaluated ASM1607732v2 8 NC_052184.1:42737976_42737977insT Wang et al. (2020) report 'non-dun' as a "1 bp deletion (chr8:g.42742556 CT>C−) located ~18.6 kb downstream of the transcription start site of the TBX3 gene." The reference genome ASM1607732v2 represents the non-dun allele and information has been changed in the table to report the coordinates for the dun allele [05/06/2024]

     


 
2020 33293529
1029 OMIA:001972-9796 domestic horse Non-dun without primitive markings TBX3 nd2 reference sequence allele regulatory Naturally occurring variant Not currently evaluated EquCab3.0 8 allele is represented by the reference genome EquCab3.0 2016 26691985 [IT thanks Haley Rutstein, working under the guidance of Professor Ernie Bailey, for contributions to this entry in April 2024]
1701 OMIA:001972-9796 domestic horse Curly Horse (Horse) Fjord (Horse) Icelandic Horse (Horse) Polish Konik (Horse) Quarter Horse (Horse) Vyatka (Horse) Dun TBX3 D haplotype regulatory Naturally occurring variant Not currently evaluated EquCab3.0 8 NC_009151.3:g.[20665796_20665797insCCTTCTGGC;20665807_20665808ins[1609]] 2016 26691985 [IT thanks Haley Rutstein, working under the guidance of Professor Ernie Bailey, for contributions to this entry in April 2024]. Additional breed information based on Stefaniuk-Szmukier et al. (2017) and Belousova et al. (2023).
1028 OMIA:001972-9796 domestic horse American Trotter (Horse) Arab (Horse) Curly Horse (Horse) Faeroes Pony (Horse) Gotland Pony (Horse) Mongolian (Horse) Quarter Horse (Horse) Shetland Pony (Horse) Swedish Warmblood (Horse) Vyatka (Horse) Non-dun with primitive markings TBX3 nd1 haplotype regulatory Naturally occurring variant Not currently evaluated EquCab3.0 8 NC_009151.3:g.[20665796_20665797insCCTTCTGGC;20665807_20665808ins[1610]] 2016 26691985 [IT thanks Haley Rutstein, working under the guidance of Professor Ernie Bailey, for contributions to this entry in April 2024]. Additional breed information based on Belousova et al. (2023).
1210 OMIA:000839-9031 chicken Feathered shanks TBX5 substitution regulatory Naturally occurring variant Not currently evaluated GRCg6a 15 g.12573054T>C This SNP is 25kb upstream of the gene TBX5 (Bortoluzzi et al., 2020; Li et al. 2020) rs3386894056 2020 32344431 32344429
213 OMIA:001951-9913 taurine cattle Holstein (black and white) (Cattle) Vertebral and spinal dysplasia TBXT substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 9 NC_037336.1:g.101160274T>C NM_001192985.1:c.196A>G NP_001179914.1:p.(K66E) rs5334475020 2015 25614605 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
79 OMIA:000975-9615 dog Pembroke Welsh Corgi (Dog) Bob tail TBXT substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 1 NC_006583.3:g.54192143G>C NM_001003092.1:c.189C>G NP_001003332.1:p.(I63M) rs1152388402 2001 11252170 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
525 OMIA:000975-9685 domestic cat American Bobtail (Cat) Manx (Cat) Pixiebob (Cat) Tail, short TBXT MX^4 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B2 NC_058372.1:g.148707058del XM_003986708.4:c.1196del XP_003986757.2:p.(P399Rfs*26) published as c.1199delC and p.(P400Rfs*26); coordinates in the table have been updated to a recent reference genome and / or transcript and in accordance with HGVS 3'-rule 2013 23949773 Genomic position in Felis_catus_9.0 is based on information provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
524 OMIA:000975-9685 domestic cat Manx (Cat) Pixiebob (Cat) Tail, short TBXT MX^3 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B2 NC_058372.1:g.148707087del XM_003986708.4:c.1166del XP_003986757.2:p.(P389Rfs*36) published as c.1169delC and p.(P390Rfs*36); coordinates in the table have been updated to a recent reference genome and / or transcript and in accordance with HGVS 3'-rule 2013 23949773 Genomic position in Felis_catus_9.0 is based on information provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
523 OMIA:000975-9685 domestic cat American Bobtail (Cat) Manx (Cat) Pixiebob (Cat) Tail, short TBXT MX^1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B2 NC_058372.1:g.148709037del XM_003986708.4:c.995del XP_003986757.2:p.(L332Pfs*22) published as c.998delT and p.(L333Pfs*22); coordinates in the table have been updated to a recent reference genome and / or transcript 2013 23949773 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
623 OMIA:000975-9685 domestic cat Manx (Cat) Pixiebob (Cat) Tail, short TBXT MX^2 delins, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B2 NC_058372.1:g.[148709018_148709020del;148709021_148709037dup] XM_003986708.4:c.[995_1011dup;1011_1014del] XP_003986757.2:p.(A338Sfs*21) published as c.998_1014dup17delGCC and p.(A339Sfs*21); coordinates in the table have been updated to a recent reference genome and / or transcript 2013 23949773 Genomic position in Felis_catus_9.0 is based on information provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1578 OMIA:000975-9940 sheep Tail, short TBXT substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 8 NC_040259.1:g.95879358C>A XM_027972732.1:c.334G>T XP_027828533.1:p.G112W The gene is also called TBXT 2018 35948368 29208649
95 OMIA:001975-9615 dog Spanish Water Dog (Dog) Neuroaxonal dystrophy, juvenile TECPR2 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 8 NC_006590.3:g.70433320C>T XM_022422394.1:c.4009C>T XP_547986.3:p.(R1337W) 2015 26555167 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
912 OMIA:001673-9823 pig Large White, Finland (Pig) Spermatogenic arrest TEX14 insertion, gross (>20) splicing Naturally occurring variant Not currently evaluated 12 "a 51 bp insertion within exon 27, which caused differential splicing of the exon and created a premature translation stop codon" 2011 22136159
963 OMIA:001941-9913 taurine cattle Holstein (black and white) (Cattle) Abortion due to haplotype HH5 TFB1M complex rearrangement Naturally occurring variant Not currently evaluated 9 "a deletion of 138kbp, spanning position 93,233kb to 93,371kb on chromosome 9 (BTA9), harboring only dimethyl-adenosine transferase 1 (TFB1M). The deletion breakpoints are flanked by bovine long interspersed nuclear elements Bov-B (upstream) and L1ME3 (downstream), suggesting a homologous recombination/deletion event." 2016 27128314
1619 OMIA:002761-51751 ball python Skin colour, piebald TFEC substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.493C>T p.(R165*) Coordinates based on a Python bivittatus assembly 2023 36702128
295 OMIA:000424-9913 taurine cattle Africander (Cattle) Goitre, familial TG substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 14 NC_037341.1:g.8432343G>A XM_025001401.1:c.1963C>T XP_024857169.1:p.(R655*) rs480120030 1987 3472203 Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool
264 OMIA:000424-9925 goat Nederlandse Landgeit, Netherlands (Goat) Goitre, familial TG substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS1.2 14 NC_030821.1:g.73537317C>G XM_018058585.1:c.945C>G XP_017914074.1:p.(Y315*) Previously listed as p.(Y296*), coordinated updated to recent transcript rs5334475116 1993 8380383 The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries
1903 OMIA:003059-9615 dog Rottweiler (Dog) Hypothyroidism and dwarfism TG substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 13 NC_049234.1:g.29881970C>T NM_001048104.1:c.3694C>T NP_001041569.1:p.(R1232*) 2026 42173671
706 OMIA:000546-9615 dog Jack Russell Terrier (Dog) Ichthyosis TGM1 insertion, gross (>20) Naturally occurring variant Not currently evaluated 8 a LINE-1 insertion in the TGM1 gene 2009 19438474
1595 OMIA:002370-9940 sheep North Country Cheviot (Sheep) Motor neuron disease, TMCO6-related TMCO6 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UI_Ramb_v2.0 5 NC_056058.1:g.49438388_49438391del XM_012178620.3:c.645_648del XP_012034010.1:p.(L215Ffs*34) XP_012034010.1 2023 37488055
1047 OMIA:000303-9031 chicken White Leghorn (Chicken) Dwarfism, autosomal TMEM263 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated GRCg6a 1 g.53638233C>T c.433G>A p.(W59*) Wu et al. (2018): "NM_001006244.1:c.433G > A . . . NP_001006244.1:p.(Trp59∗)" 2018 29930570
1042 OMIA:002176-9940 sheep Coopworth (Sheep) Perendale (Sheep) Meckel-like hepatorenal fibrocystic dysplasia syndrome TMEM67 haplotype Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 9 NC_040260.1:g.[91651651A>C;91651669A>T] XM_012184130.2:c.[2042T>A;2060T>G] XP_012039520.2:p.[(I681N);(I687S)] Published as c.[2050T>A; 2068T>G] rs1086155906; rs1088172192 2017 28487520 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
779 OMIA:001902-9913 taurine cattle Simmental (Cattle) Male subfertility TMEM95 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.2 19 g.27056843C>A c.483C>A p.(C161*) rs378652941 2014 24391514 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
13 OMIA:001302-9031 chicken Resistance to avian sarcoma and leukosis viruses, subgroup B TNFRSF10B substitution missense Naturally occurring variant Not currently evaluated 22 c.G>C p.(C125S) 2008 18094190
324 OMIA:001302-9031 chicken Resistance to avian sarcoma and leukosis viruses, subgroup B TNFRSF10B substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated GRCg6a 22 g.1418711C>T c.172C>T p.(Q58*) rs736008824 2002 12097608 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1238 OMIA:002285-9940 sheep Merino (Sheep) Ovine congenital progressive muscular dystrophy TNNT1 deletion, small (<=20) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 14 NC_040265.1:g.66970247del XM_027978800.1:c.746+1del Published as "KT218690 c.614 + 1delG" (Clayton et al., 2020); Oar3.1 chr14: g.59556001delG and Oar4.0 chr14: g.59437065delG (Josh Clayton, pers comm., 7 Sep 2020) 2020 32819427
397 OMIA:000162-9103 turkey Cardiomyopathy, dilated TNNT2 deletion, small (<=20) splicing Naturally occurring variant Not currently evaluated delGGGCTCCTC 2002 11886865
1279 OMIA:002304-9685 domestic cat British Longhair (Cat) British Shorthair (Cat) Devon Rex (Cat) Maine Coon (Cat) Ragdoll (Cat) Sphynx (Cat) Unknown significance TNNT2 substitution Naturally occurring variant VUS Felis_catus_9.0 F1 g.42204052C>T c.95-108G>A This particular variant was a single base pair substitution (G to A) within intron 3, corresponding to c.95-108G > A of ENSFCAG00000004613 (McNamara et al., 2020). Based on the evidence provided by Schipper et al. (2022), this variant is now classified as having "unknown significance". For archival reasons, the variant remains in the OMIA variant table, but its "unknown significance" classification clearly indicates that, on the basis of current knowledge (2 June 2022), it "should not be used for breeding decisions regarding HCM" (Schipper et al., 2022). Additional breeds in which variant has been detected are based on PMID:38371598. 2020 33304277
1543 OMIA:002663-9615 dog Weimaraner (Dog) Dystonia–ataxia syndrome, paroxysmal TNR insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 7 g.23940980dup c.831dup p.(N278Qfs*38) XM_038542431.1; XP_038398359.1; published as g.23940980dupC; c.831dupC 2023 37023257
437 OMIA:000175-9796 domestic horse Arab (Horse) Bashkir Curly (Horse) Quarter Horse (Horse) Trakehner (Horse) Welsh Pony (Horse) Cerebellar abiotrophy TOE1 substitution missense Naturally occurring variant Not currently evaluated EquCab3.0 2 NC_009145.3:g.13122415C>T XM_001496197.5:c.284G>A XP_001496247.1:p:R95H ENSECAT00000009202.3:c.541-13539C>T ENSECAT00000024892.2:c.284G>A ENSECAP00000020698.1:p.Arg95His A SNP "located in exon 4 of TOE1 and approximately 1200 base pairs upstream of MUTYH, adjacent to a possible binding site for the transcription factor GATA2" (Brault et al., 2011). EquCab3.1 coordinate provided by Meredith O’Connell, working under the supervision of Professor E. Bailey. Additional breeds added based on supplementary table 6 of Durward-Akhurst et al. (2024, PMID: 38600096).  rs397160943 2011 21126570
425 OMIA:000536-9615 dog Spanish Water Dog (Dog) Hypothyroidism TPO insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 17 g.773950_773951insG c.39_40insG p.(R14Efs*184) NM_001003009.2; NP_001003009.2; the variant expands a stretch of 8 consecutive guanine residues to 9 guanine residues and introduces an early frameshift 2013 23223904
273 OMIA:000536-9615 dog Rat Terrier (Dog) Toy Fox Terrier (Dog) Hypothyroidism TPO substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 17 NC_006599.3:g.784624C>T NM_001003009.2:c.331C>T NP_001003009.2:p.(Q111*) 2003 12564727 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
50 OMIA:000536-9615 dog Tenterfield Terrier (Dog) Hypothyroidism TPO substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 17 NC_006599.3:g.799099C>T NM_001003009.2:c.1777C>T NP_001003009.2:p.(R593W) NM_001003009.2 2012 23113744 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
407 OMIA:000536-9615 dog French Bulldog (Dog) Hypothyroidism TPO substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 17 NC_006599.3:g.801598T>C NM_001003009.2:c.2242+2T>C 2015 26478542
138 OMIA:000536-9685 domestic cat Domestic Shorthair (Cat) Hypothyroidism TPO substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A3 NC_058370.1:g.139582244C>T XM_045055112.1:c.1418G>A XP_044911047.1:p.(A473T) c. and p. previously listed as XM_006930524.4:c.1333G>A, XP_006930586.2:p.(A445T) - updated to recent NCBI transcript [09/07/2025] 2015 Reference not in PubMed; see OMIA 000536-9685 for reference details Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1485 OMIA:000536-9685 domestic cat British Shorthair (Cat) Domestic Longhair (Cat) Domestic Medium Hair (Cat) Domestic Shorthair (Cat) Russian Blue (Cat) Hypothyroidism TPO substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A3 NC_058370.1:g.139592392C>T XM_045055112.1:c.514G>A XP_044911047.1:p.(G172R) c. and p. previously listed as XM_006930524.4:c.430G>A, XP_006930586.2:p.(G144R) - updated to recent NCBI transcript [09/07/2025] 2022 36054182 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1519 OMIA:001472-9823 pig Yucatan Miniature, United States of America (Pig) Neuronal ceroid lipfuscinosis, 2 (CLN2) TPP1 not known nonsense (stop-gain) Transgenesis via viral vectors Not currently evaluated p.(R208*) 2022 36100791
1538 OMIA:001472-9541 crab-eating macaque Neuronal ceroid lipofuscinosis, 2 TPP1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated c.42delC p.(L15Sfs*33) 2023 36918063
473 OMIA:001472-9615 dog Dachshund (Dog) Neuronal ceroid lipofuscinosis, 2 TPP1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 21 g.29925076del c.325delC p.(R108Gfs*6) NP_001013869.1; NM_001013847.1, genomic coordinates in accordance with HGVS 3' rule 2006 16621647
725 OMIA:001341-9796 OMIA:002139-9796 domestic horse American Miniature Horse (Horse) Appaloosa (Horse) British Spotted Pony, Spotted Pony, United Kingdom of Great Britain and Northern Ireland (Horse) English Spotted Pony, Australia (Horse) Knabstrupper (Horse) Malopolski (Horse) Noric (Horse) Pony Of the Americas, Germany (Horse) Shetland Pony (Horse) Thoroughbred (Horse) Stationary congenital night blindness & Leopard Complex/Appaloosa spotting TRPM1 insertion, gross (>20) Naturally occurring variant Not currently evaluated EquCab3.0 1 NC_009144.3:g.109211964_109211965insN[1378] "a 1378 bp retroviral LTR insertion in intron 1 of TRPM1", EquCab2.0: g.108297929_108297930insN[1378] 2013 24167615 Coordinates in EquCab3.0 kindly provided by Haley Rutstein, working under the guidance of Professor Ernie Bailey.
1682 OMIA:002841-30538 alpaca Suri (Alpaca) Fleece variation, Suri type TRPV3 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated VicPac3.2 16 NW_021964189.1:g.4265902G>T XM_031685167.1:c.1423G>T XP_031541027.1:p.(E475*) 2024 38365607
140 OMIA:000319-9685 domestic cat American Curl (Cat) Minuet (Cat) Munchkin (Cat) Norwegian Forest Cat (Cat) Scottish Fold (Cat) Scottish Fold Longhair (Cat) Ears, folded TRPV4 Fd substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 D3 NC_058379.1:g.18723951C>A XM_023241517.2:c.1024G>T XP_023097285.2:p.(V342F) 2016 27063440 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. Additional breeds added based on PMID:42108233
1130 OMIA:002215-9615 dog Schnauzer, Standard (Dog) Leukodystrophy, TSEN54-related TSEN54 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 9 NC_006591.3:g.5015506C>T XM_540434.6:c.371G>A XP_540434.3:p.(G124D) XM_540434.6; XP_540434.3 2019 31584937
410 OMIA:000542-9913 taurine cattle Pezzata Rossa Italiana, Italy (Cattle) Hypotrichosis, streaked TSR2 substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.2 X g.91964644A>G c.441+226A>G rs5334475030 2015 26203908 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
949 OMIA:001984-9615 dog Golden Retriever (Dog) Golden Retriever PRA 2 TTC8 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 8 g.60090186del c.669delA p.(K223Rfs*15) 2014 26401321
345 OMIA:002036-9913 taurine cattle Holstein Friesian (Cattle) Abortion (embryonic lethality), TTF1 TTF1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 11 NC_037338.1:g.102463944G>A NM_001102083.1:c.1579G>A NP_001095553.1:p.(R527*) rs715966442 2016 27646536 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1772 OMIA:002922-9615 dog English Cocker Spaniel (Dog) Retinopathy with vitamin E deficiency TTPA deletion, gross (>20) deletion (in-frame) Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 29 NC_049250.1:13696669_13696770del XM_038579384.1:c.23_124del XP_038435312.1:p.(P8_P41del) 2025 39874248
98 OMIA:002434-9615 dog Cairn Terrier (Dog) Norfolk Terrier (Dog) Thrombocytopaenia TUBB1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 24 NC_006606.3:g.43761303G>A XM_022408906.1:c.5G>A XP_022264614.1:p.(R2H) XM_022408906.1; XP_022264614.1 2014 25060661 Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn.
81 OMIA:002434-9615 dog King Charles Spaniel (Dog) Thrombocytopaenia TUBB1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 24 NC_006606.3:g.43766144G>A XM_022408906.1:c.745G>A XP_022264614.1:p.(D249N) XM_022408906.1; XP_022264614.1 rs1152388419 2008 18466252 Sequence information used to identify the genomic location was kindly provided by Mary K Boudreaux.
776 OMIA:001939-9913 taurine cattle Brown Swiss (Cattle) Original Swiss Brown (Cattle) Simmental (Cattle) Haplotype with homozygous deficiency BH2 TUBD1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 19 g.10833921T>C c.757T>C p.(H210R) rs383232842 2016 27225349 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
1414 OMIA:002515-9913 taurine cattle Brown Swiss (Cattle) Haplotype with homozygous deficiency OH2 TUBGCP5 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.1268426G>T NM_001102495.1:c.311C>A NP_001095965.1:p.(T104K) NM_001102495.1 rs720533878 2021 34915862
594 OMIA:001593-9913 taurine cattle Charolais (Cattle) Scurs, type 2 TWIST1 duplication frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 4 NC_037331.1:g.27819577_27819586dup NM_001191145.1:c.148_157dup NP_001178074.1:p.(A56Rfs*87) c.DNA position based on NM_001191145.1 2011 21814570 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446.
761 OMIA:001469-9913 taurine cattle Belted Galloway (Cattle) Brown Swiss (Cattle) Dutch Belted (Cattle) Lakenvelder (Cattle) Yakutskii Skot, Russian Federation (Cattle) Coat colour, white belt TWIST2 repeat variation Naturally occurring variant Not currently evaluated 3 "The belt-associated variant was a copy number variant (CNV) involving the quadruplication of a 6 kb non-coding sequence located approximately 16 kb upstream of the TWIST2 gene" (Awasthi Mishra et al., 2017) 200922: g. info moved to here (g.118,607,715-118,614,131) until it can be standardised "a quadruplication on bovine chromosome 3 between positions 118,608,362 and 118,614,132 bp" (UMD3.1) (Rothammer et al., 2018). Hogers et al. (2026) report the location as ARS‐UCD2.0 - BTA3:118 028 480–118 034 892. 2017 28658273
1027 OMIA:000202-9773 humpback whale Migaloo, the white whale TYR deletion, small (<=20) Naturally occurring variant Not currently evaluated "(264 del C) at codon 88" 2012 22140253
666 OMIA:000202-9669 domestic ferret Coat colour, albinism TYR deletion, gross (>20) Naturally occurring variant Not currently evaluated "deletion of exon 4" 2007 17655555
723 OMIA:000202-8090 Japanese medaka Skin colour, albinism tyr i1 insertion, gross (>20) Naturally occurring variant Not currently evaluated a 1.9 kb fragment, corresponding to a novel transposable element (Tol1), has been inserted in exon 1 of the gene for tyrosinase 1995 8552044
1554 OMIA:000202-8090 Japanese medaka Skin colour, albino (quasi-albino) tyr i4 insertion, gross (>20) Naturally occurring variant Not currently evaluated a 4.7-kb insertion in exon 5 (Tol2-tyr) 1996 8779712
1555 OMIA:000202-8090 Japanese medaka Skin colour, albino (weak) tyr i(b) insertion, gross (>20) Naturally occurring variant Not currently evaluated a 4.7-kb insertion in the 5' untranslated region (Tol2) 2004 15016305
1746 OMIA:000202-8296 axolotl Skin colour, albino TYR deletion, gross (>20) frameshift Naturally occurring variant Not currently evaluated Linkage group 7 "a 142 bp deletion of tyr a coding sequence at the end of exon 1 (extending ~3 kb in to intron 1) that results in a frame-shift and premature stop codon" (Woodcock et al., 2017) 2017 28127056
1304 OMIA:000202-3370412 Japanese raccoon dog Albinism TYR complex rearrangement Naturally occurring variant Not currently evaluated Mae et al. (2020): "the third exon was removed due to a deletion ... :two separate regions of 3.8 kb and 7.3 kb had been removed, but a segment of 0.3 kb between these two regions was retained, though was present in the reverse orientation." 2020 32783776
718 OMIA:000369-9031 chicken Feather colour, recessive white TYR C*C insertion, gross (>20) Naturally occurring variant Not currently evaluated 1 a retroviral insertion in the tyrosinase gene 2006 16457736
1829 OMIA:000202-1960652 red-necked wallaby Albinism, oculocutaneous TYR insertion, gross (>20) Naturally occurring variant Not currently evaluated 2022 35030050
1162 OMIA:000202-9557 hamadryas baboon Siamese coat colour pattern TYR substitution missense Naturally occurring variant Not currently evaluated p.(A365T) ENSPANT00000015629.2:c.1093G>A; A0A096MRE4:p.(Ala365Thr) [Koga et al., 2020] 2020 32053406
813 OMIA:000202-8410 Japanese wrinkled frog Albinism TYR substitution missense Naturally occurring variant Not currently evaluated c.1127G>A p.(G376D) 2018 28674275
814 OMIA:000202-8409 dark-spotted frog Albinism TYR insertion, small (<=20) Naturally occurring variant Not currently evaluated c.1244_1245insT 2018 28674275
332 OMIA:000202-452646 American mink Albinism TYR substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.138T>A p.(C46*) 2008 18822100
812 OMIA:000202-1772025 Rice frog Albinism TYR substitution missense Naturally occurring variant Not currently evaluated c.169G>A p.(G57R) 2018 28674275
260 OMIA:000202-452646 American mink Himalayan TYR substitution missense Naturally occurring variant Not currently evaluated c.1835C>G p.(H420Q) 2009 19308642
1011 OMIA:000202-9689 lion White lion TYR substitution missense Naturally occurring variant Not currently evaluated c.260G>A p.(R87Q) 2013 24045858
1600 OMIA:000202-9544 Rhesus monkey Coat colour, oculocutaneous albinism TYR substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated 14 c.552C>A p.(S184*) 2000 10751629
355 OMIA:000202-9515 Tufted capuchin Coat colour, albinism TYR substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.64C>T p.(R22*) 2017 28476152
816 OMIA:000202-8409 dark-spotted frog Albinism TYR deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated c.682_684del p.(L228del) 2018 28674275
1004 OMIA:000202-10141 domestic guinea pig Coat colour, albinism Tyr substitution missense Naturally occurring variant Not currently evaluated c.710A>G p.(D237G) PRJEB26285 2018 29947431
1599 OMIA:000202-9544 Rhesus monkey Coat colour, golden TYR substitution missense Naturally occurring variant Not currently evaluated 14 c.768C>G p.(H256Q) 2023 37522525
815 OMIA:000202-8409 dark-spotted frog Albinism TYR insertion, small (<=20) Naturally occurring variant Not currently evaluated c.768_769insT 2018 28674275
513 OMIA:000369-9031 chicken Feather colour, albinism TYR C*A deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated 1 c.817_822del6 p.(D237_W238del) 2000 10685888
1303 OMIA:000202-31143 Japanese ratsnake Coat colour, oculocutaneous albinism TYR albino - pet trade substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated c.895C>T p.(R299X) 2018 30158334
1601 OMIA:000202-9544 Rhesus monkey Coat colour, oculocutaneous albinism TYR substitution missense Naturally occurring variant Not currently evaluated 14 c.934C>A p.(L312I) 2020 32259106
1594 OMIA:000202-9901 American bison Oculocutaneous albinism type I (OCA1), TYR-related TYR substitution missense Naturally occurring variant Not currently evaluated 29 g.7995584C>T c.1114C>T p.(G372R) 2023 37481261
1851 OMIA:000202-9913 taurine cattle Angus (Cattle) Coat colour, albinism, oculocutaneous TYR substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 29 NC_037356.1:g.6389480C>G NM_181001.3:c.1184+1G>C 2026 42101288
1830 OMIA:000202-9913 taurine cattle Simmental (Cattle) Coat colour, albinism, oculocutaneous TYR substitution missense Naturally occurring variant Not currently evaluated ARS-UCD2.0 29 NC_037356.1:g.6343738G>A NM_181001.3:c.1283C>T NP_851344.1:p.(P428L) 2025 40913728
589 OMIA:000202-9913 taurine cattle Brown Swiss (Cattle) Coat colour, albinism, oculocutaneous TYR insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD2.0 29 NC_037356.1:g.6424971_6424972insG NM_181001.3:c.925_926insC Insertion causes a frameshift that resulted in a premature stop codon at residue 316, whereas normal sequence contains 517 amino acids. 2004 14727143 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1789 OMIA:000369-311895 green‐cheeked parakeet Feather colour, non-sex-linked lutino TYR substitution missense Naturally occurring variant Not currently evaluated ASM1176335v2 (GCA_011763355.2) c.1111C>T p.(H371Y) 2025 40195888
151 OMIA:000202-9793 ass (donkey) Coat colour, albinism TYR substitution missense Naturally occurring variant Not currently evaluated ASM1607732v2 20 NC_052196.1:58132615G>C XM_014827959.2:c.616C>G XP_014683445.2:p.(H206D) Published as c.604C>G, p.(H202D) - coordinates in the table were updated to reflect the recent reference genome




2016 26763160
1788 OMIA:000369-60463 Fischer's lovebird Feather colour, non-sex-linked lutino TYR delins, small (<=20) missense Naturally occurring variant Not currently evaluated ASM3478289v1 (GCA_034782895.1) c.736‐737TG>CT p.(W246L) 2025 40195888
1758 OMIA:000202-9615 dog Mixed Breed (Dog) Himalayan coat colour TYR substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 21 NC_006603.3:10893930G>A NM_001002941.1:c.229C>T NP_001002941.1:p.(R77W) 2025 39709984
1247 OMIA:000202-9615 dog Dachshund (Dog) Himalayan coat colour TYR substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 21 NC_006603.3:g.10893929C>T NM_001002941.1:c.230G>A NP_001002941.1:p.(R77Q) NM_001002941.1; NP_001002941.1 2020 33039541 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
1159 OMIA:000202-9860 red deer White TYR substitution missense Naturally occurring variant Not currently evaluated CerEla 1.0 2 c.871G>A p.(G291R) 2020 32041521
349 OMIA:000202-9685 domestic cat Albinism TYR c^2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 D1 NC_058377.1:43927287G>A XM_045038634.1:c.1204C>T XP_044894569.1:p.(R402*)          


rs5334475126 2017 27634063 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1024 OMIA:000202-9685 domestic cat Burmese (Cat) Mocha TYR c^m duplication delins (in-frame) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 D1 NC_058377.1:44012836_44012998dup XM_045038634.1:c.820_936delinsAATCTC XP_044894569.1:p.(I274_L312delinsNL) published as NC_018732.3:chromosome D1:45898609_45898771dup,  c.820_936delinsAATCTC (p.I274_L312delinsNL) 2019 30716167 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
122 OMIA:000202-9685 domestic cat Siamese (Cat) Siamese coat colour pattern TYR c^s substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 D1 NC_058377.1:44013031C>T XM_045038634.1:c.904G>A XP_044894569.1:p.(G302R) published as c. 940G>A and p.(G302R) by Lyons et al. (2005) and p.(G301R) by Schmidt-Küntzel et al. (2005)               2005 15771720 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
494 OMIA:000202-9685 domestic cat Coat colour, complete albinism TYR c deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 D1 NC_058377.1:g.44012999del XM_045038634.1:c.939del XP_044894569.1:p.(S314Pfs*9) published as "a cytosine deletion in TYR at position 975 in exon 2", HGVS 3' rule applied to g. coordinates 2006 16573534 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
121 OMIA:000202-9685 domestic cat Burmese (Cat) Burmese coat colour pattern TYR c^b substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 D1 NC_058377.1:g.44022819C>A XM_045038634.1:c.679G>T XP_044894569.1:p.(G227W) Felis_catus_6.2: g.46406472C>A, Felis_catus 9.0: g.45907839C>A rs5334475127 2005 15771720 The genomic location on Felis_catus_9.0 and transcript information was based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
247 OMIA:000202-9986 rabbit New Zealand White (Rabbit) Zika, Hungary (Rabbit) Coat colour, albinism TYR substitution missense Naturally occurring variant Not currently evaluated OryCun2.0 1 NC_013669.1:g.127636997G>T NM_001082077.1:c.1118C>A NP_001075546.1:p.(T373K) The OryCun2.0 reference genome is from a white rabbit and reflects the albino coat colour g.127636997T; NM_001082077.1 and NP_001075546.1 reflect the wildtype allele. 2000 10920244
1520 OMIA:000202-9986 rabbit Oculocutaneous albinism TYR substitution missense Base-editing Not currently evaluated OryCun2.0 1 NC_013669.1:g.127650868T>C NM_001082077.1:c.973A>G NP_001075546.1:p.(T325A) 2022 35282412
1748 OMIA:000369-9135 common canary Feather colour, pearl TYR substitution missense Naturally occurring variant Not currently evaluated serCan2020 1 NC_066313.1:g.34568603C>A XM_009102738.4:c.134C>A XP_009100986.1:p.(P45H) 2024 39377483
329 OMIA:000202-89462 water buffalo Murrah (Buffalo) Albinism TYR substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated UOA_WB_1 5 NC_037549.1:g.82063942C>T XM_006075179.2:c.1431G>A XP_006075241.1:p.(W477*) 2012 22817390
1118 OMIA:000202-9627 red fox Albinism TYR insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated VulVul2.2 NW_020356544.1 g.7130732dup c.365dup p.(N122Kfs4*) XM_026015193.1; XP_025870978.1; published as c.365dupA 2019 31246286
1255 OMIA:001249-452646 American mink American Palomino coat colour TYRP1 b^p insertion, gross (>20) Naturally occurring variant Not currently evaluated "a large insertion of approximately eight kb. The insertion most likely disrupts different elements necessary for the splicing of intron 2 of the TYRP1 gene" (Cicera et al., 2016) 2016 26886941
1597 OMIA:001249-9544 Rhesus monkey Coat colour, golden TYRP1 substitution missense Naturally occurring variant Not currently evaluated 15 c.1028A>G p.(N343G) 2023 37522525
1598 OMIA:001249-9544 Rhesus monkey Coat colour, golden TYRP1 substitution missense Naturally occurring variant Not currently evaluated 15 c.1244T>C p.(L415P) 2023 37522525
753 OMIA:002061-345164 Saker falcon Feather colour, light brown TYRP1 haplotype splicing Naturally occurring variant Not currently evaluated c.79C>T and c.79_80insT in exon 1, resulting in "a frameshift change and a premature stop codon at position 81 of the deduced protein sequence, which in the wild-type form contains 536 amino acids. 2017 27611661
258 OMIA:001322-93934 Japanese quail Feather colour, roux TYRP1 substitution missense Naturally occurring variant Not currently evaluated c.845T>C p.(F282S) 2007 18028514
1713 OMIA:001249-9691 leopard Coat colour, red TYRP1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated XM_019415513:c.369del XP_019271058:p.(G63Afs*6) 2022 35782007
1745 OMIA:002817-8296 axolotl Skin colour, copper TYRP1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated 6p g.1225541490del c.1156del p.(G388Efs*28) 2024 39333770
1518 OMIA:001249-9643 American black bear Cinnamon coat colour TYRP1 substitution missense Naturally occurring variant Not currently evaluated HiC_scaffold_24 g.6724152G>A p.(R153C) 2023 36528024
184 OMIA:001249-9913 taurine cattle Dexter (Cattle) Dun brown TYRP1 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 8 NC_037335.1:g.31633328G>A NM_174480.3:c.1300C>T NP_776905.2:p.(H434Y) rs3423268465 2003 12755816 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1059 OMIA:001249-9925 goat Toggenburg (Goat) Valais Copperneck Brown TYRP1 substitution missense Naturally occurring variant Not currently evaluated ARS1.2 8 NC_030815.1:g.31503165C>T NM_001285727.1:c.1487G>A NP_001272656.1:p.(G496D) rs5334475101 2015 25392961 The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries
796 OMIA:001249-9615 dog Brown TYRP1 b^d deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated CanFam3.1 11 g.33326727_33326729del c.1033_1035del p.(P345del) rs851422848 2002 12140685
31 OMIA:001249-9615 dog Huntaway (Dog) Brown TYRP1 b^c substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 11 NC_006593.3:g.33317810T>A XM_005626363.2:c.121T>A XP_005626420.1:p.(C41S) muptiple breeds, additional breeds based on PMID:40965331 rs851939320 2002 12140685 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. Correction to genomic details provided by professor Claire Wade August 2018. Correction to g and c. details provided by Professor Tosso Leeb 11 Feb 2020.
1282 OMIA:001249-9615 dog Siberian Husky (Dog) Brown TYRP1 b^h substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 11 NC_006593.3:g.33317814G>A NM_001194966.1:c.125G>A XP_00562420.1:p.(C42Y) NM_001194966.1, c.125G>A, p.Cys42Tyr (Van Buren et al., 2021) 2021 33421162
797 OMIA:001249-9615 dog Australian Shepherd (Dog) Huntaway (Dog) Brown TYRP1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 11 NC_006593.3:g.33319349T>G NM_005626363.2:c.555T>G XP_00562420.1:p.(Y185*) ROS_Cfam_1.0 g.34224397T>G ENSCAFT00845015439.1:c.555T>G ENSCAFP00845011991.1:p.Tyr185Ter, additional breeds based on PMID:40965331 rs1152388483 2017 28497851
267 OMIA:001249-9615 dog Huntaway (Dog) New Zealand Heading Dog (Dog) Brown TYRP1 b^s substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated CanFam3.1 11 NC_006593.3:g.33326685C>T XM_005626363.2:c.991C>T XP_005626420.1:p.(Gln331*) multiple breeds, additional breeds based on PMID:40965331 rs850566878 2002 12140685 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1113 OMIA:001249-9615 dog Lancashire Heeler (Dog) Liver TYRP1 b^e substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 11 NC_006593.3:g.33326719T>G XM_005626363.2:c.1025T>G XP_005626420.1:p.(F342C) 2019 31468558
379 OMIA:001249-9685 domestic cat Chocolate TYRP1 b substitution splicing Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 D4 NC_058380.1:38142265G>A NM_001042560.2:c.1261+5G>A based on Lyons et al. (2005): c.1261+5G>A; based on Schmidt-Küntzel et al. (2005) this splice variant results in c.1261_1262insN[51^54]; p.(A420_D421insX[17^18]) and is inherited together with g.40068871C>G / c.8C>G / p.(A3G); F.catus_Fca126_mat1.0 and NM_001042560.2 represent the A allele 2005 16104383 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
306 OMIA:001249-9685 domestic cat Cinnamon (light brown) TYRP1 b^l substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 D4 NC_058380.1:g.38130163C>T NM_001042560.2:c.298C>T NP_001036025.2:p.(R100*) Felis_catus_9.0 reference sequence represents the T allele 2005 16104383 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1057 OMIA:001259-9031 chicken Orpington (Chicken) Wyandotte (Chicken) Chocolate feathered TYRP1 substitution missense Naturally occurring variant Not currently evaluated GRCg6a Z g.30830300G>T c.640C>A p.(H214N) 2019 30457703
227 OMIA:001249-9940 sheep Brown TYRP1 substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 2 c.2240C>G p.(A???V) 2013 23451726
1127 OMIA:001249-9940 sheep Valais Red (Sheep) Brown TYRP1 b^VS1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 2 NC_040253.1:g.87540706_87540707del NM_001130023.1:c.86_87del NP_001123495.1:p.(E29Vfs*5) NM_001130023.1: c.86_87delGA; NP_001123495.1: p.(Glu29ValfsTer5) 2019 31571241 210906 to conform to HGVS notation, FN removed GA from g.87540706_87540707delGA and c.86_87delGA
226 OMIA:001249-9940 sheep Soay (Sheep) Tawny (light brown) TYRP1 b^Soay substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 2 NC_040253.1:g.87545636G>T NM_001130023.1:c.869G>T NP_001123495.1:p.(C290F) rs402624085 2007 17254985 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1128 OMIA:001249-9940 sheep Valais Red (Sheep) Brown TYRP1 b^VS2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 2 NC_040253.1:g.87549195C>T NM_001130023.1:c.1066C>T NP_001123495.1:p.(R356*) NM_001130023.1: c.1066C>T; NP_001123495.1: p.(Arg356*) rs1085637427 2019 31571241
1058 OMIA:001249-9986 rabbit Havanna (Rabbit) Brown TYRP1 b substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated OryCun2.0 1 g.41359827C>T c.570G>A p.(W190*) NM_001297495.1; NP_001284424.1; published as g.41360196G>A, c.570G>A, p.Trp190ter but review of the genomic position suggests that the genomic location is OryCun2.0: chr1:41359827C>T 2014 24814776
1791 OMIA:001259-9228 Rose-ringed parakeet Feather colour, cinnamon TYRP1 substitution missense Naturally occurring variant Not currently evaluated P.krameri1.0 c.691G>A p.(E231K) 2025 40195888
1790 OMIA:001259-9228 Rose-ringed parakeet Feather colour, cinnamon TYRP1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated P.krameri1.0 c.86_95del p.(C29fs*64) 2025 40195888
508 OMIA:001249-9823 pig Dahe, China (Pig) Tibetan, China (Pig) Wujin - Kele, China (Pig) Wujin - Liangshan, China (Pig) Brown TYRP1 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated Sscrofa11.1 1 NC_010443.5:g.209726926_209726931del NM_001025226.1:c.1484_1489del NP_001020397.1:p.(M495_G496del) Previously listed in OMIA as g.209726927_209726932del, corrected 29/01/2025 rs5334475178 2011 20978532
404 OMIA:001934-9913 taurine cattle Ayrshire, Finland (Cattle) Ptosis, intellectual disability, retarded growth and mortality (PIRM) syndrome UBE3B substitution splicing Naturally occurring variant Not currently evaluated ARS-UCD1.3 17 NC_037344.1:g.63668380C>T NM_001206232.2:c.2076G>A NP_001193161.1:p.(E692E) ENSBTAT00000003493.5:c.2076G>A ENSBTAP00000003493.4:p.Glu692= rs475678587 2014 25306138 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Variant rsID kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
1409 OMIA:002298-9913 taurine cattle Jersey (Cattle) Neuropathy with splayed forelimbs UCHL1 JNS substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.2 6 g.60158901G>A c.979G>A p.(E327K) Several transcripts are reported: ENSBTAT00000046823.2:c.718G>A ENSBTAP00000044075.1:p.Glu240Lys ENSBTAT00000066434.1:c.931G>A ENSBTAP00000063885.1:p.Glu311Lys ENSBTAT00000072800.1:c.979G>A ENSBTAP00000059848.1:p.Glu327Lys ENSBTAT00000074165.1:c.706G>A ENSBTAP00000057432.1:p.Glu236Lys rs1116058914 2022 34955244
1228 OMIA:002541-9685 domestic cat Munchkin (Cat) Munchkin standard UGDH delins, gross (>20) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B1 NC_058371.1:g.172171181_172174505delinsN[108] Felis catus 9.0:NC_018726.3:g.174882895_174886198delins108 (Struck et al., 2020) 2020 32605545 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
740 OMIA:001586-9685 domestic cat Deficient acetaminophen glucuronidation UGT1A6 reference sequence allele Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 C1 F.catus_Fca126_mat1.0 "sequencing of the entire UGT1A6 exon 1 coding region revealed five deleterious genetic mutations ... [in cats] UGT1A6 is a pseudogene". UGT1A6 is a pseudogene in all cats  - not to be used for diagnostic testing 2000 10862526
290 OMIA:000262-9913 taurine cattle Holstein (black and white) (Cattle) Holstein Friesian (Cattle) Red Holstein, Switzerland (Cattle) Wagyu (Cattle) Deficiency of uridine monophosphate synthase UMPS substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.3 1 NC_037328.1:g.69151931C>T NM_177508.1:c.1213C>T NP_803474.1:p.(R405*) rs5334474835 1993 8486364 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
1157 OMIA:001609-9615 dog German Longhaired Pointer (Dog) German Shorthaired Pointer (Dog) Vizsla (Dog) Exfoliative cutaneous lupus erythematosus UNC93B1 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 18 NC_006600.3:g.49834825C>A XM_540813.6:c.1438C>A XP_540813.3:p.(P480T) XM_540813.6:c.1438C>A; XP_540813.3:p.(Pro480Thr) (Leeb et al., 2020) 2020 32028618
1053 OMIA:002182-9823 pig Landrace (Pig) Embryonic lethality URB1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Sscrofa11.1 13 NC_010455.5:g.195977038del XM_021069844.1:c.5995del XP_020925503.1:p.(V1999fs) published as 13:g.195977038delC; ENSSSCP00000036505:p.Val1961fs: "introduces 26 novel amino acids and a premature stop codon, producing a truncated protein of 1,986 amino acids, lacking the final 261 amino acids compared to the wild-type protein (2,247 AA)." rs5334475182 2019 30875370
906 OMIA:001176-9940 sheep Scottish Blackface (Sheep) Porphyria cutanea tarda UROD substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 1 NC_040252.1:g.20327971T>C NM_001012341.1:c.392T>C NP_001012341.1:p.(L131P) Oar_v3.1 position is g.19437840T>C; protein and cDNA positions are based on NP_001012341.1 and NM_001012341.1, respectively rs429214636 2005 16026339 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
137 OMIA:001175-9685 domestic cat Domestic Shorthair (Cat) Porphyria, congenital erythropoietic UROS haplotype missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 D2 NC_058378.1:g.[81231649C>T;81246195G>A] XM_003994514.5:c.[140C>T;331G>A] XP_003994563.1:p.[(S47F);(G111S)] 2010 20485863 Genomic position in Felis_catus_9.0 provided by Joshua Khamis, Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1300 OMIA:001216-9615 dog Australian Cattle Dog (Dog) Dalmatian (Dog) English Cocker Spaniel (Dog) German Shorthaired Pointer (Dog) Wirehaired Pointing Griffon (Dog) Roan USH2A T^R duplication Naturally occurring variant Not currently evaluated CanFam3.1 38 Brancalion et al. (2021) "identified a duplicated DNA segment (11 398 bp) lying within the 67th intron of USH2A and spanning CFA38:11131841–11143239 (canfam3.1)". Kawakami et al. (2021) identified the same duplication: "an 11-kb tandem duplication (11,131,835–11,143,237)" 2021 33539602 33755696
370 OMIA:001431-9615 dog Pomeranian (Dog) Vitamin D-deficiency rickets, type II VDR deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 27 g.6895070del c.462del p.(P155Lfs*40) XM_038438367.1; XP_038294295.1; a single G deletion at the exon 4 / intron 4 junction; splicing is not affected, but the aberrant transcript contains a frameshift and premature stop codon; coordinates have been updated to recent reference sequence and differ from the publication 2009 19909429
1843 OMIA:001431-9685 domestic cat Domestic Shorthair (Cat) Vitamin D-dependent rickets type 2 VDR substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B4 NC_058374.1:g.74665603G>A XM_019834851.3:c.509C>T XP_019690410.2:p.(P170L) 2025 41083377
1586 OMIA:001431-9685 domestic cat Domestic Longhair (Cat) Vitamin D-dependent rickets type 2 VDR deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 B4 NC_058374.1:g.74684169del XM_019834851.3:c.106del XP_019690410.2:p.(R36Efs*18) published as c.106delC

2023 37387221 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
917 OMIA:001947-9615 dog Eurasier (Dog) Cerebellar hypoplasia, VLDLR-associated VLDLR deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 1 NC_006583.3:g.91266144del NM_001286978.1:c.1713del NP_001273907.1:p.(W572Gfs*10) NM_001286978.1; NP_001273907.1; published as c.1713delC 2015 25668033 Genomic position in CanFam3.1 provided by Robert Kuhn
15 OMIA:000865-9031 chicken White Leghorn (Chicken) Restricted ovulator VLDLR substitution missense Naturally occurring variant Not currently evaluated GRCg6a Z NC_006127.5:g.26569213G>C NM_205229.1:c.2177G>C NP_990560.1:p.(C726S) published as p.(C682S), updated to reflect reference genome [1/8/2026] 1995 7568242
1512 OMIA:002602-9615 dog Working Kelpie (Dog) Cerebellar abiotrophy VMP1 substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 9 NC_049230.1:g.34218228C>A ENSCAFP00805028489.1:p.(P160Q) 2022 36292596
995 OMIA:002152-9615 dog Rottweiler (Dog) Neuroaxonal dystrophy, VPS11-related VPS11 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 5 NC_006587.3:g.14777774T>C XM_546492.6:c.2504A>G XP_546492.2:p.(H835R) XM_546492.6; XP_546492.2 rs852867622 2018 29945969
478 OMIA:001428-9615 dog Border Collie (Dog) Huntaway (Dog) New Zealand Heading Dog (Dog) Trapped Neutrophil Syndrome VPS13B deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 13 g.1412654_1412657del c.2893_2896del p.(V595Ifs) XM_539102.7; XP_539102.2; published as g.4411950_4411953del GTTT (HM036106.1). BLAST of published sequence (HM036106.1) identified genomic position in CanFam3.1 as g.1412654_1412657del. Additional breeds based on PMID:40965331 2011 21605373
969 OMIA:001058-9823 pig Mixed Breed (Dog) Von Willebrand disease III VWF duplication frameshift Naturally occurring variant Not currently evaluated 5 p.(V814Lfs*3) "a tandem duplication of exons 17 and 18, causing a frameshift and a premature termination codon (p.Val814LeufsTer3) . . . This duplication putatively originates from porcine SINE elements located within VWF introns 16 and 18 with high identity. 2018 29208651
479 OMIA:001058-9615 dog Scottish Terrier (Dog) Von Willebrand disease III VWF deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 27 g.38848107del c.255del p.(V86Cfs) NM_001002932.1; NP_001002932.1; "a single base deletion [C] in the codon for amino acid 85 of the prepro-vWF cDNA" 2000 10668811
968 OMIA:001058-9615 dog Shetland Sheepdog (Dog) Von Willebrand disease III VWF deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated CanFam3.1 27 g.38868884del c.738del p.(F366Lfs) NM_001002932.1; NP_001002932.1; Venta, P. J., G. J. Brewer, V. Yuzbasiyan-Gurkan, W. D. Schall, and J. Duffendeck, 1998 Inventors; The Regents of the University of Michigan, assignee. DNA encoding canine von Willebrand factor and methods of use. United States patent US6074832A. 1998 Aug 11. 1998 Reference not in PubMed; see OMIA 001058-9615 for reference details
803 OMIA:001339-9615 dog Chinese Crested (Dog) German Shorthaired Pointer (Dog) German Wirehaired Pointer (Dog) Von Willebrand disease II VWF substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 27 NC_006609.3:g.38887211T>G NM_001002932.1:c.1657T>G NP_001002932.1:p.(W553G) 2017 28696025 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
371 OMIA:001058-9615 dog Nederlandse Kooikerhondje (Dog) Von Willebrand disease III VWF substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 27 NC_006609.3:g.38892182G>A NM_001002932.1:c.2186+1G>A NM_001002932.1; a G>A base substitution at the first position of the donor splice site sequence of intron 16 1998 9716162
84 OMIA:001339-9615 dog Boykin Spaniel (Dog) German Shorthaired Pointer (Dog) German Spitz (Dog) German Wirehaired Pointer (Dog) Von Willebrand disease II VWF substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 27 NC_006609.3:g.38924099A>G NM_001002932.1:c.4937A>G NP_001002932.1:p.(N1646S) variant initially identified in German Shorthaired Pointer and German Wirehaired Pointer and later reported in additional breeds: PMID: 37582787 rs852456570 2004 15133170 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
401 OMIA:001057-9615 dog Barbet (Dog) Bernese Mountain Dog (Dog) Brazilian Terrier (Dog) Doberman Pinscher (Dog) Dutch Shepherd (Dog) Huntaway (Dog) Kromfohrlander (Dog) Manchester Terrier (Dog) Von Willebrand disease I VWF substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 27 NC_006609.3:g.38951839G>A NM_001002932.1:c.7437G>A NP_001002932.1:p.(S2479S) Incomplete penetrance - some dogs with the variant do not develop clinical signs of disease. Additional breeds based on PMID:40965331 2013 23911791 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool.
1813 OMIA:001058-9615 dog Havanese (Dog) Von Willebrand disease III VWF substitution missense Naturally occurring variant Not currently evaluated UU_Cfam_GSD_1.0 27 NC_049248.1:g.7133670A>C NM_001002932.1:c.7711T>G NP_001002932.1:p.(C2571G) 2025 40504041
1814 OMIA:002970-9913 taurine cattle Belgian Blue (Cattle) Cleft palate, syndromic WDR33 substitution missense Naturally occurring variant Not currently evaluated ARS-UCD1.3 2 NC_037329.1:g.4772428C>T NM_001206078.1: c.2617C>T NP_001193007.1: p.(P873S) 2025 40525707
592 OMIA:002423-9913 taurine cattle Japanese Black, Japan (Cattle) Multiple ocular defects WFDC1 insertion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.2 18 g.10567100_10567101insC c.321insC insertion of a single base causes a frame shift mutation and a premature termination codon appeared at codon 126 2009 19374945 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
312 OMIA:001759-9685 domestic cat Burmese (Cat) Hypokalaemic periodic paralysis WNK4 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 E1 NC_058381.1:g.41327499C>T XM_019817924.3:c.2899C>T XP_019673483.1:p.(Q967*) 2012 23285264 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1618 OMIA:002759-9913 taurine cattle Brown Swiss (Cattle) Brachygnathia WNT10B duplication frameshift Naturally occurring variant Not currently evaluated ARS-UCD1.3 5 NC_037332.1:g.30846510dup XM_010805029.3:c.910dup XP_010803331.1:p.R304Pfs*14 XM_010805029.3; XP_010803331.1; published as g.30,846,510dupC; c.910dupC; variant is associated with increased risk of brachygnathia rs525007739 2023 37641348
11 OMIA:000679-9031 chicken New Hampshire (Chicken) Muscular dystrophy WWP1 substitution missense Naturally occurring variant Not currently evaluated GRCg6a 2 NC_006089.5:g.123014353G>A NM_001012554.2:c.1322G>A NP_001012572.1:p.(R441Q) 2008 18501710 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1358 OMIA:002445-9615 dog Mixed Breed (Dog) Xanthinuria, type I XDH substitution splicing Naturally occurring variant Not currently evaluated CanFam3.1 17 NC_006599.3:g.24941551C>T XM_005630313.3:c.654G>A XP_005630370.1:p.(R189_L218del) ENSCAFT00000047701.2; Ensembl VEP reported variant as synonymous, splice region variant, cDNA sequencing revealed removal of all 93 bp of exon 8 (p.Arg189_Leu218del) . Genomic position based on supplementary table S3. (Tate et al., 2021) 2021 34584846
1541 OMIA:002445-9685 domestic cat Domestic Shorthair (Cat) Xanthinuria, type 1 XDH substitution missense Naturally occurring variant Not currently evaluated F.catus_Fca126_mat1.0 A3 NC_058370.1:g.114863284C>T NM_001009217.1:c.2042C>T NP_001009217.1:p.(A681V) Corrected genomic coordinates from g.114863284C>T to (Felis_catus_9.0) NC_018725.3:g.117584799C>T [09/05/2025] 2023 36970934 Updated to F.catus_Fca126_mat1.0 by Bella Bartner.
1172 OMIA:002256-9615 dog Belgian Shepherd Dog (Dog) Cardiomyopathy and juvenile mortality YARS2 substitution missense Naturally occurring variant Not currently evaluated CanFam3.1 27 NC_006609.3:g.16157324G>A XM_543740.6:c.1054G>A XP_543740.1:p.(E352K) "XM_543740.6:c.1054G>A . . . XP_543740.1:p.(Glu352Lys)" (Gurtner et al. (2020) 2020 32183361
1551 OMIA:002688-9986 rabbit Microcephaly, primary YIPF5 substitution missense Base-editing Not currently evaluated p.(W218R) 2023 37142085
1376 OMIA:002468-9823 pig Bama Xiang Zhu, China (Pig) ZBED6 knock-out ZBED6 deletion, small (<=20) frameshift Genome-editing (CRISPR-Cas9) Not currently evaluated 9 c.1320del c.1320del causes a frameshift after codon 134 and a premature stop occurs at codon 224 (Wang et al., 2021) 2021 34710100
921 OMIA:001736-9913 taurine cattle Charolais (Cattle) Polled and multisystemic syndrome ZEB2 deletion, gross (>20) Naturally occurring variant Not currently evaluated 2 A 3.7Mb deletion encompassing the genes ARHGAP15, GTDC1 and ZEB2 2012 23152852
1246 OMIA:001736-9913 taurine cattle Simmental (Cattle) Polledness, abnormal skull shape, small body stature and subfertility ZEB2 Del11 deletion, small (<=20) Naturally occurring variant Not currently evaluated ARS-UCD1.2 2 g.52263360_52263370del 2020 33046754
1283 OMIA:002307-9913 taurine cattle Limousin (Cattle) Frontonasal dysplasia ZIC2 deletion, small (<=20) nonsense (stop-gain) Naturally occurring variant Not currently evaluated ARS-UCD1.2 12 g.76742067del c.1596del p.(S453*) rs3423095151 2021 33388042

* Variant pathogenicity for single-gene diseases as evaluated according to the Animal Variant Classification Guidelines (AVCG) by the Variant Pathogenicity Working Group of the International Society of Animal Genetics (ISAG) Animal Genetic Testing Standardization (AGTS) Standing Committee: P = pathogenic, LP = likely pathogenic, VUS = variant of unknown significance, LB = likely benign, B = benign. For more information (including details on the classification of each variant) see LINKS.

Overall Statistics
Total number of variants 1793
Variants with genomic location 1448 (80.8% )
Variants in a variant database, i.e. with rs ID 440 (24.5%)
Variant Type Count Percent
complex rearrangement 22 1.2%
deletion, gross (>20) 139 7.8%
deletion, small (<=20) 291 16.2%
delins, gross (>20) 14 0.8%
delins, small (<=20) 50 2.8%
duplication 49 2.7%
haplotype 33 1.8%
insertion, gross (>20) 82 4.6%
insertion, small (<=20) 80 4.5%
inversion 9 0.5%
not known 9 0.5%
reference sequence allele 8 0.4%
repeat variation 19 1.1%
substitution 987 55.0%
unknown 1 0.1%
Variant Effect Count Percent
deletion (in-frame) 58 3.2%
delins (in-frame) 10 0.6%
duplication (in-frame) 3 0.2%
extension (stop-lost) 3 0.2%
frameshift 322 18.0%
insertion (in-frame) 3 0.2%
missense 638 35.6%
nonsense (stop-gain) 231 12.9%
regulatory 48 2.7%
splicing 151 8.4%
start-lost 4 0.2%
synonymous 1 0.1%
unknown 321 17.9%
Year First Reported Count Percent
1986 1 0.1%
1987 1 0.1%
1988 0 0.0%
1989 2 0.1%
1990 3 0.2%
1991 2 0.1%
1992 5 0.3%
1993 6 0.3%
1994 11 0.6%
1995 7 0.4%
1996 15 0.8%
1997 14 0.8%
1998 25 1.4%
1999 21 1.2%
2000 26 1.5%
2001 16 0.9%
2002 32 1.8%
2003 18 1.0%
2004 20 1.1%
2005 30 1.7%
2006 36 2.0%
2007 59 3.3%
2008 34 1.9%
2009 44 2.5%
2010 48 2.7%
2011 57 3.2%
2012 70 3.9%
2013 73 4.1%
2014 59 3.3%
2015 77 4.3%
2016 86 4.8%
2017 98 5.5%
2018 81 4.5%
2019 94 5.2%
2020 119 6.6%
2021 105 5.9%
2022 75 4.2%
2023 100 5.6%
2024 104 5.8%
2025 75 4.2%
2026 44 2.5%