Search Results
Advanced search
Link to this search: https://omia.org/results/?result_type=variant&search_type=advanced
1836 variant records found |
[show instead phene records] |
By default, variants are sorted chronologically by year of publication, to provide a historical perspective.
Readers can re-sort on any column by clicking on the column header. Click it again to sort in a descending
order. To create a multiple-field sort, hold down Shift while clicking on the second, third etc relevant column
headers.
WARNING! Inclusion of a variant in this table does not automatically mean that it should be used for DNA testing. Anyone contemplating the use of any of these variants for DNA testing should examine critically the relevant evidence (especially in breeds other than the breed in which the variant was first described). If it is decided to proceed, the location and orientation of the variant sequence should be checked very carefully.
Since October 2021, OMIA includes a semiautomated lift-over pipeline to facilitate updates of genomic positions to a recent reference genome position. These changes to genomic positions are not always reflected in the ‘acknowledgements’ or ‘verbal description’ fields in this table.
| OMIA Variant ID | OMIA Phene-Species ID(s) | Species Name | Breed(s) | Variant Phenotype | Gene | Allele | Variant Type | Variant Effect | Source of Genetic Variant | AVCG Pathogenicity Classification* | Reference Sequence | Chr. | g. or m. | c. or n. | p. | Verbal Description | EVA ID | Year Published | PubMed ID(s) | Acknowledgements |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 2 | OMIA:000042-9031 | chicken | Wisconsin hypoalpha mutant (WHAM), United States of America (Chicken) | Analphalipoproteinaemia | ABCA1 | substitution | missense | Naturally occurring variant | Not currently evaluated | GRCg6a | Z | g.54877918C>T | c.265G>A | p.(E89K) | 2002 | 12364545 | Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool | |||
| 1126 | OMIA:002238-9913 | taurine cattle | Shorthorn (Cattle) | Ichthyosis, ABCA12-related | ABCA12 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 2 | g.103016791A>G | c.6776T>C | p.(L2259P) | NM_001191294.2:c.6776T>C; NP_001178223.2:p.(Leu2259Pro) | rs5334475100 | 2019 | 31568573 | ||
| 1220 | OMIA:002238-9913 | taurine cattle | Polled Hereford (Cattle) | Ichthyosis, ABCA12-related | ABCA12 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 2 | g.103043495_103043496insG | c.5689_5690insC | p.(S1784Ifs*33) | BTA 2:103043495–103043496insG; ENSBTAT00000004518.6:c.5689‐5690insC; ENSBTAP00000004518.6:p.(Ser1784Ilefs*33) (Eager et al., 2020) | rs3423092881 | 2020 | 32567073 | ||
| 195 | OMIA:002238-9913 | taurine cattle | Chianina (Cattle) | Ichthyosis, ABCA12-related | ABCA12 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.103030489T>C | NM_001191294.2:c.5804A>G | NP_001178223.2:p.(H1935R) | previously listed in OMIA as ARS-UCD1.2:g.103025585T>C, g. coordinates have been corrected after review of original paper and incorrectly assigned EVA rs ID has been removed [29/08/2024] | 2008 | 18344998 | |||
| 1861 | OMIA:002238-9685 | domestic cat | Domestic Shorthair (Cat) | Ichthyosis, ABCA12-related | ABCA12 | deletion, small (<=20) | frameshift | Not currently evaluated | F.catus_Fca126_mat1.0 | C1 | NC_058375.1:g.199458885del | XM_019838638.2:c.6600del | XP_019694197.1:p.(T2201Pfs*9) | published as XM_019838638.2:c.6926delC; ABCA12:p.Pro2201fsTer9 | 2025 | 41395671 | ||||
| 1379 | OMIA:002238-9823 | pig | Bama Xiang Zhu, China (Pig) | Ichthyosis | ABCA12 | substitution | splicing | Chemical mutagenesis (ENU) | Not currently evaluated | Sscrofa11.1 | 15 | NC_010457.5:g.117250799T>C | Intronic mutation IVS49-727 A>G results in splicing alteration resulting in a 132-nt insertion and a premature stop codon (Wang et al., 2019) | 2019 | 30925591 | |||||
| 1050 | OMIA:002179-9615 | dog | Labrador Retriever (Dog) | Stargardt disease 1 | ABCA4 | insertion, small (<=20) | frameshift | Naturally occurring variant | P | CanFam3.1 | 6 | NC_006588.3:g.55146556dup | NM_001003360.2:c.4176dup | NP_001003360.2:p.(F1393Lfs*3) | Mäkeläinen et al. (2019): "ENSCAFT00000005367 exon28 4170dupC* V1390fs" Importantly, the same authors also explain in Table S3 that "*The insertion is found in a cytosine mononucleotide-repeat region [55,146,550–55,146,556] and it is arbitrary at what position the actual insertion occurs. In the text we have denoted the insertion as c.4176insC, p.F1393Lfs*1395)." Variant information changed to reflect HGVS nomenclature | 2019 | 30889179 | |||
| 607 | OMIA:001402-9615 | dog | Border Collie (Dog) | Adverse reaction to certain drugs | ABCB1 | insertion, small (<=20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 14 | CanFam3.1 | published as c.73insAAT - the allele is reflected by the reference sequence CanFam3.1 and NM_001003215.2 as reference: g.13737172_13737174; c.73_75, p.N25; causality of this variant should be reviewed | 2010 | 21113104 | ||||||
| 469 | OMIA:001402-9615 | dog | Australian Shepherd (Dog) Border Collie (Dog) Collie (Dog) German Shepherd Dog (Dog) Long-Haired Whippet (Dog) Miniature Australian Shepherd Dog (Dog) Old English Sheepdog (Dog) Shetland Sheepdog (Dog) Silken Windhound (Dog) Waller (Dog) White Swiss Shepherd Dog (Dog) | Adverse reaction to certain drugs | ABCB1 | mdr1-1Delta | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 14 | NC_006596.3:g.13726596_13726599del | NM_001003215.2:c.228_231del | NP_001003215.2:p.(D77Afs*16) | 2001 | 11692082 | Variant information initially gleaned from or confirmed by Donner et al. (2016) PLoS One 11:e0161005 and later updated to reflect HGVS nomenclature. | ||
| 442 | OMIA:001402-9615 | dog | Border Collie (Dog) Huntaway (Dog) New Zealand Heading Dog (Dog) | Adverse reaction to certain drugs | ABCB1 | substitution | regulatory | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 14 | NC_006596.3:g.13742402A>C | published as Canfam2 chr14:16692274T>G, c.-6-180T>G, possible regulatory variant associated with resistance to phenobarbital treatment in epileptic Border Collies; an association between the variant and the phenotype was not supported in a different study: PMID: 31685133. Additional breeds based on PMID:40965331 | rs852787132 | 2011 | 21488961 | Genomic coordinates in CanFam3.1 and EVA ID provided by Zoe Shmidt and Robert Kuhn. | |||
| 1322 | OMIA:001402-9685 | domestic cat | Balinese (Cat) Domestic Longhair (Cat) Domestic Medium Hair (Cat) Domestic Shorthair (Cat) Maine Coon (Cat) Maine Coon Polydactyl (Cat) Ragdoll (Cat) Russian Blue (Cat) Siamese (Cat) Turkish Angora (Cat) | Adverse reaction to certain drugs | ABCB1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Out of scope | F.catus_Fca126_mat1.0 | A2 | NC_058369.1g.91572902_91572903del | NM_001171064.2:c.1930_1931del | published as ABCB1:1930_1931delTC; protein product is predicted to be severely truncated (~50%) and non functional | 2015 | 25660379 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Additional breeds reported based on PMID:34125616 and PMID:35709088. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 572 | OMIA:001524-9615 | dog | Shetland Sheepdog (Dog) | Gallbladder mucoceles | ABCB4 | insertion, small (<=20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 14 | g.13584928_13584929insC | c.1660_1661insG | p.(L554Rfs) | XM_539403.6; XP_539403.3; published as c.1583_1584G, the association between this variant and disease was later disproven and this variant should not be used as a diagnostic marker for GBM (Cullen et al. 2014) | 2010 | 20598156 | ||||
| 1574 | OMIA:002710-9615 | dog | Manchester Terrier (Dog) | Cardiomyopathy, dilated, ABCC9-related | ABCC9 | SCDY/DCM | substitution | missense | Naturally occurring variant | LP | Dog10K_Boxer_Tasha | 27 | NC_006609.4:g.21042635C>T | XM_022410972.2:c.3557G>A | XP_022266680.2:p.(R1186Q) | XM_022410972.2; XP_022266680.2 | 2023 | 37239348 | ||
| 1499 | OMIA:002589-8839 | Mallard | Blue eggshell | ABCG2 | haplotype | regulatory | Naturally occurring variant | Not currently evaluated | BGI_duck1.0 | NW_004676534.1 | g.[3573054A>G;3573085A>G] | The BGI_duck1.0 reference genome represents the blue eggshell genotype. | 2020 | 33186356 | ||||||
| 1477 | OMIA:002561-9913 | taurine cattle | Deutsche Holstein Schwarzbunt, Germany (Cattle) | Infertility | ABHD16B | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 13 | NC_037340.1:g.53957903G>A | NM_001038541.2:c.652C>T | NP_001033630.1:p.(Q218*) | ENSBTAT00000045249.4; ENSBTAP00000055253.1 | rs468948776 | 2020 | 31963602 | ||
| 1388 | OMIA:002368-9615 | dog | Golden Retriever (Dog) | Ichthyosis, ABHD5-related | ABHD5 | ICH2 | deletion, small (<=20) | frameshift | Naturally occurring variant | P | CanFam3.1 | 23 | NC_006605.3:g.2587000_2587013del | XM_542689.5:c.1006_1019del | XP_542689.2:p.(D336Sfs*6) | 2022 | 34791225 | |||
| 1504 | OMIA:002594-9823 | pig | N-acetyl-galactosamine intestinal concentration | ABO | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 1 | 2.3kb deletion encompassing exon 8 | 2022 | 35477154 | |||||||||
| 1177 | OMIA:001089-9542 | Japanese macaque | Antigen B | ABO | haplotype | Naturally occurring variant | Not currently evaluated | Allele B reflects the peptide haplotype p.266Met + p.268Ala | 2000 | 10984838 | ||||||||||
| 20 | OMIA:001089-9541 | crab-eating macaque | A antigen | ABO | haplotype | Naturally occurring variant | Not currently evaluated | p.266L + p.268G | Allele A is reflected in the peptide haplotype p.266Leu + p.268Gly | 1998 | 9583803 | |||||||||
| 21 | OMIA:001089-9544 | Rhesus monkey | Antigen A | ABO | haplotype | Naturally occurring variant | Not currently evaluated | p.266L + p.268G | Allele A is reflected in the peptide haplotype p.266Leu + p.268Gly | 1998 | 9583803 | |||||||||
| 1174 | OMIA:001089-9544 | Rhesus monkey | Antigen B | ABO | haplotype | Naturally occurring variant | Not currently evaluated | p.266M + p.268A | Allele B is a reflection of the peptide haplotype p.266Met + p.268Ala | 1998 | 9583803 | |||||||||
| 1175 | OMIA:001089-9541 | crab-eating macaque | B antigen | ABO | haplotype | Naturally occurring variant | Not currently evaluated | p.266M + p.268A | Allele B is a reflection of the peptide haplotype p.266Met + p.268Ala | 1998 | 9583803 | |||||||||
| 22 | OMIA:001089-9579 | agile gibbon | Alleles A and B | ABO | haplotype | missense | Naturally occurring variant | Not currently evaluated | c.2178C>A and c.2185G>C | Haplotype c.2178C + c.2185G is allele A; haplotype c.2178A + c.2185C is allele B | 2009 | 19298858 | ||||||||
| 23 | OMIA:001089-9580 | common gibbon | Blood group system ABO | ABO | haplotype | missense | Naturally occurring variant | Not currently evaluated | c.2178C>A and c.2185G>C | 2009 | 19298858 | |||||||||
| 532 | OMIA:001089-9598 | chimpanzee | O (lack of antigen) | ABO | O^del | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | c.514_522delGTGCTGGAG | p.(V172-E174del) | 1999 | 10380696 | |||||||
| 24 | OMIA:001089-9598 | chimpanzee | O (lack of antigen) | ABO | O^x | substitution | missense | Naturally occurring variant | Not currently evaluated | c.791A>C | p.(Y264C) | 1999 | 10380696 | |||||||
| 1497 | OMIA:002585-9615 | dog | Cavalier King Charles Spaniel (Dog) | medium-chain acyl-CoA dehydrogenase | ACADM | delins, gross (>20) | frameshift | Naturally occurring variant | P | UU_Cfam_GSD_1.0 | 6 | NC_049227.1:g.71401388_71401389delinsCATAATTCTTAGACAATATTGAGAATTAAC | XM_038541645.1:c.444_445delinsGTTAATTCTCAATATTGTCTAAGAATTATG | XP_038397573.1:p.(T150Ifs*6) | 2022 | 36292732 | ||||
| 972 | OMIA:002140-9615 | dog | German Hunting Terrier (Dog) | Exercise induced metabolic myopathy | ACADVL | substitution | nonsense (stop-gain) | Naturally occurring variant | P | CanFam3.1 | 5 | NC_006587.3:g.32193689C>A | XM_546581.5:c.1728C>A | XP_546581.3:p.(Y576*) | XM_546581.5; XP_546581.3 | 2018 | 29491033 | |||
| 429 | OMIA:001271-9913 | taurine cattle | Dexter (Cattle) | Bulldog calf | ACAN | BD2 | substitution | regulatory | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 21 | g.20377856C>T | c.-198C>T | rs3423095877 | 2007 | 17952705 | Variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 590 | OMIA:001271-9913 | taurine cattle | Dexter (Cattle) Highland (Cattle) | Bulldog calf | ACAN | BD1 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 21 | g.20422104_20422105insGGCA | c.2266_2267insGGCA | Variant initially identified in Dexter cattle and later reported in additional breeds: PMID:26885599 | 2007 | 17952705 | Variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1060 | OMIA:001271-9915 | indicine cattle (zebu) | Miniature Zebu, United Kingdom of Great Britain and Northern Ireland (Cattle) | Bulldog calf | ACAN | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 21 | g.20428539_20428540insC | c.5688_5689insC | p.(V1897fs*9) | cDNA position based on transcript NM_173981.2 | 2018 | 30305023 | |||
| 1001 | OMIA:001271-9796 | domestic horse | Miniature Horse (Horse) | Dwarfism, ACAN-related | ACAN | D4 | deletion, gross (>20) | deletion (in-frame) | Naturally occurring variant | LP/P | EquCab3.0 | 1 | NC_009144.3:g.95257479_95257499del | XM_005602799.2:c.7633_7653del | XP_005602856.2:p.(F2545_C2551del) | Genomic positions were previosuly incorreclty listed in OMIA as g.95257458_95257500del (until 10/01/2022) and g.95257480_95257500del (until 13/06/2024). Coordinates presented in the table reflect the published rs1095048839. IT is thanking Rebecca Bellone for spotting an error in the genomic coordinates which are now corrected (26/11/2024). |
rs1095048839 | 2018 | 30058072 | |
| 1792 | OMIA:001271-9796 | domestic horse | Miniature Horse (Horse) | Dwarfism, ACAN-related | ACAN | D5 | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 1 | NC_009144.3:g.95258999C>T | XM_005602799.2:c.7435G>A | XP_005602856.2:p.(A2479T) | 2023 | Reference not in PubMed; see OMIA 001271-9796 for reference details | |||
| 788 | OMIA:001271-9796 | domestic horse | Miniature Horse (Horse) Shetland Pony (Horse) | Dwarfism, ACAN-related | ACAN | D3* | substitution | missense | Naturally occurring variant | LP/P | EquCab3.0 | 1 | NC_009144.3:g.95282140C>G | XM_023650286.1:c.1513G>C | XP_023506054.1:p.(A505P) | ENSECAT00000040213.1:c.1513G>C ENSECAP00000032890.1:p.Ala505Pro This variant was named D3* by Eberth et al. (2018) | rs1095048823 | 2017 | 27942904 | Variant coordinates obtained from Eberth et al. (2018) and EVA_ID link |
| 1000 | OMIA:001271-9796 | domestic horse | Miniature Horse (Horse) Quarter Horse (Horse) Warmblood (Horse) | Dwarfism, ACAN-related | ACAN | D2 | substitution | missense | Naturally occurring variant | LP | EquCab3.0 | 1 | NC_009144.3:g.95284530C>T | XP_023506054.1:c.1270C>T | XP_023506054.1:p.(V424M) | rs3091781465 | 2018 | 30058072 | Breed information updated based on PMID: 38600096 | |
| 999 | OMIA:001271-9796 | domestic horse | Miniature Horse (Horse) Shetland Pony (Horse) | Dwarfism, ACAN-related | ACAN | D1 | deletion, small (<=20) | frameshift | Naturally occurring variant | P | EquCab3.0 | 1 | NC_009144.3:g.95291271del | XM_023650281.1:c.245del | XP_023506054.1:p.(K82Rfs*54) | 220110: changed g.95291270del to g.95291271del based on HGVS 3'rule. ENSECAT00000040213.1:c.245del ENSECAP00000032890.1:p.Lys82ArgfsTer54 | rs1095048841 | 2018 | 30058072 | Breed information updated based on PMID: 38600096 |
| 323 | OMIA:000702-9031 | chicken | Nanomelia | ACAN | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | GRCg6a | 10 | g.13502829C>A | c.4537G>T | p.(E1513*) | 1994 | 7827752 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||||
| 1045 | OMIA:002177-9615 | dog | Akita (Dog) American Akita (Dog) | Amelogenesis imperfecta, ACP4-related | ACPT | insertion, small (<=20) | frameshift | Naturally occurring variant | P | CanFam3.1 | 1 | NC_006583.3:g.106051997dupC | XM_541473.2:c.1189dupG | XP_541473.2:p.(A397Gfs) | ACPT is a synonym of ACP4 | 2019 | 30877375 | |||
| 1419 | OMIA:002226-9913 | taurine cattle | Brown Swiss (Cattle) | Haplotype with homozygous deficiency BH34 | ACSL5 | BH34 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 26 | NC_037353.1:g.32940521C>G | NM_001075650.1:c.528C>G | NP_001069118.1:p.(N176K) | NM_001075650.1 | rs5357452907 | 2021 | 34915862 | |
| 1259 | OMIA:002226-9615 | dog | Australian Kelpie (Dog) | Intestinal lipid malabsorption | ACSL5 | deletion, gross (>20) | Naturally occurring variant | P | CanFam3.1 | 28 | NC_006610.3:g.23380074_23483377del | 2020 | 33106515 | |||||||
| 1073 | OMIA:000388-9685 | domestic cat | Domestic Shorthair (Cat) | Fibrodysplasia ossificans progressiva | ACVR1 | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | C1 | NC_058375.1:g.147442389C>T | XM_045033838.1:c.617G>A | XP_044889773.1:p.(R206H) | 2019 | 31007133 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 633 | OMIA:001520-9615 | dog | Glen of Imaal Terrier (Dog) | Cone-rod dystrophy 3 | ADAM9 | deletion, gross (>20) | frameshift | Naturally occurring variant | P | 16 | "a deletion of exons 15 and 16 which alters the reading frame leading to a premature stop codon" in the ADAM9 gene | 2010 | 20691256 | |||||||
| 43 | OMIA:001870-9615 | dog | Beagle (Dog) | Glaucoma, primary open angle | ADAMTS10 | substitution | missense | Naturally occurring variant | P | CanFam3.1 | 20 | NC_006602.3:g.53096339C>T | XM_022406266.1:c.1981G>A | XP_022261974.1:p.(G661R) | XM_849227.3; XP_854320.1 | 2011 | 21379321 | |||
| 101 | OMIA:001870-9615 | dog | Norwegian Elkhound (Dog) | Glaucoma, primary open angle | ADAMTS10 | substitution | missense | Naturally occurring variant | P | CanFam3.1 | 20 | NC_006602.3:g.53101896C>T | XM_022406266.1:c.1159G>A | XP_022261974.1:p.(A387T) | XM_849227.3; XP_854320.1 | 2014 | 25372548 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 685 | OMIA:001976-9615 | dog | Basset Hound (Dog) | Glaucoma, primary open angle, ADAMTS17-related | ADAMTS17 | deletion, small (<=20) | frameshift | Naturally occurring variant | P | CanFam3.1 | 3 | NC_006585.3:g.40614853_40614872del | XM_022416850.1:c.194_213del | XP_022272558.1:p.(L68Gfs*) | 2015 | 26474315 | ||||
| 365 | OMIA:000588-9615 | dog | American Toy Terrier (Dog) Chinese Crested (Dog) German Hunting Terrier (Dog) Jack Russell Terrier (Dog) Lancashire Heeler (Dog) Miniature Bull Terrier (Dog) Parson Russell Terrier (Dog) Patterdale Terrier (Dog) Rat Terrier (Dog) Sealyham Terrier (Dog) Tenterfield Terrier (Dog) Tibetan Terrier (Dog) Toy Fox Terrier (Dog) Volpino Italiano (Dog) Welsh Terrier (Dog) Wire Fox Terrier (Dog) Yorkshire Terrier (Dog) | Lens luxation | ADAMTS17 | substitution | splicing | Naturally occurring variant | P | CanFam3.1 | 3 | NC_006585.3:g.40782144G>A | XM_022416850.1:c.1473+1G>A | XM_022416850.1; additional breeds reported by PMID:22050825 and PMID:37582787 | rs1152388408 | 2010 | 20375329 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 96 | OMIA:001976-9615 | dog | Basset Fauve de Bretagne (Dog) | Glaucoma, primary open angle, ADAMTS17-related | ADAMTS17 | substitution | missense | Naturally occurring variant | LP/P | CanFam3.1 | 3 | NC_006585.3:g.40808345G>A | XM_022416851.1:c.1552G>A | XP_022272559.1:p.(G518S) | XM_022416851.1; XP_022272559.1 | 2015 | 26474315 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1086 | OMIA:001976-9615 | dog | Petit Basset Griffon Vendeen (Dog) | Glaucoma, primary open angle, ADAMTS17-related | ADAMTS17 | inversion | Naturally occurring variant | P | CanFam3.1 | 3 | NC_006585.3:g.40812274_45768123inv | XM_545825.4:c.1721+2668_*4831255inv | Forman et al. (2015): "a 4.96 Mb inversion . . . with breakpoints in intron 12 of ADAMTS17 (chr3:40,812,274) and a downstream intergenic region (chr3:45,768,123) [Canfam3.1]… Analysis of RNAseq data revealed novel exon expression for ADAMTS17 due to cryptic splicing occurring 3’ of the exons located immediately upstream of the inversion event." | 2015 | 26683476 | |||||
| 942 | OMIA:000588-9615 OMIA:001976-9615 | dog | Chinese Shar-Pei (Dog) | Primary open-angle glaucoma (POAG), primary lens luxation (PLL), or both | ADAMTS17 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | LP/P | CanFam3.1 | 3 | NC_006585.3:g.40935387_40935392del | XM_014112382.2:c.3069_3074del | XP_013967857.1:p.(V1024_V1025del) | published as c.3070_3075delCGTGGT; p.(V1025_V1026del) | 2018 | 29287154 | |||
| 486 | OMIA:000328-9913 | taurine cattle | Belgian Blue (Cattle) | Ehlers-Danlos syndrome, type VII (Dermatosparaxis) | ADAMTS2 | delins, small (<=20) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 7 | g.2017035_2017051delinsAGC | c.464_480delinsAGC | 1999 | 10417273 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | |||||
| 1513 | OMIA:000328-9615 | dog | Alapaha Blue Blood Bulldog (Dog) American Pit Bull Terrier (Dog) | Ehlers-Danlos syndrome, type VII (Dermatosparaxis) | ADAMTS2 | deletion, small (<=20) | frameshift | Naturally occurring variant | P | CanFam3.1 | 11 | NC_006593.3:g.2280117del | XM_843844.4:c.10del | p.(P4Rfs*175) | delC | 2022 | 36421833 | |||
| 1117 | OMIA:000328-9615 | dog | Doberman Pinscher (Dog) | Ehlers-Danlos syndrome, type VII (Dermatosparaxis) | ADAMTS2 | substitution | nonsense (stop-gain) | Naturally occurring variant | P | CanFam3.1 | 11 | NC_006593.3:g.2408978C>T | XM_843844.4:c.769C>T | XP_848937.1:p.(R257*) | 2019 | 31294848 | ||||
| 1514 | OMIA:000328-9615 | dog | Catahoula Leopard Dog (Dog) | Ehlers-Danlos syndrome, type VII (Dermatosparaxis) | ADAMTS2 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 11 | NC_006593.3:g.2491238G>A | XM_843844.4:c.2897G>A | XP_848937.1:p.(R966H) | 2022 | 36421833 | ||||
| 1589 | OMIA:000328-9685 | domestic cat | Domestic Shorthair (Cat) | Ehlers-Danlos syndrome | ADAMTS2 | delins, small (<=20) | frameshift | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | A1 | NC_058368.1:g.90995621dup | XM_023254116.2:c.698dup | XP_023109884.2:p.(S235Qfs*3) | 2023 | 37462293 | ||||
| 318 | OMIA:000328-9940 | sheep | Dorper (Sheep) | Ehlers-Danlos syndrome, type VII (Dermatosparaxis) | ADAMTS2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 5 | NC_040256.1:g.1938399G>T | XM_027969213.1:c.424G>T | XP_027825014.1:p.(E142*) | XM_012156230:c.424G>T, XP_012011620:p.Glu142* (Joller et al., 2017) | 2012 | 22497338 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 857 | OMIA:000328-9940 | sheep | Dorper (Sheep) | Ehlers-Danlos syndrome, type VII (Dermatosparaxis) | ADAMTS2 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 5 | NC_040256.1:g.2088231G>A | XP_027825015.1:c.673G>A | XP_027825015.1:p.(V225M) | Published as g.1862883G>A / (V15M), previously listed in OMIA as XM_012156230:c.805G>A, XP_012011620:p.Val269Met based on Joller et al., 2017; coordinates in this table updated to a recent reference genome [10/06/2025] | 2015 | 25354687 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 537 | OMIA:001140-9615 | dog | Nova Scotia Duck Tolling Retriever (Dog) | Cleft lip with or without cleft palate | ADAMTS20 | deletion, small (<=20) | frameshift | Naturally occurring variant | P | CanFam3.1 | 27 | NC_006609.3:g.10553479_10553480del | XM_022410988.1:c.1358_1359del | XP_022266696.1:p.(K453Ifs*4) | published as c.1360_1361delAA and p.(K453Ifs*3); coordinates in the table have been updated to a recent reference genome and / or transcript and HGVS nomenclature | 2015 | 25798845 | Genomic position in CanFam3.1 provided by Mateo Etcheveste and Robert Kuhn. | ||
| 1163 | OMIA:001562-9913 | taurine cattle | Cikasto govedo, Slovenia (Cattle) | Pulmonary hypoplasia and anasarca syndrome | ADAMTS3 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 6 | NC_037333.1:g.87462016G>A | NM_001192797.1:c.1222C>T | NP_001179726.1:p.(H408T) | NM_001192797.1: c.1222C>T; NP_001179726.1: p.(His408Tyr) (Häfliger et al., 2020) | rs5334475098 | 2020 | 32069517 | ||
| 1084 | OMIA:001893-9615 | dog | Norwich Terrier (Dog) | Upper airway syndrome | ADAMTS3 | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 13 | g.61287796G>A | c.2786G>A | p.(R929H) | 2019 | 31095560 | ||||||
| 1750 | OMIA:001562-9940 | sheep | Persian (Sheep) | Pulmonary hypoplasia with anasarca | ADAMTS3 | deletion, small (<=20) | splicing | Naturally occurring variant | Not currently evaluated | Oarv3.1 | 6 | NC_019463.1:g.87124344del | XM_012180125.1:c.2055+3del | XP_012035515.1:p.(V680_V685del) | the variant results in the activation of a cryptic splice site within exon 14 | 2024 | 39409761 | |||
| 60 | OMIA:001509-9615 | dog | Beagle (Dog) | Musladin-Lueke syndrome | ADAMTSL2 | substitution | missense | Naturally occurring variant | LP/P | CanFam3.1 | 9 | NC_006591.3:g.49931561C>T | XM_014116955.2:c.661C>T | XP_013972430.1:p.(R221C) | 2010 | 20862248 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 935 | OMIA:001511-9913 | taurine cattle | Angus (Cattle) | Contractual arachnodactyly (Fawn calf syndrome) | ADAMTSL3 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 21 | "a large (~58 kilobase pair) deletion affecting the ADAMTSL3 gene" | 2014 | Reference not in PubMed; see OMIA 001511-9913 for reference details | ||||||||
| 1435 | OMIA:002535-9913 | taurine cattle | Original Swiss Brown (Cattle) | Congenital cataract | ADAMTSL4 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 3 | NC_037330.1:g.20146737C>T | NM_001101061.1:c.2327G>A | NP_001094531.1:p.(R776H) | NM_001101061.1; NP_001094531.1 | rs5353205567 | 2022 | 35233794 | ||
| 466 | OMIA:001577-9615 | dog | Curly Coated Retriever (Dog) | Glycogen storage disease IIIa | AGL | deletion, small (<=20) | frameshift | Naturally occurring variant | P | CanFam3.1 | 6 | NC_006588.3:g.50050457del | NM_001048096.1:c.4223del | NP_001041561.1:p.(K1408Sfs*6) | published as c.4223delA; genomic position adjusted to HGVS 3' rule | 2007 | 17338148 | Genomic and protein coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 934 | OMIA:002135-9913 | taurine cattle | Angus (Cattle) | Arthrogryposis multiplex congenita, AGRN-related | AGRN | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 16 | A 23,363 bp deletion "encompasses the entirety of the ISG15 ubiquitin-like modifier (ISG15) gene . . . one or both of the 5' regulatory region of the hairy and enhancer split 4 (HES4) and of the agrin (AGRN) gene and of the first two exons of the AGRN gene" (Beever and Marron, 2011) | 2011 | Reference not in PubMed; see OMIA 002135-9913 for reference details | ||||||||
| 233 | OMIA:000662-9940 | sheep | Romney Marsh (Sheep) | Motor neuron disease, lower | AGTPBP1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 2 | NC_040253.1:g.35795594G>C | XM_015093043.2:c.2909G>C | XP_014948529.2:p.(R970P) | protein and cDNA positions are based on XP_014948529.2 and XM_015093043.2, respectively | 2012 | 22588130 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 75 | OMIA:001672-9615 | dog | Coton de Tulear (Dog) | Primary hyperoxaluria type I (Oxalosis I) | AGXT | substitution | missense | Naturally occurring variant | P | CanFam3.1 | 25 | NC_006607.3:g.50968854G>A | XM_003639891.4:c.304G>A | XP_003639939.1:p.(G102S) | rs397510072 | 2012 | 22486513 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1252 | OMIA:001672-9940 | sheep | Zwartbles (Sheep) | Type 1 Primary Hyperoxaluria | AGXT | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 1 | NC_040252.1:g.801189C>T | XM_027966918.1:c.584G>A | XP_027822719.1:p.(C195Y) | NC_040252.1: g.801189C>T; XM_027966918.1: c.584G>A; XP_027822719.1: p.Cys195Tyr (Letko et al., 2020) | 2020 | 33003365 | |||
| 1214 | OMIA:001222-9685 | domestic cat | Persian (Cat) | Leber congenital amaurosis | AIPL1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | E1 | NC_058381.1:g.940554C>T | XM_045044616.1:c.577C>T | XP_044900551.1:p.(R193*) | 2016 | 27030474 | The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 1629 | OMIA:002788-9913 | taurine cattle | Holstein Friesian (Cattle) | Subfertility, AK9-related | AK9 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 9 | g.40620329A>G | rs457222030 | 2021 | 34028060 | |||||
| 1094 | OMIA:002205-9615 | dog | Collie Rough (Dog) | Recurrent inflammatory pulmonary disease | AKNA | deletion, small (<=20) | frameshift | Naturally occurring variant | P | CanFam3.1 | 11 | NC_006593.3:g.68576241_68576244del | XM_014117950.2:c.2717_2720delACAG | XP_013973425.1:p.(D906Afs*173) | 2019 | 31357536 | ||||
| 1801 | OMIA:002956-176072 | dusky lory | Feather colour, red | ALDH3A2 | substitution | regulatory | Naturally occurring variant | Not currently evaluated | scaffold_13:6288712T>C | 2024 | 39480920 | |||||||||
| 1240 | OMIA:002250-9615 | dog | Saluki (Dog) | Succinic Semialdehyde Dehydrogenase Deficiency | ALDH5A1 | substitution | missense | Naturally occurring variant | P | CanFam3.1 | 35 | NC_006617.3:g.22572768G>A | XM_014110599.2:c.866G>A | XP_013966074.2:p.(G288D) | XM_014110599.2: c.866G>A; XP_013966074.2: p.(Gly288Asp) (Vernau et al., 2020) | 2020 | 32887425 | |||
| 1292 | OMIA:002316-9685 | domestic cat | American Shorthair (Cat) British Longhair (Cat) British Shorthair (Cat) Devon Rex (Cat) Exotic Shorthair (Cat) Maine Coon (Cat) Munchkin (Cat) Ragdoll (Cat) Scottish Fold (Cat) Sphynx (Cat) | Cardiomyopathy, hypertrophic | ALMS1 | substitution | missense | Naturally occurring variant | VUS | F.catus_Fca126_mat1.0 | A3 | NC_058370.1:g.89899157G>C | XM_045054402.1:c.11647G>C | XP_044910337.1:p.(G3883R) | cDNA and protein positions have been predicted using Ensemble VEP based on transcript ENSFCAT00000077013.1; variant initially reported in Sphynx cats and in a later study (Akiyama et al., 2023) identified in other breeds. Turba et al., 2023 report additional variants in the vicinity that can result in allele dropout in DNA tests and indicate "the need to verify the correspondence between the [Felis_catus_9.0:}g.92439157 C variant frequency and the prevalence of HCM" due to high allele frequency of the variant in Sphynx cats in their study. Seo et al. (2024) also identified this variant frequently in Sphynx cats but reported that the variant "was not associated with the HCM diagnosis in the studied population." Additional breeds in which the variant has been reported are based on PMID:38371598. c. coordinates were previouly listed in OMIA based on transcript ENSFCAT00000077013.1:c.7384G>C / p.(G2462R). |
rs5334475133 | 2021 | 33639992 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 1834 | OMIA:003011-9615 | dog | Chihuahua (Dog) | ichthyosis, ALOXE3-related | ALOXE3 | substitution | missense | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 5 | NC_049226.1:g.33136922C>T | XM_038536792.1:c.1379G>A | XP_038392720.1:p.(G460D) | 2025 | 41057024 | ||||
| 1021 | OMIA:002162-9615 | dog | Karelian Bear Dog (Dog) | Hypophosphatasia | ALPL | substitution | missense | Naturally occurring variant | P | CanFam3.1 | 2 | NC_006584.3:g.77561953A>C | XM_005617214.3:c.1301T>G | XP_005617271.1:p.(V434G) | XM_005617214.3; XP_005617271.1 | 2019 | 30700765 | |||
| 1486 | OMIA:002162-9940 | sheep | Hypophosphatasia | ALPL | substitution | missense | Genome-editing (CRISPR-Cas9) | Not currently evaluated | Oar_rambouillet_v1.0 | 2 | NC_040253.1:g.260716094G>C | XM_027965561.1:c.1077C>G | XP_027821362.1:p.(I359M) | XM_027965561.1; XP_027821362.1 | 2018 | 30446691 | ||||
| 1828 | OMIA:001492-9940 | sheep | Merino (Sheep) | Axonopathy, segmental | ALS2 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v2.0 | 2 | NC_056055.1:g.204020069-204020070del | NC_056055.1:g.204020069-204020070del | XP_011998058.1:p.(L1380Gfs*17) | 2025 | 41131452 | ||||
| 550 | OMIA:002717-9685 | domestic cat | Burmese (Cat) | Brachycephaly | ALX1 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | B4 | NC_058374.1:g.107855022_107855033del | XM_003989090.5:c.497_508del | XP_003989139.1:p.(A166_T169del) | published as c.496delCTCTCAGGACTG | 2016 | 26610632 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 764 | OMIA:001009-9913 | taurine cattle | Shorthorn (Cattle) | Tibial hemimelia | ALX4 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 15 | Deletion of 45,694 bp including exon 1 of ALX4 | 2012 | Reference not in PubMed; see OMIA 001009-9913 for reference details | ||||||||
| 763 | OMIA:001009-9913 | taurine cattle | Galloway (Cattle) | Tibial hemimelia | ALX4 | ALX4dup-GAU / ALX4dup-LfL | duplication | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 15 | NC_037342.1:g.74384919_74384938dup | NM_001030304.1:c.713_732dup | NP_001025475.1:p.(Q245fs) | Initially reported as g.75154399_75154418dup in UMD3.1 and g.74384916_74384935dup in ARS-UCD1.2.. Updated to current coordinates after publication of a correction by the authors (PMID: 39298916) [23/09/2024]. The variant is now identical to a variant reported by Buitkamp et al. (2023, PMID:36585373), which was previously listed as omia.variant:1516. Both variants are now merged into one entry and omia.variant:1516 is redundant. | 2015 | 26076463 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. The same ARS-UCD1.2 location in the reverse order was included in the paper by Buitkamp et al. (2022). The allele name ALX4dup-GAU was also given by Buitkamp et al. (2022). | |
| 1129 | OMIA:001868-9615 | dog | Siberian Husky (Dog) | Blue eyes | ALX4 | duplication | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 18 | g.44791414_44890185dup | Deane-Coe et al. (2018): "a 98.6-kb duplication directly upstream of the Homeobox gene ALX4" | 2018 | 30286082 | g. coordinates kindly provided by Anna Letko and Cord Drögemüller (7th Oct 2019) | |||||
| 280 | OMIA:002775-9615 | dog | Miniature Schnauzer (Dog) | Persistent Mullerian duct syndrome | AMHR2 | substitution | nonsense (stop-gain) | Naturally occurring variant | P | CanFam3.1 | 27 | NC_006609.3:g.1794738G>A | XM_543632.6:c.262C>T | XP_543632.4:p.(R88*) | XM_543632.6; XP_543632.4; published as c.241C>T; coordinates in the table have been updated to a recent reference genome and / or transcript | 2009 | 18723470 | |||
| 639 | OMIA:000565-9615 | dog | Giant Schnauzer (Dog) | Intestinal cobalamin malabsorption, AMN-related | AMN | deletion, gross (>20) | deletion (in-frame) | Naturally occurring variant | P | CanFam3.1 | 8 | NC_006590.3:g.70807271_70807303del | NM_001002960.1:c.1113_1145del | NP_001002960.1:p.(G372_A382del) | 2005 | 15845892 | Genomic position in CanFam3.1 provided by Robert Kuhn and Mateo Etcheveste. | |||
| 426 | OMIA:000565-9615 | dog | Australian Shepherd (Dog) | Intestinal cobalamin malabsorption, AMN-related | AMN | substitution | start-lost | Naturally occurring variant | P | ROS_Cfam_1.0 | 8 | NC_051812.1:g.71077084G>A | NM_001002960.1:c.3G>A | NP_001002960.1:p.(M1?) | NM_001002960.1; NP_001002960.1 | 2005 | 15845892 | |||
| 1677 | OMIA:002838-9615 | dog | Cirneco dell'Etna (Dog) | Cirneco oculo-neurological syndrome | AMPD2 | CONS | deletion, small (<=20) | frameshift | Naturally occurring variant | P | UU_Cfam_GSD_1.0 | 6 | NC_049227.1:g.42698170del | XM_038541065.1:c.2131del | XP_038396993.1:p.(D711Mfs12*) | 2024 | 38397227 | |||
| 353 | OMIA:002539-9615 | dog | Dalmatian (Dog) | Respiratory distress syndrome | ANLN | substitution | nonsense (stop-gain) | Naturally occurring variant | P | CanFam3.1 | 14 | NC_006596.3:g.47812143C>T | XM_005628719.3:c.31C>T | XP_005628776.1:p.(R11*) | 2017 | 28222102 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 422 | OMIA:001353-9615 | dog | American Staffordshire Terrier (Dog) Australian Cattle Dog (Dog) Beagle (Dog) Belgian Shepherd Dog, Malinois (Dog) Chinese Crested (Dog) German Shepherd Dog (Dog) Great Pyrenees (Dog) Labrador Retriever (Dog) Perro de Presa Canario (Dog) Siberian Husky (Dog) | Platelet receptor for factor X, deficiency of | ANO6 | substitution | splicing | Naturally occurring variant | P | CanFam3.1 | 27 | NC_006609.3:g.8912219C>T | XM_005636953.1:c.1934+1G>A | Initially reported in German Shepherds - additional breeds based on PMID: 36848397. | 2015 | 26414452 | Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool | |||
| 927 | OMIA:002083-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Abortion (embryonic lethality), ANXA10-related | ANXA10 | repeat variation | Naturally occurring variant | Not currently evaluated | 8 | "a "34-kb deleted-type" CNV "associated with embryonic mortality at 30-60 days after artificial insemination. The CNV harbors exon 2 to 6 of ANNEXIN A10 (ANXA10). . . . Western blot analysis showed that the CNV results in a null allele of ANXA10." | 2016 | 27881083 | ||||||||
| 580 | OMIA:000248-9615 | dog | Collie (Dog) | Neutropenia, cyclic | AP3B1 | insertion, small (<=20) | frameshift | Naturally occurring variant | P | CanFam3.1 | 3 | NC_006585.3:g.28663129_28663130insA | NM_001002974.2:c.2407_2408insA | NP_001002974.1:p.(T803Nfs*5) | rs1152388405 | 2003 | 12897784 | |||
| 286 | OMIA:000001-9913 | taurine cattle | Blanco Orejinegro, Colombia (Cattle) Holstein Friesian (Cattle) | Abortion due to a nonsense mutation in APAF1 on haplotype HH1 | APAF1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | g.62810245C>T | XM_015471110.2:c.1735C>T | XP_015326596.1:p.(Q579*) | Variant initially reported in Holstein Friesian cattle and later reported in additional breeds: PMID:34779908. Previously listed in OMIA as: p.(Q581*), c.1741C>T, updated to recent transcript information [03/09/2024] | rs448942533 | 2016 | 27289157 | Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | |
| 1206 | OMIA:001916-9615 | dog | Jack Russell Terrier (Dog) | Familial Adenomatous Polyposis | APC | delins, small (<=20) | Naturally occurring variant | P | CanFam3.1 | 3 | NC_006585.3:g.312131_312132delinsAA | XM_014111995.2:c.[462_463delinsTT] | XP_013967470.1:p.(K155*) | 2020 | 32445578 | Reference assembly and genomic location kindly provided by Kyoko Yoshizaki, 17 Dec 2020 | ||||
| 1897 | OMIA:001916-9796 | domestic horse | Pony (Horse) | Familial adenomatous polyposis | APC | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 14 | NC_009157.3:g.58546516dup | NM_001301314.1:c.4656dup | NP_001288243.1:p.(E1553Rfs*9) | Published as g.58546511C>CT; p.(E1527Rfs*9); c.4578dup - coordinates in this table presented based on HGVS 3' rule and NCBI reference transcript. | 2026 | 42038751 | |||
| 731 | OMIA:001965-9913 | taurine cattle | Holstein Friesian (Cattle) Simmental (Cattle) Swiss Fleckvieh (Cattle) | Holstein cholesterol deficiency | APOB | insertion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | 11 | "1.3kb insertion of a transposable LTR element (ERV2-1) in the coding sequence of the APOB gene, which leads to truncated transcripts and aberrant splicing [p.Gly135ValfsX10)]" | 2016 | 26763170 | Additional breed inforamtion based on PMID: 40312951 | ||||||
| 436 | OMIA:000991-9796 | domestic horse | Quarter Horse (Horse) | Androgen insensitivity syndrome (AIS) | AR | substitution | regulatory | Naturally occurring variant | LP/P | EquCab3.0 | X | NC_009175.3:g.52728703A>G | NM_001163891.1:c.1A>G | mutation in start codon for NP_001157363.1; | 2012 | 22095250 | The genomic position in EquCab3.0 was provided by Ceara Mulvey, working under the guidance of Professor Ernie Bailey in April 2022 | |||
| 1143 | OMIA:000991-9796 | domestic horse | Tennessee Walking Horse (Horse) | Androgen insensitivity syndrome (AIS) | AR | deletion, small (<=20) | frameshift | Naturally occurring variant | LP/P | EquCab3.0 | X | NC_009175.3:g.52728885del | NM_001163891.1:c.183del | NP_001157363.1:p.(R63Gfs) | published as c.183delT and p.(Ser61fs); c. and p. information in the table has been updated to HGVS nomenclature | 2020 | 31936796 | The genomic position in EquCab3.0 was provided by Ceara Mulvey, working under the guidance of Professor Ernie Bailey in April 2022 | ||
| 783 | OMIA:000991-9796 | domestic horse | Warmblood (Horse) | Androgen insensitivity syndrome | AR | deletion, gross (>20) | frameshift | Naturally occurring variant | P | EquCab3.0 | X | NC_009175.3:g.52808634_52808658del | NM_001163891.1:c.1630_1654del | the deletion is predicted to create a frameshift: "resulting in altered amino acid composition from p.543Lys and a premature stop codon 44 amino acid residues downstream in exon 3 | 2017 | 28192783 | ||||
| 786 | OMIA:000991-9796 | domestic horse | Thoroughbred (Horse) | Androgen insensitivity syndrome | AR | substitution | missense | Naturally occurring variant | P | EquCab3.0 | X | NC_009175.3:g.52872393G>C | NM_001163891.1:c.2042G>C | NP_001157363.1:p.(W681S) | 2016 | 27073903 | The genomic position in EquCab3.0 was provided by Ceara Mulvey, working under the guidance of Professor Ernie Bailey in April 2022; p. coordinates obtained from Villagomez et al. (2019) | |||
| 1144 | OMIA:000991-9796 | domestic horse | Thoroughbred (Horse) | Androgen insensitivity syndrome (AIS) | AR | substitution | missense | Naturally occurring variant | LP | EquCab3.0 | X | NC_009175.3:g.52878093C>T | NM_001163891.1:c.2132C>T | NP_001157363.1:p.(A711V) | 2020 | 31936796 | ||||
| 1895 | OMIA:000991-9796 | domestic horse | Thoroughbred (Horse) | Androgen insensitivity syndrome | AR | substitution | splicing | Naturally occurring variant | Not currently evaluated | TB-T2T | X | NC_091715.1:64377280T>C | NM_001163891.1:c.2204+2T>C | 2026 | 42036781 | |||||
| 1752 | OMIA:001201-9685 | domestic cat | Orange coat colour | ARHGAP36 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | Felis_catus_9.0 | X | NC_018741.3:g.110432079_110437152del | Published by Toh et al. (2024) as g.109186183_109191258del based on the AnAms1.0 reference genome (Matsumoto et al., 2024). This deletion is located within the first intron of ARHGAP36 (Toh et al., 2024). Coordinates in this table are based on a reference genome avialable in the NCBI genome data viewer. The cat sequenced for F.catus_Fca126_mat1.0 is orange - the coordinates for the breakpoints are NC_058386.1:107721951_107721952. | 2024 | 39605675 | |||||||
| 960 | OMIA:001917-9615 | dog | Leonberger (Dog) Saint Bernard (Dog) | Polyneuropathy, ARHGEF10-related | ARHGEF10 | deletion, small (<=20) | splicing | Naturally occurring variant | LP/P | CanFam3.1 | 16 | NC_006598.3:g.54349199_54349208del | XM_005630036.3:c.1955_1958+6del | published as c.1955_1958+6delCACGGTGAGC - eliminating the 3'-splice junction of exon 17 and creating an alternate splice site leading to a truncated protein | 2014 | 25275565 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn | |||
| 780 | OMIA:001334-9913 | taurine cattle | Swedish Red (Cattle) | Sperm, short tail | ARMC3 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 13 | g.24024660del | c.1442del | p.(A451fs*26) | rs797454424 | 2016 | 26923438 | Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | ||
| 56 | OMIA:000666-9615 | dog | Miniature Schnauzer (Dog) | Mucopolysaccharidosis VI | ARSB | deletion, gross (>20) | Naturally occurring variant | P | CanFam3.1 | 3 | NC_006585.3:g.27870127_27870182del | NM_001048133.1:c.-24_32del | 2020 | 32985704 | g. coordinate kindly provided by Karthik Raj 29 Oct 2020 | |||||
| 640 | OMIA:000666-9615 | dog | Poodle, Miniature (Dog) | Mucopolysaccharidosis VI | ARSB | deletion, gross (>20) | frameshift | Naturally occurring variant | P | CanFam3.1 | 3 | NC_006585.3:g.27870253_27870274del | NM_001048133.1:c.103_124del | NP_001041598.1:p.(A35Gfs*108) | 2012 | 22329490 | Variant information initially provided by Karthik Raj and Urs Giger | |||
| 859 | OMIA:000666-9615 | dog | Great Dane (Dog) | Mucopolysaccharidosis VI | ARSB | substitution | nonsense (stop-gain) | Naturally occurring variant | P | CanFam3.1 | 3 | NC_006585.3:g.27870445C>T | NM_001048133.1:c.295C>T | NP_001041598.1:p.(Q99*) | NM_001048133.1; NP_001041598.1 | 2018 | 29157190 | Variant information initially provided by Karthik Raj and Urs Giger, and confirmed by Ensembl's VEP | ||
| 1258 | OMIA:000666-9615 | dog | Miniature Pinscher (Dog) | Mucopolysaccharidosis VI | ARSB | substitution | missense | Naturally occurring variant | LP/P | CanFam3.1 | 3 | NC_006585.3:g.27950471G>A | NM_001048133.1:c.910G>A | NP_001041598.1:p.(G304R) | NM_001048133.1; NP_001041598.1 | 2020 | 32985704 | g. coordinate kindly provided by Karthik Raj 29 Oct 2020 | ||
| 1320 | OMIA:000666-9685 | domestic cat | Siamese (Cat) | Mucopolysaccharidosis VI, mild, in L476P/D520N cats | ARSB | substitution | missense | Naturally occurring variant | VUS | F.catus_Fca126_mat1.0 | A1 | NC_058368.1:g.142610129C>T | NM_001142259.1:c.1558G>A | NP_001135731.1:p.(D520N) | D520N/D520N and L476P/D520N cats have normal growth and appearance. L476P/D520N cats have a very mild MPS VI phenotype (increased incidence of degenerative joint disease). | 1998 | 9421472 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 132 | OMIA:000666-9685 | domestic cat | Domestic Shorthair (Cat) Siamese (Cat) | Mucopolysaccharidosis VI | ARSB | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A1 | NC_058368.1:g.142610260A>G | NM_001142259.1:c.1427T>C | NP_001135731.1:p.(L476P) | rs5334475159 | 1996 | 8910299 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 67 | OMIA:001503-9615 | dog | American Staffordshire Terrier (Dog) | Lysosomal storage disease (previously called Neuronal ceroid lipofuscinosis, 4A) | ARSG | substitution | missense | Naturally occurring variant | P | CanFam3.1 | 9 | NC_006591.3:g.15071276G>A | XM_005624176.3:c.296G>A | XP_005624233.1:p.(R99H) | 2010 | 20679209 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 665 | OMIA:000201-10042 | North American deer mouse | New Hampshire (Chicken) | Melanic (non-agouti) | ASIP | deletion, gross (>20) | regulatory | Naturally occurring variant | Not currently evaluated | "a 125-kb deletion, which includes the upstream regulatory region and exons 1 and 2 of Agouti, results in a loss of Agouti expression" | 2009 | 19649329 | ||||||||
| 712 | OMIA:000201-9913 | taurine cattle | Normande (Cattle) | Brindle | ASIP | Abr | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 13 | "insertion of a full-length Bos taurus LINE element" | 2006 | 16827753 | |||||||
| 1075 | OMIA:001602-93934 | Japanese quail | Feather colour, fawn-2/beige | ASIP | Y^f2 | duplication | Naturally occurring variant | Not currently evaluated | 20 | Robic et al. (2019) concluded "that fawn-2 and beige are the same allele, and that it is caused by a 70,895-bp tandem duplication . . . [with breakpoints] (NC-029535 [1,371,395(or 98)–1,442,295 (or 98)]) . . . located downstream of the ITCH exon 1 and upstream of the ASIP exon e4 (5′ UTR). . . . The 70,895 bp of the duplicated region include the entire AHCY gene on one strand, and parts of the ASIP and ITCH genes on the other strand." | 2019 | 30987584 | ||||||||
| 1199 | OMIA:000201-9925 | goat | Peacock Goat (Goat) Valais Grüenochte | Peacock | ASIP | A^pc | repeat variation | Naturally occurring variant | Not currently evaluated | 13 | "The ASIP allele in Peacock goats, which we propose to term “peacock” (A^pc), has a quadruplication of the same ~45 kb region having five copies in the A^b allele. It is additionally flanked by triplicated segments of 27,996 bp and 41,807 bp on the left and right side of the quadruplicated sequence (Fig 3, S4 Fig, S5 Table). The central part of the A^pc allele has exactly the same breakpoints as the A^b allele suggesting a common origin of A^b and A^pc." (Henkel et al., 2019) "63'158'171-63'203'851: 4 copies (corresponds to the CNV in the Ab allele)" (Table S5; Henkel et al., 2019) 200922: Marius picked this g. entry up as requiring attention: "g.63130175_63245658 (3 copies)". Because this will take time to sort out, I have removed it from the g. field for the time being. | 2019 | 31841508 | |||||||
| 1200 | OMIA:000201-9925 | goat | Bezoar (Goat) Valais Blackneck (Goat) Valais Copperneck | Wild type or Bezaur | ASIP | A^bz | reference sequence allele | Naturally occurring variant | Not currently evaluated | 13 | "The goat genome reference sequence is derived from a San Clemente goat, which has a similar coat color pattern as bezoars. The genome reference therefore supposedly represents the wildtype allele at the ASIP locus, termed “bezoar” (Abz) [8]. Bezoars and all other Swiss goat breeds did not show any CNVs at the ASIP locus." (Henkel et al., 2019) | 2019 | 31841508 | |||||||
| 1321 | OMIA:002200-9915 | indicine cattle (zebu) | Brahman (Cattle) Nellore, India (Sheep) | Darkness of hair coat | ASIP | delins, gross (>20) | Naturally occurring variant | Not currently evaluated | 13 | 1155-bp deletion followed by an insertion of a transposable element of more than 150 bp that may impact the recruitment of ASIP non-coding exons (Trigo et al.2021) | 2021 | 33910501 | ||||||||
| 251 | OMIA:000201-61386 | Kodkod | Melanism (black coat) | ASIP | substitution | missense | Naturally occurring variant | Not currently evaluated | p.(C126Y) | 2015 | 25695801 | |||||||||
| 252 | OMIA:000201-3055696 | Colocolo | Melanism (black coat) | ASIP | substitution | missense | Naturally occurring variant | Not currently evaluated | p.(R120C) | 2015 | 25695801 | |||||||||
| 1119 | OMIA:000201-10141 | domestic guinea pig | Recessive black | Asip | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | c.181_184delTTCA | MH026115: c.181_184delTTCA; the deletion leads to a truncated protein of 77 amino acids due to the premature stop codon. | 2019 | 30746725 | ||||||||
| 330 | OMIA:000201-10042 | North American deer mouse | Alaska, United States of America (North American deer mouse) | Melanic (non-agouti) | ASIP | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.193?>? | p.(Q65*) | 2009 | 19649329 | |||||||
| 333 | OMIA:000201-9691 | leopard | Coat colour, black (black panther) | ASIP | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.333C>A | p.(C111*) | 2012 | 23251368 | ||||||||
| 1219 | OMIA:000201-9858 | Western roe deer | Melanistic (black) | ASIP | substitution | missense | Naturally occurring variant | Not currently evaluated | c.33G>T | p.(L11F) | 2020 | 32545389 | ||||||||
| 1587 | OMIA:000201-9691 | leopard | Coat colour, black (black panther) | ASIP | substitution | missense | Naturally occurring variant | Not currently evaluated | c.353C>A | p.(C113F) | 2023 | 37440497 | ||||||||
| 1666 | OMIA:000201-10007 | tassel-eared squirrel | Coat colour, black | ASIP | substitution | missense | Naturally occurring variant | Not currently evaluated | c.370T>C | p.(C124R) | 2024 | 38396615 | ||||||||
| 504 | OMIA:001602-93934 | Japanese quail | Feather colour, recessive black | ASIP | rb | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | 20 | c.373_380del | "A deletion of 8 bases was found in the ASIP gene" | 2008 | 18287406 | ||||||
| 253 | OMIA:000201-61455 | Asiatic golden cat | Black | ASIP | substitution | missense | Naturally occurring variant | Not currently evaluated | c.384C>G | p.(C128W) | 2012 | 23251368 | ||||||||
| 1010 | OMIA:000201-9838 | Arabian camel | Black and dark-brown coat colour | ASIP | haplotype | Naturally occurring variant | Not currently evaluated | c.[23delT;c.25G>A] | KU179868; c.[23delT;c.25G>A]. As described by Almathen et al. (2018), this haplotype comprises "a 1-bp deletion (23delT/T) and a SNP (25G/A) in exon 2 of ASIP". | 2018 | 29893870 | |||||||||
| 654 | OMIA:001602-93934 | Japanese quail | Feather colour, lethal yellow | ASIP | Y | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 20 | g.1463709_1604872del | Nadeau et al. (2008): "a >90-kb [141162bp] deletion upstream of ASIP" | 2008 | 18287407 | The g. coordinates were provided by Robic et al. (2019) | ||||||
| 1196 | OMIA:000201-9925 | goat | Appenzell (Goat) Girgentana, Italy (Goat) Saanen (Goat) | White or tan | ASIP | A^Wt | repeat variation | Naturally occurring variant | Not currently evaluated | ARS1.2 | 13 | "CNV [copy number variation] affecting a region of less that 100 kb including the ASIP and AHCY genes" (Fontanesi et al., 2009)."spans 154,677 bp ofthe reference genome sequence and comprises the entire coding sequence ofthe ASIP, AHCYand ITCH genes. The individual copies are arranged in tandem in a head to tail orientation." (Henkel et al., 2019) 200922: moved the g. entry to here (g.63,226,824-63,381,501 (3 copies)) until it can be standardised | 2009 | 20016133 | ||||||
| 1197 | OMIA:000201-9925 | goat | Grisons Striped (Goat) Toggenburg (Goat) | Swiss markings | ASIP | A^sm | repeat variation | Naturally occurring variant | Not currently evaluated | ARS1.2 | 13 | "8 tandem copies of a 13,433 bp sequence from the 5’-flanking region of ASIP" (Henkel et al., 2019) 200922: moved g. entry to here (g.63,129,198-63,142,631 (8 copies)) until it can be fixed | 2019 | 31841508 | ||||||
| 1198 | OMIA:000201-9925 | goat | Chamois Coloured (Goat) St Gallen Booted Goat (Goat) | Badgerface | ASIP | A^b | repeat variation | Naturally occurring variant | Not currently evaluated | ARS1.2 | 13 | "a five-fold amplification of45,680 bp located ~61 kb downstream ofthe Asm amplification" (Henkel et al., 2019) 200922: move the g. entry to here (g.63,158,171-63,203,851 (5 copies)), until it can be fixed | 2019 | 31841508 | ||||||
| 149 | OMIA:000201-9793 | ass (donkey) | Âne de Provence, France (Ass) Âne normand, France (Ass) Dezhou, China (Ass) Miniature, United States of America (Ass) | No light points | ASIP | NLP | substitution | missense | Naturally occurring variant | Not currently evaluated | ASM1607732v2 | 15 | NC_052191.1:g.25406489T>C | XM_044748287.1:c.349T>C | XP_044604222.1:p.(C117R) | The Dezhou reference genome ASM1607732v2 represents the 'no light points' variant: NC_052191.1:g.25406489C |
2015 | 25887951 | ||
| 1382 | OMIA:000201-9615 | dog | Dominant yellow | ASIP | DY | reference sequence allele | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 24 | CanFam3.1 | The reference sequence CanFam3.1 represents the dominant yellow phenotype. | 2021 | 34385618 | ||||||
| 1386 | OMIA:000201-9615 | dog | Black saddle | ASIP | BS | delins, gross (>20) | regulatory | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 24 | g.23378062_23379640delins[MT319116.1:424_663] | Likely causal regulatory promoter variant | 2021 | 34385618 | |||||
| 1385 | OMIA:000201-9615 | dog | Black back 3 | ASIP | BB3 | haplotype | regulatory | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 24 | g.[23353288_23353472del;23354716_23354751A[4];23377890_23378086del;23378320_23378343del;g.23378858_2 | Haplotype containing a likely causal regulatory promoter variant | 2021 | 34385618 | |||||
| 1380 | OMIA:000201-9615 | dog | Agouti | ASIP | AG | haplotype | regulatory | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 24 | g.[23353288_23353472del;23354716_23354751A[4];23377890_23378086del;23378320_23378343del] | Haplotype containing a likely causal regulatory promoter variant | 2021 | 34385618 | |||||
| 1383 | OMIA:000201-9615 | dog | Black back 1 | ASIP | BB1 | haplotype | regulatory | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 24 | g.[23353288_23353472del;23354716_23354751A[4];23378062_23378231delins[MT319115.1:424_674] | Haplotype containing a likely causal regulatory promoter variant | 2021 | 34385618 | |||||
| 1384 | OMIA:000201-9615 | dog | Black back 2 | ASIP | BB2 | haplotype | regulatory | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 24 | g.[23353288_23353472del;23354716_23354751A[4];23378062_23379640delins[MT319116.1:424_663]] | Haplotype containing a likely causal regulatory promoter variant | 2021 | 34385618 | |||||
| 1381 | OMIA:000201-9615 | dog | Shaded yellow | ASIP | SY | haplotype | regulatory | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 24 | g.[23353288_23353472del;23354716_23354751A[4]] | Haplotype containing a likely causal regulatory promoter variant | 2021 | 34385618 | |||||
| 30 | OMIA:000201-9615 | dog | German Shepherd Dog (Dog) Huntaway (Dog) | Recessive black | ASIP | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 24 | NC_006606.3:g.23393552C>T | NM_001007263.1:c.286C>T | NP_001007264.1:p.(R96C) | Additional breeds based on PMID:40965331 | rs851336386 | 2004 | 15520882 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 1847 | OMIA:000201-9279 | southeastern quoll | Coat colour, melanistic | ASIP | deletion, gross (>20) | start-lost | Naturally occurring variant | Not currently evaluated | DasViv_v1.0 | 2 | 4.7 kb deletion encompassing the first two coding exons | 2025 | 41119986 | |||||||
| 509 | OMIA:000201-9796 | domestic horse | American Trotter (Horse) Arab (Horse) Belgian Draft (Horse) Clydesdale (Horse) Freiberger (Horse) Icelandic Horse (Horse) Morgan (Horse) Quarter Horse (Horse) Shetland Pony (Horse) Thoroughbred (Horse) Warmblood (Horse) Welsh Pony (Horse) | Coat colour, recessive black | ASIP | a | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 22 | NC_009165.3:g.26067463_26067473del | NM_001164017.1:c.187_197del | published as g.2174_2184del and c.191_201del - coordinates in the table updated to a recent reference genome. | rs3091770233 | 2001 | 11353392 | Coordinates in EquCab3.0 kindly provided by Haley Rutstein, working under the guidance of Professor Ernie Bailey. Breed information based on PMID: 38600096 | ||
| 1453 | OMIA:002549-9685 | domestic cat | Bengal (Cat) | Coat colour and pattern, charcoal | ASIP | A^Pben | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A3 | NC_058370.1:g.24826914T>C | NM_001009190.1:c.302A>G | NP_001009190.1:p.(D101G) | variant contributes to A^Pbe haplotype associated with charcoal colour/pattern | 2014 | 25143047 | ||
| 1452 | OMIA:002549-9685 | domestic cat | Bengal (Cat) | Coat colour and pattern, charcoal | ASIP | A^Pben | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A3 | NC_058370.1:g.24826965T>C | NM_001009190.1:c.251A>G | NP_001009190.1:p.(Q84R) | variant contributes to A^Pbe haplotype associated with charcoal colour/pattern | 2014 | 25143047 | ||
| 1450 | OMIA:002549-9685 | domestic cat | Bengal (Cat) | Coat colour and pattern, charcoal | ASIP | A^Pben | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A3 | NC_058370.1:g.24831065A>G | NM_001009190.1:c.142T>C | NP_001009190.1:p.(S48P) | variant contributes to A^Pbe haplotype associated with charcoal colour/pattern | 2014 | 25143047 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 493 | OMIA:000201-9685 | domestic cat | Coat colour, non-agouti (black) | ASIP | a | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A3 | NC_058370.1:g.24831083_24831084del | NM_001009190.1:c.123_124del | NP_001009190.1:p.(M42Efs*59) | rs5334475125 | 2003 | 12620197 | The genomic location on Felis_catus_9.0 is based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1451 | OMIA:002549-9685 | domestic cat | Bengal (Cat) | Coat colour and pattern, charcoal | ASIP | A^Pben | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A3 | NC_058370.1:g.24831166C>G | NM_001009190.1:c.41G>C | NP_001009190.1:p.(C14S) | variant contributes to A^Pbe haplotype associated with charcoal colour/pattern | 2014 | 25143047 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 1734 | OMIA:000201-30532 | fallow deer | Coat colour, black | ASIP | substitution | splicing | Naturally occurring variant | Not currently evaluated | GCF_033118175.1 | 23 | NC_083703.1:g.63827550G>A | XM_061127099.1:c.225+1G>A | 2024 | 39202415 | ||||||
| 1735 | OMIA:000201-30532 | fallow deer | Coat colour, black | ASIP | duplication | Naturally occurring variant | Not currently evaluated | GCF_033118175.1 | 23 | NC_083703.1:g.63830157_63830161dup | 2024 | 39202415 | ||||||||
| 1708 | OMIA:000201-9337 | common brushtail possum | Coat colour, non-agouti (black) | ASIP | substitution | missense | Naturally occurring variant | Not currently evaluated | mTriVul1.pri | 3 | NC_050575.1:g.100483705C>T | XM_036748710.1:c.343C>T | XP_036604605.1:p.(R115C) | 2024 | 39086822 | |||||
| 714 | OMIA:000201-9940 | sheep | Merino (Sheep) | White fleece | ASIP | Wt | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 13 | a 190kb tandem duplication encompassing the ASIP gene, the neighbouring AHCY gene and the promoter for a third gene ITCH | 2008 | 18493018 | ||||||
| 1111 | OMIA:000201-9940 | sheep | Recessive black | ASIP | a | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 13 | g.66475132_66475136del | published as g.100_105del / D5 and predicted to result in a frame shift followed by a premature stop codon 63 amino acids downstream of the start site | 2002 | 12354151 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||||
| 1112 | OMIA:000201-9940 | sheep | Recessive black | ASIP | a | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 13 | NC_040264.1:g.66474980T>A | NM_001134303.1:c.376T>A | NP_001127775.1:p.(C126S) | Published as g.5172T>A (Norris et al. 2008). cDNA and protein positions based on NM_001134303.1 and NP_001127775.1 | 2008 | 18493018 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1134 | OMIA:000201-9986 | rabbit | Black and tan | ASIP | a^t | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | OryCun2.0 | 4 | g.5455408_5466123del | Letko et al. (2020): NC_013672.1:g.5,455,408_5,466,123del | 2020 | 31729778 | ||||||
| 567 | OMIA:000201-9986 | rabbit | New Zealand White (Rabbit) | Black (non-agouti) | ASIP | a | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | UM_NZW_1.0 | 4 | NC_067377.1:g.13094745_13094746insT | NM_001122939.1:c.5_6insA | NP_001116411.1:p.(N2Kfs21*) | Reported by Letko et al. (2020): NM_001122939.1:c.5_6insA, the OryCun2.0 reference genome represents the nonagouti allele. | 2010 | 20004240 | ||
| 1270 | OMIA:000213-89462 | water buffalo | White | ASIP | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | UOA_WB_1 | 14 | "2,809-bp-long LINE-1 insertion in the ASIP (agouti signaling protein) gene" (Liang et al. (2020) | 2021 | 33212507 | ||||||||
| 667 | OMIA:000201-9627 | red fox | Dark Standard Silver | ASIP | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | VulVul2.2 | NW_020356514.1 | A 16.5-kb deletion resulting in "a 166-nt deletion in the Standard Silver fox cDNA, spanning the second exon ... .This deletion removes the start codon and entire signal peptide" | 1997 | 9054949 | ||||||||
| 1309 | OMIA:002325-9685 | domestic cat | Encephalopathy, spongy | ASPA | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | E1 | NC_058381.1:g.13594036C>G | XM_006939957.5:c.859G>C | XP_006940019.2:p.(A287P) | 2021 | 33779415 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||||
| 111 | OMIA:002099-9615 | dog | German Shepherd Dog (Dog) | Ichthyosis, ASPRV1-related | ASPRV1 | substitution | missense | Naturally occurring variant | LP/P | CanFam3.1 | 10 | NC_006592.3:g.68587027A>G | XM_014117456.1:c.1052T>C | XP_013972931.1:p.(L351P) | XM_014117456.1; XP_013972931.1 | 2017 | 28249031 | Genomic position in CanFam3.1 provided by Robert Kuhn and Mateo Etcheveste. | ||
| 1673 | OMIA:002099-9615 | dog | Pembroke Welsh Corgi (Dog) | Ichthyosis, non-epidermolytic | ASPRV1 | deletion, small (<=20) | frameshift | Naturally occurring variant | VUS | UU_Cfam_GSD_1.0 | 10 | NC_049231.1:g.69888722_69888723del | XM_038551592.1:c.594_595del | XP_038407520.1:p.(L199Rfs*342) | 2024 | 38549226 | ||||
| 289 | OMIA:000194-9913 | taurine cattle | Blanco Orejinegro, Colombia (Cattle) Brown Swiss (Cattle) Holstein Friesian (Cattle) | Citrullinaemia | ASS1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 11 | NC_037338.1:g.100781668C>T | NM_173892.4:c.256C>T | NP_776317.1:p.(R86*) | Variant initially identified in Holstein Friesian and later reported in additional breeds: PMID:30014197, PMID:34779908. | rs5334475062 | 1989 | 2813370 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | |
| 65 | OMIA:001471-9615 | dog | Poodle, Standard (Dog) | Neonatal encephalopathy with seizures | ATF2 | substitution | missense | Naturally occurring variant | LP/P | CanFam3.1 | 36 | NC_006618.3:g.19078954A>C | XM_005640334.3:c.152T>G | XP_005640391.1:p.(M51R) | 2008 | 18074159 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 94 | OMIA:001954-9615 | dog | Lagotto Romagnolo (Dog) | Neurodegenerative vacuolar storage disease | ATG4D | substitution | missense | Naturally occurring variant | LP/P | CanFam3.1 | 20 | NC_006602.3:g.50618958C>T | XM_542069.6:c.1288G>A | XP_542069.1:p.(A430T) | 2015 | 25875846 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1067 | OMIA:001552-9615 | dog | Australian Cattle Dog (Dog) | Neuronal ceroid lipofuscinosis, 12 | ATP13A2 | substitution | missense | Naturally occurring variant | LP/P | CanFam3.1 | 2 | NC_006584.3:g.81208162C>T | XM_005617949.3:c.1118C>T | XP_005618006.1:p.(T373I) | XM_005617949.3; XP_005618006.1 | 2019 | 30956123 | |||
| 400 | OMIA:001552-9615 | dog | Tibetan Terrier (Dog) | Neuronal ceroid lipofuscinosis, 12 | ATP13A2 | deletion, small (<=20) | splicing | Naturally occurring variant | P | CanFam3.1 | 2 | NC_006584.3:g.81210367del | XM_005617949.3:c.1623del | XM_005617949.3; XP_005618006.1; variant was published as c.1623delG p.P541fs*597 by Farias et al. (2011); Wöhlke et al. (2011) provided an alternate transcript position c.1620delG and proposed that the variant causes exon 16 skipping in NCL-affected Tibetan terriers. The sequence information provided by Wöhlke et al. (2011) corresponds to XM_005617949.3:c.1623del | 2011 | 21362476 22022275 | ||||
| 734 | OMIA:002110-9615 | dog | Belgian Shepherd Dog (Dog) | Ataxia, cerebellar, ATP1B2-related | ATP1B2 | insertion, gross (>20) | Naturally occurring variant | P | CanFam3.1 | 5 | NC_006587.3:g.32551064_32551065ins[LT796559.1:g.50_276] | XM_546597.5:c.130_131ins[LT796559.1:g.50_276] | "a 227 bp SINE insertion into exon 2 of the ATP1B2 gene" | 2017 | 28620085 | |||||
| 188 | OMIA:001450-9913 OMIA:001464-9913 | taurine cattle | Belgian Blue (Cattle) Maas-Rijn-Ijssel (Cattle) | Congenital muscular dystonia 1 | ATP2A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 25 | NC_037352.1:g.25933247G>A | NM_001075767.1:c.1675C>T | NP_001069235.1:p.(R559C) | Variant is reported to cause congenital muscular dystonia 1 in Belgian Blue cattle (OMIA 001450-9913) and congenital pseudomyotonia in a Dutch improved red and white cross-bred calf (OMIA:001464_9913). | rs5334475104 | 2008 | 18344998 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). | |
| 219 | OMIA:001464-9913 | taurine cattle | Romagnola (Cattle) | Pseudomyotonia, congenital | ATP2A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 25 | NC_037352.1:g.25939141C>A | NM_001075767.1:c.857G>T | NP_001069235.1:p.(G286V) | This variant was identified as part of a haplotype with the G211V variant in Romagnola cattle. Akyürek et al. (2022; PMID: 36293223) suggest that the G286V variant is likely to be benign and that the G211V is likely to be causal. | rs3423529256 | 2012 | 23046865 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | |
| 218 | OMIA:001464-9913 | taurine cattle | Romagnola (Cattle) | Pseudomyotonia, congenital | ATP2A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 25 | NC_037352.1:g.25939366C>A | NM_001075767.1:c.632G>T | NP_001069235.1:p.(G211V) | rs5334474971 | 2012 | 23046865 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 205 | OMIA:001464-9913 | taurine cattle | Chianina (Cattle) Marchigiana (Cattle) Romagnola (Cattle) | Pseudomyotonia, congenital | ATP2A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 25 | NC_037352.1:g.25940510C>T | NM_001075767.1:c.491G>A | NP_001069235.1:p.(R164H) | Variant initially identified in Chianina cattle and later reported in additional breeds: PMID: 35717834 | rs3423529241 | 2008 | 18786632 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | |
| 1192 | OMIA:002265-9615 | dog | Irish Terrier (Dog) | Darier disease | ATP2A2 | insertion, gross (>20) | frameshift | Naturally occurring variant | P | CanFam3.1 | 26 | NC_006608.3:g.8200944_8200945insN[(205)] | NM_001003214.1:c.2098-3_2098-2insN[(205)] | NP_001003214.1:p.(T700Vfs*6) | Linek et al. (2020): "a heterozygous SINE insertion [~205bp] into the ATP2A2 gene, at the end of intron 14, close to the boundary of exon 15", giving rise to NP_001003214.1:p.(Thr700Valfs*6) | 2020 | 32354065 | |||
| 1533 | OMIA:002265-9615 | dog | Shih Tzu (Dog) | Darier disease | ATP2A2 | substitution | missense | Naturally occurring variant | LP | UU_Cfam_GSD_1.0 | 26 | NC_049247.1:g.8434781A>C | NM_001003214.1:c.2425A>C | NP_001003214.1:p.(N809H) | 2023 | 36883421 | ||||
| 107 | OMIA:002608-9615 | dog | Labrador Retriever (Dog) | Modifier of copper toxicosis | ATP7A | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | NC_006621.3:g.60279238C>T | XM_005641519.2:c.980C>T | XP_005641576.1:p.(T327I) | rs852523339 | 2016 | 26747866 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The phenotype was renamed from 'Menkes disease' to 'Modifier of copper toxicosis' based on feedback from Tom Nagels [10/01/2023]. | ||
| 106 | OMIA:001071-9615 | dog | Huntaway (Dog) Labrador Retriever (Dog) New Zealand Heading Dog (Dog) | Wilson disease | ATP7B | substitution | missense | Naturally occurring variant | Out of scope | CanFam3.1 | 22 | NC_006604.3:g.225112G>A | XM_005633828.3:c.4151G>A | XP_005633885.1:p.(R1384Q) | XM_005633831.3; XP_005633888.1; variant published as c.4358G>A / p.(R1453Q) and the variant coordinates in this table have been changed to reflect recent transcript IDs; conflicting evidence in regard to causality of this variant are reported in the literature - see https://omia.org/OMIA001071/9615/ for details. Additional breeds based on PMID:40965331 | rs851958524 | 2016 | 26747866 | 30 Dec 2020: correct genomic location provided by Angelica K Kallenberg | |
| 1347 | OMIA:001071-9685 | domestic cat | Wilson disease | ATP7B | substitution | missense | Naturally occurring variant | Out of scope | F.catus_Fca126_mat1.0 | A1 | NC_058368.1:g.19545959C>T | XM_023251165.2:c.1649C>T | XP_023106933.2:p.(P550L) | 2020 | 31687873 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||||
| 1590 | OMIA:001071-9685 | domestic cat | Domestic Longhair (Cat) | Wilson disease | ATP7B | substitution | missense | Naturally occurring variant | Out of scope | F.catus_Fca126_mat1.0 | A1 | NC_058368.1:g.19573282T>A | XM_023251165.1:c.3670T>A | XP_023106933.2:p.(W1224R) | variant heterozygous in a single affected cat | 2023 | 37427085 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1136 | OMIA:001071-9685 | domestic cat | Wilson disease | ATP7B | substitution | missense | Naturally occurring variant | LP | F.catus_Fca126_mat1.0 | A1 | NC_058368.1:g.19574780C>G | XM_023251165.2:c.3890C>G | XP_023106933.2:p.(T1297R) | 2019 | 30561139 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||||
| 1076 | OMIA:001645-10036 | golden hamster | Black tremor | Atrn | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | Kuramoto et al. (2002): "an approximately 10-kb DNA fragment, which had 557-bp direct repeats in both ends and was flanked by the identical 6-bp target duplication sequences, [that] was inserted into exon 24" | 2002 | 11773967 | ||||||||||
| 348 | OMIA:000487-9796 | domestic horse | Belgian Draft (Horse) Friesian (Horse) Warmblood (Horse) | Hydrocephalus | B3GALNT2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 1 | NC_009144.3:g.76887901C>T | XM_001491545.6:c.1423C>T | XP_001491595.2:p.(Q475*) | XM_001491545; XP_001491595; Ducro et al. (2015): "The nomenclature for the mutation is c.1423C>T [GenBank:XM_001491545] corresponding to p.Gln475* [GenBank:XP_001491595]". As at 25 April 2019, Ensembl's Variant Effect Predictor (VEP) gives the EquCab3 c. and p. coordinates as having not changed from the EquCab2 coordinates reported by Ducro et al. (2015). The Ensembl ref is ENSECAT00000049072 | rs3429464524 | 2015 | 26452345 | c. and p. variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. EquCab3 g. coordinate provided by Meredith O’Connell, working under the supervision of Professor Ernie Bailey, 24 April 2019. Breed information updated based on PMID: 38600096 | |
| 439 | OMIA:001885-9940 | sheep | Lacaune (Sheep) | Fecundity, Lacaune, FecL | B4GALNT2 | substitution | regulatory | Naturally occurring variant | Not currently evaluated | Oar_v3.1 | 11 | g.36938224T>A | c.766+2831A>T | ENSOART00000006875.1:c.766+2831A>T ENSOART00000006877.1:c.781+2831A>T | rs588626728 | 2013 | 24086150 | |||
| 440 | OMIA:001885-9940 | sheep | Lacaune (Sheep) | Fecundity, Lacaune, FecL | B4GALNT2 | substitution | regulatory | Naturally occurring variant | Not currently evaluated | Oar_v3.1 | 11 | g.37034573A>G | 2013 | 24086150 | ||||||
| 421 | OMIA:002068-9796 | domestic horse | Friesian (Horse) | Dwarfism, Friesian | B4GALT7 | substitution | splicing | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 14 | NC_009157.3:g.3772591C>T | XM_023617086.1:c.50G>A | XP_023472854.1:p.(R17K) | rs3447120064 | 2016 | 27793082 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. FN thanks Elizabeth Huffman, who updated the g. coordinates to EquCab3, working under the supervision of Professor Ernie Bailey; 23 April 2020. | ||
| 1676 | OMIA:002837-9646 | giant panda | Coat colour, brown white | BACE2 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 1 | c.176_200del | Published as c.176_200delTCGCCCTGGAGCCCGCCGGCGGCGC; g.4545815_4545839del | 2024 | 38437540 | ||||||||
| 1391 | OMIA:002484-9615 | dog | Shetland Sheepdog (Dog) | Bardet-Biedl syndrome 2 | BBS2 | substitution | missense | Naturally occurring variant | LP/P | CanFam3.1 | 2 | NC_006584.3:g.59693737G>C | ENSCAFT00000014523.5:c.1222G>C | ENSCAFP00000013435.4:p.(A408P) | 2021 | 34828377 | ||||
| 356 | OMIA:002045-9615 | dog | Puli (Dog) | Bardet-Biedl syndrome 4 | BBS4 | substitution | nonsense (stop-gain) | Naturally occurring variant | P | CanFam3.1 | 30 | NC_006612.3:g.36063748A>T | c.58A>T | p.(K20*) | 2017 | 28533336 | ||||
| 1131 | OMIA:002216-9544 | Rhesus monkey | Bardet-Biedl syndrome 7 | BBS7 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Mmul_8.0.1 | c.160delG | p.(A54fs) | 2019 | 31589838 | |||||||
| 1049 | OMIA:002178-9823 | pig | Landrace (Pig) Large White (Pig) Yorkshire (Pig) | Abortion, BBS9 and BMPER-related | BBS9 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 18 | NC_010460.4:g.39817373_40029300del | Derks et al. (2018): "a large deletion in complete LD with the SSC18 haplotype of approximately 212kb (position 39,817,373 to 40,029,300), spanning a part of the BBS9 gene ... [and reducing] expression of the downstream BMPER gene". Initially reported in Large White and later reported in other breeds (PMID:39327728). | 2018 | 30231021 | ||||||
| 635 | OMIA:001592-9615 | dog | Cavalier King Charles Spaniel (Dog) | Episodic falling | BCAN | deletion, gross (>20) | Naturally occurring variant | P | CanFam3.1 | 7 | NC_006589.3:g.41325010_41340731delinsAAGGCC | XM_005622698.1:c.-13991_466+85delinsGGCCTT | a 15.7kb deletion in the BCAN gene removing the first 3 exons | 2012 | 21821125 | |||||
| 298 | OMIA:000627-9913 | taurine cattle | Polled Hereford (Cattle) | Maple syrup urine disease | BCKDHA | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 18 | g.50551011C>T | c.148C>T | p.(Q50*) | cDNA position based on ENSBTAT00000021342.6 | rs5334475064 | 1990 | 2303405 | ||
| 200 | OMIA:000627-9913 | taurine cattle | Shorthorn (Cattle) | Maple syrup urine disease | BCKDHA | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 18 | g.50560242C>T | c.1380C>T | p.(P372L) | rs3423447991 | 1999 | 10425233 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1333 | OMIA:001079-9940 | sheep | spælsau (Sheep) | yellow fat | BCO2 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 15 | "insertion of a 7.9 kb endogenous Jaagsiekte Sheep Retrovirus (enJSRV) sequence in the first intron of the BCO2 gene" (Kent et al. 2021) | 2021 | 34193038 | ||||||||
| 549 | OMIA:001079-9986 | rabbit | Flemish Giant (Rabbit) New Zealand White (Rabbit) | Yellow fat | BCO2 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | 1 | delAAT | 2015 | 26002694 | ||||||||
| 1375 | OMIA:002466-48883 OMIA:002466-48882 OMIA:002466-87173 OMIA:002466-48884 OMIA:002466-48885 OMIA:002466-48886 OMIA:002466-1553461 | medium ground-finch | Beak colour, yellow | BCO2 | substitution | synonymous | Naturally occurring variant | Not currently evaluated | 24 | g.6166878G>A | p.(V?V) | synonymous change 32 bp into exon 4 | 2021 | 34687609 | ||||||
| 305 | OMIA:001079-9913 | taurine cattle | Holstein Friesian (Cattle) | Yellow fat | BCO2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 15 | NC_037342.1:g.22552375G>A | NM_001101987.2:c.306G>A | NP_001095457.2:p.(W102*) | UMD3.1 position is g.22877552G>A; cDNA position is based on XM_024975217.1 | rs109226280 | 2009 | 19398771 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 1559 | OMIA:002466-9135 | common canary | Beak and leg colour, red | BCO2 | substitution | missense | Naturally occurring variant | Not currently evaluated | NW_022042652.1 | g.75258192G>A | p.R413H | 2020 | 31930402 | XP_009096268.1, genomic position as reported by Bovo et al. (2023) PMID:37194440 | ||||||
| 320 | OMIA:001079-9940 | sheep | spælsau (Sheep) | Yellow fat | BCO2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 15 | NC_040266.1:g.25024133C>T | XM_012095240.3:c.196C>T | XP_011950630.2:p.(Q66*) | Oar_v3.1 position is g.21947481C>T | rs1090867485 | 2010 | 20122251 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 737 | OMIA:001554-9615 | dog | Finnish Lapphund (Dog) Lapponian Herder (Dog) | Multifocal retinopathy 3 | BEST1 | cmr3 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 18 | g.54470590del | c.1388del | p.(P463Hfs) | NM_001097545.1; NP_001091014.1; published as c.1388delC; variant initially identified in Lapponian Herder and later reported in additional breeds: PMID:27525650 | rs397509969 | 2010 | 21197113 | Variant information and allele abbreviation gleaned from or confirmed by Donner et al. (2016) PLoS One 11:e0161005 and genomic position in CanFam3.1 and EVA ID provided by Mateo Etcheveste and Robert Kuhn. |
| 59 | OMIA:001553-9615 | dog | Coton de Tulear (Dog) | Multifocal retinopathy 2 | BEST1 | cmr2 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 18 | NC_006600.3:g.54476143C>T | NM_001097545.1:c.482G>A | NP_001091014.1:p.(G161D) | NM_001097545.1; NP_001091014.1 | 2007 | 17460247 | Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. | |
| 275 | OMIA:001444-9615 | dog | Boerboel (Dog) Bull Mastiff (Dog) English Mastiff (Dog) Great Pyrenees (Dog) | Multifocal retinopathy 1 | BEST1 | cmr1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 18 | NC_006600.3:g.54478586G>A | NM_001097545.1:c.73C>T | NP_001091014.1:p.(R25*) | NM_001097545.1; NP_001091014.1 | 2007 | 17460247 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 1822 | OMIA:002976-9541 | crab-eating macaque | Macular dystrophy | BEST1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Macaca_fascicularis_5.0 | 14 | NC_022285.1:g.12255587G>C | XM_015434136.1:c.979C>G | XP_015289622.1:p.(Q327E) | 2025 | 40327408 | |||||
| 398 | OMIA:001660-9615 | dog | Great Dane (Dog) | Inherited myopathy of Great Danes | BIN1 | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 19 | NC_006601.3:g.23522400A>G | XM_014121413.2:c.786-2A>G | XP_013976888.1:p.(R262_K263insASASRPFPQ) | XM_014121413.2; XP_013976888.1; published as IVS10-2A>G, updated in this table to HGVS nomenclature | 2013 | 23754947 | |||
| 1770 | OMIA:002917-9615 | dog | Mixed Breed (Dog) | Biliverdinuria | BLVRA | deletion, gross (>20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 18 | NC_049239.1:g.6532022_6551313del | XP_038418561.1:p.(K117_K296del) | 2024 | 39766828 | |||||
| 1771 | OMIA:002917-9615 | dog | Mixed Breed (Dog) | Biliverdinuria | BLVRA | deletion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 18 | NC_049239.1:g.6543863_6545908 | XP_038418561.1:p.(A154fs) | 2024 | 39766828 | |||||
| 1874 | OMIA:003044-9685 | domestic cat | Domestic Shorthair (Cat) | Osteogenesis imperfecta, BMP1-related | BMP1 | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.35831890C>T | XM_045055405.1:c.637G>A | XP_044911340.1:p.(V213M) | 2026 | 41562138 | ||||
| 755 | OMIA:002306-9940 | sheep | Tunisian Barbary (Sheep) | Fecundity, Barbarine | BMP15 | FecX(Bar) | complex rearrangement | frameshift | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | X | g.[56600937insG;56600945_56600947del;56600948C>A] | c.[301G>T;302_304delCTA;310insC] | p.(A101Cfs*113) | "a composite polymorphism associating a single nucleotide substitution (c.301G > T), a 3 bp deletion (c.302_304delCTA) and a C insertion (c.310insC) in the ovine BMP15 cDNA leading to a frame shift at protein position 101" - cDNA positions based on NM_001114767 | 2017 | 28506298 | ||
| 244 | OMIA:002306-9940 | sheep | Belclare (Sheep) Cambridge (Sheep) | Fecundity, Belclare | BMP15 | FecX(B) | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | X | NC_040278.1:g.56594843C>A | NM_001114767.1:c.1100G>T | NP_001108239.1:p.(S367I) | 2004 | 14627550 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 238 | OMIA:002306-9940 | sheep | Olkuska (Sheep) | Fecundity, Olkuska | BMP15 | FecX(O) | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | X | NC_040278.1:g.56594934T>G | NM_001114767.1:c.1009A>C | NP_001108239.1:p.(N337H) | Protein and cDNA positions based on NP_001108239.1 and NM_001114767.1, respectively. | 2013 | 23637641 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 236 | OMIA:002306-9940 | sheep | Lacaune (Sheep) | Fecundity, Lacaune | BMP15 | FecX(L) | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | X | NC_040278.1:g.56594981C>T | NM_001114767.1:c.962G>A | NP_001108239.1:p.(C321Y) | cDNA position based on NP_001108239.1 | 2007 | 17038554 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 237 | OMIA:002306-9940 | sheep | Grivette (Sheep) | Fecundity, Grivette | BMP15 | FecX(Gr) | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | X | NC_040278.1:g.56594993G>A | NM_001114767.1:c.950C>T | NP_001108239.1:p.(T317I) | protein and cDNA positions based on NP_001108239.1 and NM_001114767.1, respectively | 2013 | 23637641 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 235 | OMIA:002306-9940 | sheep | Romney Marsh (Sheep) | Fecundity, Inverdale | BMP15 | FecX(I) | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | X | NC_040278.1:g.56595047A>T | NM_001114767.1:c.896T>A | NP_001108239.1:p.(V299D) | protein and cDNA positions based on NP_001108239.1 and NM_001114767.1, respectively | rs398521635 | 2000 | 10888873 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. |
| 335 | OMIA:002306-9940 | sheep | Romney Marsh (Sheep) | Fecundity, Hanna | BMP15 | FecX(H) | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | X | NC_040278.1:g.56595072G>A | NM_001114767.1:c.871C>T | NP_001108239.1:p.(Q291*) | previously listed as c.1184C>T; protein and cDNA position based on NP_001108239.1 and NM_001114767.1, respectively | rs413916687 | 2000 | 10888873 | |
| 334 | OMIA:002306-9940 | sheep | Cambridge (Sheep) | Fecundity, Galway | BMP15 | FecX(G) | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | X | NC_040278.1:g.56595225G>A | NM_001114767.1:c.718C>T | NP_001108239.1:p.(Q239*) | rs425019156 | 2004 | 14627550 | ||
| 521 | OMIA:002306-9940 | sheep | Rasa Aragonesa, Spain (Sheep) | Fecundity, Rasa Aragonesa | BMP15 | FecX(R) | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | X | NC_040278.1:g.56595467_56595483del | NM_001114767.1:c.460_476del | NP_001108239.1:p.(W154Nfs*55) | published as c.525_541delTGGGTCCAGAAAAGCCC based on AF236079, protein and cDNA position in table based on NP_001108239.1 and NM_001114767.1, respectively | 2008 | 18355397 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 1345 | OMIA:002306-9940 | sheep | Blanc Du Massif Central (Sheep) Noir du Velay, France (Sheep) | Fecundity | BMP15 | FecX(N) | substitution | regulatory | Naturally occurring variant | Not currently evaluated | Oar_v3.1 | X | g.50977717T>A | 2020 | 32636872 | |||||
| 1341 | OMIA:002306-9940 | sheep | Rasa Aragonesa, Spain (Sheep) | Fecundity | BMP15 | FecX(RA) | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_v3.1 | X | NC_019484.1:g.50970948G>A | NM_001114767.1:c.1172C>T | NP_001108239.1:p.(T391I) | Published as ENSOART00000010201: p.T400I - changed from NC_019484.1:g.50970948C>T to NC_019484.1:g.50970948G>A [09/06/2025] | 2020 | 31927415 | ||
| 1281 | OMIA:002306-9823 | pig | German Landrace (Pig) | Infertility and increased litter size | BMP15 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | X | NC_010461.5:g.44618787C>T | NM_001005155.2:c.634C>T | NP_001005155.2:p.(R212*) | 2021 | 33413103 | ||||
| 1768 | OMIA:002074-9940 | sheep | Tail fat deposition | BMP2 | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v1.0 | 13 | NC_040264.1:g.51760995A>C | candidate causal variant that influences tail fat weight trait and expression of BMP2 | 2024 | 39742295 | ||||||||
| 862 | OMIA:001551-9615 | dog | Brachycephaly | BMP3 | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 32 | g.5231894C>A | c.1344C>A | p.(F448L) | rs851217657 | 2012 | 22876193 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||||
| 241 | OMIA:000383-9940 | sheep | Booroola (Sheep) Small Tailed Han, China (Sheep) | Fecundity, Booroola | BMPR1B | FecB(B) | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 6 | NC_040257.1:g.34010859T>C | NM_001009431.1:c.746A>G | NP_001009431.1:p.(Q249R) | Position on Oar_v3.1: g.29382188T>C, previously listed in OMIA as c.914A>G and p.(Q305R). c. and p. coordinates updated [10/06/2025] | rs418841713 | 2001 | 11259271 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool, the genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. |
| 1254 | OMIA:000576-9823 | pig | Yorkshire (Pig) | Knobbed acrosome defect | BOLL | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 15 | NC_010457.5:g.101549770_101604750del | 2020 | 32975846 | |||||||
| 93 | OMIA:001512-9615 | dog | Invasive transitional cell carcinoma of the bladder | BRAF | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 16 | g.8296284T>A | c.1643T>A | p.(V548E) | XM_005629551.3; XP_005629608.1; published as somatic mutation p.(V594E) | 2015 | 25767210 | ||||||
| 1766 | OMIA:002913-9913 | taurine cattle | Holstein Friesian (Cattle) | Cardiac malformation, BRI3BP-related | BRI3BP | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 17 | NC_037344.1:g.50813902C>T | NM_001099087.1:c.478G>A | NP_001092557.1:p.(V160I) | likely de novo variant | 2025 | 39593234 | |||
| 851 | OMIA:002132-9615 | dog | German Shorthaired Pointer (Dog) | Abortion (embryonic lethality), BTBD17-related | BTBD17 | insertion, small (<=20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | g.6048201_6048202insG | c.85+206_85+207insG | ROS_Cfam_1.0:g.6720627_6720628insG ENSCAFT00845033049.1:c.85+206_85+207insG; the homozygous variant genotype is associated with embryonic lethality in German Shorthaired Pointer, but may not be causal as the variant was observed at a high frequency in both heterozygous and homozygous form across normal dogs from multiple breeds (PMID:37582787, PMID:40965331) | rs852549625 | 2017 | 29053721 | ||||
| 981 | OMIA:001991-9913 | taurine cattle | Nordic Red (Cattle) | Stillbirth | BTBD9 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 23 | "∼525 KB deletion on Chr23:12,291,761-12,817,087 (overlapping BTBD9, GLO1 and DNAH8)" | 2016 | 27091210 | ||||||||
| 325 | OMIA:001622-9031 | chicken | Resistance to avian sarcoma and leukosis viruses, subgroup C | BTN1A1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | GRCg6a | 28 | g.903289G>T | c.165C>A | p.(C55*) | rs735807319 | 2005 | 16051833 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 455 | OMIA:000155-9615 | dog | Brittany Spaniel (Dog) | C3 deficiency | C3 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 20 | g.53573746del | c.2136del | p.(F712Lfs*11) | XM_038428862.1; XP_038284790.1 "a deletion of a cytosine at position 2136 (codon 712), leading to a frameshift that generates a stop codon 11 amino acids downstream" | 1998 | 9510185 | |||
| 1693 | OMIA:001270-9913 | taurine cattle | Angus (Cattle) | Bovine familial convulsions and ataxia | CACNA1A | BFCA | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 7 | NC_037334.1:g.12367906C>T | NM_001075129.1:c.5041C>T | NP_001068597.1:p.(R1681*) | 2024 | 38426585 | |||||
| 1737 | OMIA:002886-9823 | pig | Large White (Pig) | Timothy syndrome 1 | CACNA1C | substitution | missense | Genome-editing (CRISPR-Cas9) | Not currently evaluated | Sscrofa11.1 | 5 | NC_010447.5:g.69316114G>A | XM_021092981.1:c.1216G>A | XP_020948640.1:p.(G406R) | 2023 | 38665938 | ||||
| 1881 | OMIA:003046-9615 | dog | English Cocker Spaniel (Dog) | Retinal atrophy, progressive, CACNA1F-related | CACNA1F | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | X | NC_049260.1:g.42516353del | XM_038587436.1:c.4481del | XP_038443364.1:(F1482Lfs*8) | 2026 | 41882631 | ||||
| 1660 | OMIA:002819-9913 | taurine cattle | Holstein Friesian (Cattle) | Muscle weakness | CACNA1S | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 16 | NC_037343.1:g.79613592C>T | XM_024976574.1:c.3853G>A | XP_024832342.1:p.G1285S | ENSBTAT00000065901.3; ENSBTAP00000054797.3 | rs3423414874 | 2024 | 38246543 | ||
| 1852 | OMIA:003025-9913 | taurine cattle | Angus (Cattle) | Cerebellar abiotrophy | CACNA2D2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 22 | NC_037349.1:g.49970603T>C | XM_024983269.1:c.1183T>C | XP_024839037.1:p.(C395R) | 2026 | 41873845 | ||||
| 1087 | OMIA:002201-9913 | taurine cattle | Normande (Cattle) | Abortion due to haplotype NH7 | CAD | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 11 | g.72409143T>C | p.(Y452C) | published as CAD g.72399397T>C; p.Tyr452Cys | rs5334475092 | 2019 | 31056337 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||
| 1787 | OMIA:002939-9685 | domestic cat | Bengal (Cat) | Epileptic encephalopathy | CAD | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A3 | NC_058370.1:g.118599900C>T | XM_011281284.3:c.6044G>A | XP_011279586.1:p.(Ser2015Asn) | 2025 | 40251393 | ||||
| 1490 | OMIA:002573-151761 | yellow-crowned parrot | Lewy body-like disease | CADPS2 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.1675G>C | p.(V559L) | 2022 | 36086934 | ||||||||
| 105 | OMIA:001820-9615 | dog | Parson Russell Terrier (Dog) | Ataxia, spinocerebellar | CAPN1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 18 | NC_006600.3:g.52009339C>T | XM_540866.5:c.344G>A | XP_540866.2:p.(C115Y) | XM_540866.5; XP_540866.2 | 2013 | 23741357 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 1692 | OMIA:002854-9615 | dog | Miniature Schnauzer (Dog) | Immunodeficiency, susceptibility to Mycobacterium avium complex | CARD9 | deletion, small (<=20) | deletion (in-frame) | Not currently evaluated | CanFam3.1 | 9 | NC_006591.3:g.49115079_49115081del | XM_844178.5:c.493_495del | XP_849271.2: p.(K165del) | 2024 | 38710903 | |||||
| 1674 | OMIA:002835-9615 | dog | Cavalier King Charles Spaniel (Dog) | Immunodeficiency, CARMIL2-related | CARMIL2 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 5 | NC_006587.3:g.81801920G>A | XM_022419456.1:c.871C>T | XP_022275164.1:p.(R291*) | NC_006587.3; XM_022419456.1; XP_022275164.1 | rs3330142729 | 2024 | 38535207 | ||
| 49 | OMIA:001138-9615 | dog | American Foxhound (Dog) Beagle (Dog) English Foxhound (Dog) Harrier (Dog) Poodle, Miniature (Dog) Treeing Walker Coonhound (Dog) | Hypocatalasia | CAT | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 18 | NC_006600.3:g.33397548C>T | NM_001002984.1:c.979G>A | NP_001002984.1:p.(A327T) | Variant initially identified in Beagle and later reported in additional breeds: PMID:29708978, PMID27525650 | 2000 | 11137458 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 516 | OMIA:001416-9612 | gray wolf | Coat colour, dominant black | CBD103 | K^B | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | 3bp deletion of the CBD103 gene | 2009 | 19197024 | |||||||||
| 520 | OMIA:001416-9614 | coyote | Coat colour, dominant black | CBD103 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | 3bp deletion of the CBD103 gene | 2009 | 19197024 | ||||||||||
| 458 | OMIA:001416-9615 | dog | Huntaway (Dog) New Zealand Heading Dog (Dog) | Coat colour, dominant black | CBD103 | ΔG23 = K^B | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 16 | g.58965449_58965451del | c.231_233del | p.(G78del) | "a 3-base pair (bp) deletion in the second exon of CBD103, the ortholog of human DEFB103, that predicts an in-frame glycine deletion (ΔG23)". Multiple breeds, additional breeds based on PMID:40965331 | rs851502010 | 2007 | 17947548 | Genomic location provided by Professor Claire Wade August 2018. Allele designations taken from Ollivier et al. (2013) |
| 1032 | OMIA:002167-9913 | taurine cattle | Nordic Red (Cattle) | Asthenospermia | CCDC189 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 25 | g.26880841C>T | Touru et al. (2019): "a variant disrupting a canonical 5’ splice donor site (GCA_000003055.3:Chr25:g.27138357C>T) in CCDC189 (transcript - ID:ENSBTAT00000045037) encoding the coiled-coil domain containing protein 189." | rs5334474909 | 2019 | 30975085 | ||||
| 266 | OMIA:001540-9615 | dog | Old English Sheepdog (Dog) | Ciliary dyskinesia, primary | CCDC39 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 34 | NC_006616.3:g.13952270G>A | XM_545213.6:c.286C>T | XP_545213.3:p.(R96*) | 2011 | 21131972 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1403 | OMIA:002342-9940 | sheep | Blanc Du Massif Central (Sheep) Lacaune (Sheep) | Ciliary dyskinesia, primary (respiratory failure) | CCDC65 | LDHH6 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 3 | NC_040254.1:g.147207999C>A | XM_004006389.4:c.521G>T | XP_004006438.1:p.(E111*) | XM_004006389.4; XP_004006438.1; published as NC_040254.1:g.147,207,999C>A | rs1085624756 | 2021 | 35052387 | |
| 1274 | OMIA:001521-9615 | dog | Portuguese Water Dog (Dog) | Progressive retinal atrophy, early onset | CCDC66 | EOPRA | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 20 | g.33717704_33717705insT | c.2262_c.2263insA | p.(V747Sfs*8) | 2020 | 33273526 | |||
| 574 | OMIA:001521-9615 | dog | Schapendoes (Dog) | Generalized PRA | CCDC66 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 20 | g.33745452_33745453insT | c.521_522insA | p.(N174Kfs*2) | NM_001168012.1; NP_001161484.1; genomic coordinates in accordance with HGVS 3'-rule | 2010 | 19777273 | Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. | ||
| 1008 | OMIA:001752-9823 | pig | Resistance to PRRS virus | CD163 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 5 | Burkhard et al (2018): "the deletion of exon 7 of CD163 using CRISPR/Cas9 editing" | 2018 | 29925651 | |||||||||
| 538 | OMIA:001299-9031 | chicken | Resistance to avian sarcoma and leukosis viruses, subgroup A | CD320 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | 28 | c.502_511delCGCTCACCCC | 2015 | 25873518 | |||||||||
| 539 | OMIA:001299-9031 | chicken | Resistance to avian sarcoma and leukosis viruses, subgroup A | CD320 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | 28 | c.502_516delCGCTCACCCCGCCCC | 2015 | 25873518 | |||||||||
| 395 | OMIA:001299-9031 | chicken | Resistance to avian sarcoma and leukosis viruses, subgroup A | CD320 | deletion, small (<=20) | splicing | Naturally occurring variant | Not currently evaluated | 28 | c.506-515del10 | 2012 | 22171251 | ||||||||
| 396 | OMIA:001299-9031 | chicken | Resistance to avian sarcoma and leukosis viruses, subgroup A | CD320 | deletion, small (<=20) | splicing | Naturally occurring variant | Not currently evaluated | 28 | c.507-511del5 | 2012 | 22171251 | ||||||||
| 603 | OMIA:001299-9031 | chicken | Resistance to avian sarcoma and leukosis viruses, subgroup A | CD320 | tva^r2 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | GRCg6a | 28 | NC_006115.5:g.985659_985660insCTCG | NM_001044645.1:c.48_49insCTCG | NP_001038110.1:p.(P18Afs) | 2004 | 15564460 | Genomic position in GRCg6a provided by Joshua Khamis. | |||
| 12 | OMIA:001299-9031 | chicken | Resistance to avian sarcoma and leukosis viruses, subgroup A | CD320 | tva^r | substitution | missense | Naturally occurring variant | Not currently evaluated | GRCg6a | 28 | NC_006115.5:g.985981C>G | NM_001044645.1:c.186C>G | NP_001038110.1:p.(C62W) | published as c.120C>G and p.(C40W); coordinates in the table have been updated to a recent reference genome and / or transcript | 2004 | 15564460 | Genomic position in GRCg6a provided by Joshua Khamis. | ||
| 1340 | OMIA:002386-9544 | Rhesus monkey | OKT4 epitope deficiency | CD4 | substitution | missense | Naturally occurring variant | Not currently evaluated | 11 | c.C793T | p.(A265W) | 2021 | 33893743 | |||||||
| 1528 | OMIA:002626-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Haplotype with homozygous deficiency JBH17, CDC45-related | CDC45 | substitution | splicing | Naturally occurring variant | Not currently evaluated | UMD_3.1.1 | 17 | g.74743512G>T | located in a splicing donor site at a distance of 5 bp, affecting pre-mRNA splicing | 2021 | 33758295 | |||||
| 1496 | OMIA:002584-9615 | dog | Beauceron (Dog) | Deafness, CDH23-related | CDH23 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 4 | g:22340631C>T | c.700C>T | p.(P234S) | ON462053; XM_022417544.1; XP_022273252.1 | 2023 | 36308003 | The UU_Cfam_GSD_1.0 genomic variant coordinate is: g.Chr4:23074925C>T | ||
| 3 | OMIA:000102-9031 | chicken | Sex-linked extreme dilution | CDKN2A | B0 | haplotype | Naturally occurring variant | Not currently evaluated | Z | The B0 allele is characterised by two non-coding variants:Â "The first, SNP1, is within the CDKN2A (ARF) promoter region, 265 bp upstream of the transcription start site (according to GenBank AY138245), and the second, SNP2, is located at nucleotide position 385 bp in CDKN2A intron 1" | 2010 | 20374521 | ||||||||
| 1871 | OMIA:001699-9031 | chicken | Shank colour, Inhibition of dermal melanin locus | CDKN2A | ID | delins, gross (>20) | regulatory | Naturally occurring variant | Not currently evaluated | GRCg6a | Z | chrZ:78942980_78943123delinsAA | 143 bp deletion coupled with a 2 bp insertion impacting exprssion of CDKN2A | 2026 | 41496629 | |||||
| 5 | OMIA:000102-9031 | chicken | Sex-linked dilution | CDKN2A | B2 | substitution | missense | Naturally occurring variant | Not currently evaluated | GRCg6a | Z | g.78856557G>A | c.28C>T | p.(R10C) | rs1059941965 | 2010 | 20374521 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 4 | OMIA:000102-9031 | chicken | Sex-linked barring | CDKN2A | B1 | substitution | missense | Naturally occurring variant | Not currently evaluated | GRCg6a | Z | g.78856559A>T | c.26T>A | p.(V9D) | rs3388417177 | 2010 | 20374521 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 863 | OMIA:001890-198806 | ruff | Male body size/courtship behaviour | CENPN | inversion | Naturally occurring variant | Not currently evaluated | "a 4.5Mb inversion on the ruff orthologue of chicken chromosomr GGA11 which, due to the well-known lethality of recombinants within an inversion, has created a supergene determining male breeding behaviour, body size and plumage colour" | 2016 | 26569123 | ||||||||||
| 991 | OMIA:001830-9913 | taurine cattle | Holstein (black and white) (Cattle) | Abortion due to haplotype HH7 | CENPU | deletion, small (<=20) | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 27 | g.15123637_15123640del | Hozé et al. (2019): "Considering that CENPU is transcribed in the antisense orientation, this mutation is predicted to result in deletion of the nucleotides located at position +3 to + 6 bp after the splicing donor site of exon 11. Using cross-species nucleotide alignment, we observed that the nucleotide at position +3 is entirely conserved among vertebrates . . . , which suggests that it plays an important role in regulation of CENPU splicing. If modified after exon 11, the abnormal splicing of CENPU could cause mRNA decay or the production of a protein modified after residue 319 out of 409 AA. Based on these factors, we assumed that mutation g.14168130_14168133delTACT on chromosome 27 alters the splicing of CENPU and is embryonic lethal." | 2020 | 31733857 | |||||
| 964 | OMIA:001502-9913 | taurine cattle | Montbéliarde (Cattle) | Caprine-like Generalized Hypoplasia Syndrome | CEP250 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 13 | g.64710424C>T | c.493C>T | p.(Q165*) | rs5334474991 | 2015 | 25902731 | Coordinates obtained from and/or confirmed by EBI's VEP | ||
| 384 | OMIA:001244-9685 | domestic cat | Abyssinian (Cat) American Curl (Cat) American Shorthair (Cat) American Wirehair (Cat) Balinese (Cat) Bengal (Cat) Colorpoint Shorthair (Cat) Cornish Rex (Cat) Devon Rex (Cat) Donskoy (Cat) European Shorthair (Cat) Havana (Cat) Highlander (Cat) Maine Coon (Cat) Manx (Cat) Munchkin (Cat) Ocicat (Cat) Oriental Longhair (Cat) Oriental Shorthair (Cat) Peterbald (Cat) Pixiebob Longhair (Cat) Ragdoll (Cat) Scottish Fold (Cat) Siamese (Cat) Singapura (Cat) Somali (Cat) Sphynx (Cat) Tennessee Rex (Cat) Tonkinese (Cat) | Retinal degeneration II | CEP290 | substitution | splicing | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | B4 | NC_058374.1:g.110285757A>C | XM_023256243.2:c.7584+9T>G | published as IVS50 + 9T>G. The cat sequenced to generate the Felis_catus_9.0 reference genome is homozygous for the likely causal variant. The genomic and cDNA coordinates had therefore been previously listed in this table as Felis_catus_9.0:g.112522818TC>A and c.7584+9G>T. The information has been updated based on feedback from 潘旭 to reflect that the likely causal variant is c.7584+9G and that the normal allele is c.7584+9T [6/4/2023]. Variant was initially identified in the Abyssinian and Somali breeds but identified to be present in several other breeds (Pubmed:19747862; PMID:35709088) |
2007 | 17507457 | The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 177 | OMIA:000636-9823 | pig | Membranoproliferative glomerulonephritis type II | CFH | substitution | missense | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 10 | NW_018085100.1:g.2553907T>G | NM_214281.2:c.3551T>G | NP_999446.1:p.(I1184R) | CFH is located on Chr10 in Sscrofa10.2 g.2553907T>G, but recorded as 'unplaced/NW_018085100.1' in Sscrofa11.1., published as c.3610T>G; p.(I1166R) | 2002 | 12466119 | The genomic location on Sscrofa11.1 was determined by Stephanie Shields (27/05/2020) | |||
| 1479 | OMIA:001794-9940 | sheep | Romney (Sheep) | Cystic fibrosis | CFTR | substitution | nonsense (stop-gain) | Genome-editing (CRISPR-Cas9) | Not currently evaluated | Oar_rambouillet_v1.0 | 4 | NC_040255.1:g.57192317C>A | NM_001009781.1:c.1621G>T | NP_001009781.1:p.(G541*) | NM_001009781.1; NP_001009781.1; published as p.(G542X), coordinates in this table are updated to recent reference sequence | 2021 | 34632318 | |||
| 1478 | OMIA:001794-9940 | sheep | Romney (Sheep) | Cystic fibrosis | CFTR | deletion, small (<=20) | deletion (in-frame) | Genome-editing (CRISPR-Cas9) | Not currently evaluated | Oar_rambouillet_v1.0 | 4 | NC_040255.1:g.57218683_57218685del | NM_001009781.1:c.1518_1520del | NP_001009781.1:p.(F507del) | NM_001009781.1; NP_001009781.1; published as p.(F508del), coordinates are updated in this table to recent reference sequence | 2021 | 34632318 | |||
| 61 | OMIA:002072-9615 | dog | Old Danish Pointing Dog (Dog) | Myasthenic syndrome, congenital | CHAT | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 28 | NC_006610.3:g.1484906G>A | XM_005637485.3:c.85G>A | XP_005637542.1:p.(V29M) | XM_005637485.3; XP_005637542.1 | 2007 | 17586598 | 20181218 Thanks to Maarten de Groot for advising FN of the genomic location of this variant. | ||
| 838 | OMIA:002125-9913 | taurine cattle | Montbéliarde (Cattle) | Neurocristopathy | CHD7 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 14 | g.26402250_26402254del | p.(K594Afs*29) | 2017 | 28904385 | |||||
| 1691 | OMIA:002767-7957 | goldfish | Twin-tail | chordinA | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | p.(E127*) | 2014 | 24569511 | |||||||||
| 554 | OMIA:002022-9913 | taurine cattle | Red Dane (Cattle) | Arthrogryposis multiplex congenita, CHRNB1-related | CHRNB1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.27122027del | NM_174516.2:c.55del | NP_776941.1:p.(A19Pfs47*) | Published as Chr19:27757270CG > C; CHRNB1 c.55delG; (p.Ala19Profs47*) | rs5334474854 | 2016 | 27364156 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 490 | OMIA:000685-9915 | indicine cattle (zebu) | Brahman (Cattle) | Myasthenic syndrome, congenital, CHRNE-related | CHRNE | 470del20 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 19 | g.26485848_26485867del | c.470_489del | Kraner et al. (2002): "a loss of 20 bp within the coding sequence of exon 5 (Fig. 2), between nucleotide 469 and 490 (nucleotide numbering referring to the cDNA sequence published under accession number X02597". These authors (and subsequent authors) call this variant "470del20". The current (2020) HGVS nomenclature is c.470_489del 200922: g. information move here (g.27119615) until standardised | rs5334475050 | 2002 | 12481987 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||
| 614 | OMIA:000685-9615 | dog | Jack Russell Terrier (Dog) | Myasthenic syndrome, congenital, due to CHRNE | CHRNE | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 5 | NC_006587.3:g.31705136dup | XM_014113502.2:c.729dup | XP_013968977.2:p.(G244Rfs*274) | published as c.633_634insC, previously reported in OMIA as c.636_637insC; coordinates in the table updated to NCBI trancript IDs and in accordance to HGVS rules (3'-rule and reported as duplication) [27/08/2024] | 2015 | 26429099 | |||
| 804 | OMIA:000685-9615 | dog | Heideterrier (Dog) Smooth Fox Terrier (Dog) | Myasthenic syndrome, congenital, due to CHRNE | CHRNE | duplication | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 5 | NC_006587.3:g.31707450dup | XM_014113502.2:c.1508dup | XP_013968977.2:p.(S503Rfs*14) | published as Chr5:31,707,450_31,707,451insG, XM_014113502.1:c.1436_1437insG, XP_013968977.1:p.Ser479ArgfsTer14; in Heideterrier; information in the table updated to new transcript and in accordance with HGVS recommendations [27/08/2024]; for additional breed inforamtion see Pubmed:38853290 |
2017 | 28508416 | |||
| 1729 | OMIA:000685-9615 | dog | English Springer Spaniel (Dog) | Myasthenic syndrome, congenital, CHRNE-related | CHRNE | substitution | missense | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 5 | NC_049226.1:chr5:31915101C>A | XM_038536566.1:c.1509C>A | XP_038392494.1:p.(S503R) | reported in two affected dogs | 2024 | 38853290 | |||
| 1664 | OMIA:000698-9940 | sheep | Merino (Sheep) | Myotonia | CLCN1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v3.0 | 4 | NC_056057.1:g.107930611C>T | XM_004008136.5:c.844C>T | XP_004008185.4:p.(P282S) | rs3487175777 | 2024 | 39765607 | |||
| 224 | OMIA:000698-9925 | goat | Myotonia | CLCN1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS1.2 | 4 | NC_030811.1:g.13857007C>G | XM_013963554.2:c.2656G>C | XP_013819008.1:p.(A886P) | Previously listed in OMIA based on ENSEMBL Variant Effect Predictor: transcript ENSCHIT00000031898.1:c.2590G>C; p.(P864A); c. and p. updated based on NCBI transcript IDs [26/08/2024] | rs5334475115 | 1996 | 8855341 | |||
| 609 | OMIA:000698-9615 | dog | Australian Cattle Dog (Dog) Border Collie (Dog) | Myotonia | CLCN1 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 16 | NC_006598.3:g.6344748_6344749insT | NM_001003124.2:c.2647_2648insA | NP_001003124.1:p.(R883Qfs*18) | published as c.2665insA; p.(R889fs); coordinates in the table have been updated to a recent reference genome and / or transcript | 2007 | 17552451 | |||
| 1041 | OMIA:000698-9615 | dog | Labrador Retriever (Dog) | Myotonia | CLCN1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 16 | NC_006598.3:g.6348929T>A | NM_001003124.2:c.2275A>T | NP_001003124.1:p.(R759X) | published as "Chr16:6348929 T A CLCN1 ENSCAFG00000003619.3 stopgain" |
2018 | 29934119 | |||
| 62 | OMIA:000698-9615 | dog | Miniature Schnauzer (Dog) | Myotonia | CLCN1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 16 | NC_006598.3:g.6366383G>A | NM_001003124.2:c.803C>T | NP_001003124.1:p.(T268M) | 1999 | 10452529 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1364 | OMIA:000698-9615 | dog | American Bulldog (Dog) | Myotonia | CLCN1 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 16 | NC_006598.3:g.6369245_6369246insAGAG | NM_001003124.2:c.436_437insCTCT | NP_001003124.1:p.(Y146Sfs*49) | 2020 | 33246886 | ||||
| 1570 | OMIA:000698-9615 | dog | Mixed Breed (Dog) | Myotonia | CLCN1 | deletion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 16 | NC_006598.3:g.[6367458_6367478del;6367482del;6367485A>C] | NM_001003124.2:c.[703T>G;706del;710_730del] | NP_001003124.1:p.[(F235V;V236fs)] | published as c.[705T>G; 708del; 712_732del], coordinates in the table have been updated to the CanFam3.1 reference genome and reflect correction in PMID:37212506. |
2023 | 37212506 | |||
| 161 | OMIA:000698-9796 | domestic horse | New Forest Pony (Horse) | Myotonia | CLCN1 | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 4 | NC_009147.3:g.96518592A>C | XM_001915636.4:c.1775A>C | XP_001915671.3:p.(D592A) | c.1775A>C, Genbank acc. XM_001915636; p.D592A, Genbank acc. XP_001915671 (Wijnberg et al., 2014) | rs5334475185 | 2012 | 22197188 | (FN thanks Izabela De Assis Rocha, who provided genomic location in EquCab3.0 and the Genbank acc IDs, working under the supervision of Professor Ernie Bailey; 15 April 2020) Revised genomic location kindly provided by Cord Drögemüller; 21 May 2021 | |
| 1573 | OMIA:000698-9685 | domestic cat | Domestic Longhair (Cat) | Myotonia | CLCN1 | deletion, small (<=20) | frameshift | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | A2 | NC_058369.1:g.157186686_157186693del | NM_001305027.1:c.428_433+1del | NP_001291956.1:p.(L143Qfs3*) | published as chrA2:15897085‐15897092 | 2022 | 35815860 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1623 | OMIA:000698-9685 | domestic cat | Myotonia | CLCN1 | substitution | missense | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | A2 | NC_058369.1:g.157195914G>C | NM_001305027.1:c.991G>C | NP_001291956.1:p.(A331P) | 2023 | 37668104 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||||
| 408 | OMIA:000698-9685 | domestic cat | Myotonia | CLCN1 | substitution | splicing | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A2 | NC_058369.1:g.157205990G>T | NM_001305027.1:c.1930+1G>T | 2014 | 25356766 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||||
| 245 | OMIA:000698-9940 | sheep | Rasa Aragonesa, Spain (Sheep) | Myotonia | CLCN1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 4 | NC_040255.1:g.115541101G>A | XM_004008136.4:c.277G>A | XP_004008185.4:p.(E93K) | Oar_v3.1 position is g.106140081G>A published as p.Gln93Lys. | rs401726021 | 2015 | 25744800 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 1365 | OMIA:000698-9823 | pig | Myotonia | CLCN1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 18 | NC_010460.4:g.6912538_6916702del | 2019 | 31666547 | ||||||||
| 399 | OMIA:000698-89462 | water buffalo | Murrah (Buffalo) | Myotonia | CLCN1 | substitution | splicing | Naturally occurring variant | Not currently evaluated | UOA_WB_1 | 8 | NC_037552.1:g.106762128C>T | NM_001290916.1:c.396C>T | abnormal splicing associated with synonymous SNP (Ser132, c.396C>T) | 2013 | 23339992 | ||||
| 1678 | OMIA:000698-9615 | dog | French Bulldog (Dog) | Myotonia | CLCN1 | duplication | frameshift | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 16 | NC_049237.1:g.6074128_6074135dup | NM_001003124.2:c.2423_2430dup | NP_001003124.1:p.(F811Lfs*39) | 2024 | 38473107 | ||||
| 1757 | OMIA:000698-9615 | dog | Mixed Breed (Dog) | Myotonia | CLCN1 | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 16 | NC_049237.1:g.[6080653T>A;6080658_6080661delinsCCCGTT] | NM_001003124.2:c.[1636_1639delinsAACGGG;1644A>T] | NP_001003124.1:p.(C546Nfs*5) | 2024 | 39559538 | ||||
| 1783 | OMIA:002927-94885 | corn snake | Skin colour pattern, stripe | CLCN2 | insertion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | Scaffold 6 | p.(G203Efs*4) | insertion of a 5832-bp LTR-retrotransposon in the fifth intron of the CLCN2 gene - splicing of the retroposon results in a 397-bp insertion between exons 5 and 6 which introduces a premature stop codon after exon 5 (Montandon et al., 2025) | 2025 | 40140900 | |||||||
| 210 | OMIA:001887-9913 | taurine cattle | Belgian Blue (Cattle) | Osteopetrosis with gingival hamartomas | CLCN7 | haplotype | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 25 | g.[1139611G>T; 1139613A>G] | c.[2248T>C;2250C>A] | p.(Y750Q) | 2014 | 24159188 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |||
| 648 | OMIA:001135-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Renal dysplasia | CLDN16 | Type 1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 1 | 37kb deletion of exons 1-4 | 2000 | 10810088 | |||||||
| 781 | OMIA:001135-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Renal dysplasia | CLDN16 | Type 2 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 1 | "a 56-kb deletion that eliminates exons 1-4 and 21-bp of exon 5" 200922: g. info moved to here (g.77528017_?) until can be standardised | 2002 | 12047224 | Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | ||||||
| 1669 | OMIA:002432-9913 | taurine cattle | Hereford (Cattle) | Retinal degeneration, CLN3-realted | CLN3 | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 25 | NC_037352.1:g.26043843del | NM_001075174.2:c.1106del | NP_001068642.2:p.(P369Rfs*8) | NM_001075174.2; NP_001068642.2 | rs5377951844 | 2024 | 38516801 | ||
| 593 | OMIA:001482-9913 | taurine cattle | Devon (Cattle) | Neuronal ceroid lipofuscinosis, 5 | CLN5 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 12 | g.52112732_52112733insG | c.662_663insG | p.(R221Gfs*6) | 2006 | 16935476 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) 210909: after checking the genome assembly sequence, FN changed g.52461241insG to g.52461241_52461242insG; and c.662insG to c.662_663insG | |||
| 541 | OMIA:001482-9615 | dog | Golden Retriever (Dog) | Neuronal ceroid lipofuscinosis, 5 | CLN5 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 22 | g.30574953_30574954del | c.935_936del | p.(E312Vfs*6) | NM_001011556.1; NP_001011556.1,published as CLN5:c.934_935delAG; coordinates in the table have been updated to a recent reference genome and / or transcript | 2015 | 25934231 | Breed information obtained from Katz et al. (2017) Neurobiol Dis. doi: 10.1016/j.nbd.2017.08.017; Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. | ||
| 279 | OMIA:001482-9615 | dog | Australian Cattle Dog (Dog) Border Collie (Dog) | Neuronal ceroid lipofuscinosis, 5 | CLN5 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 22 | NC_006604.3:g.30574637C>T | NM_001011556.1:c.619C>T | NP_001011556.1:p.(Q207*) | rs1152388418 | 2005 | 16033706 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool 30 Dec 2020: g. coordinate corrected, with thanks to Angelica K Kallenberg | ||
| 389 | OMIA:001482-9940 | sheep | Borderdale, New Zealand (Sheep) | Neuronal ceroid lipofuscinosis, 5 | CLN5 | substitution | splicing | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 10 | NC_040261.1:g.56313269G>A | NM_001082595.1:c.571+1G>A | rs422165326 | 2008 | 17988881 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| 68 | OMIA:001443-9615 | dog | Australian Shepherd (Dog) | Neuronal ceroid lipofuscinosis, 6 | CLN6 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 30 | NC_006612.3:g.32247875A>G | NM_001011888.1:c.829T>C | NP_001011888.1:p.(W277R) | alternative coordinates: ROS_Cfam_1.0:g.32443458A>G ENSCAFT00845033654.1:c.829T>C ENSCAFP00845026347.1:p.Trp277Arg | rs1152388420 | 2011 | 21234413 | ||
| 1703 | OMIA:001443-9615 | dog | Mixed Breed (Dog) | Neuronal ceroid lipofuscinosis, 6 | CLN6 | substitution | splicing | Naturally occurring variant | Not currently evaluated | Dog10K_Boxer_Tasha | 30 | NC_006612.4:g.32185406C>T | 2024 | 38927597 | ||||||
| 1213 | OMIA:001443-9685 | domestic cat | Domestic Medium Hair (Cat) | Neuronal ceroid lipofuscinosis, 6 | CLN6 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B3 | NC_058373.1:g.37187417G>A | XM_003987007.6:c.668G>A | XP_003987056.1:p.(W223*) | published as ENSFCAT00000025909:c.668G>A; XM_003987007.5:c.668G>A | rs5334475122 | 2020 | 32518081 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 671 | OMIA:001443-9940 | sheep | South Hampshire, New Zealand (Sheep) | Neuronal ceroid lipofuscinosis | CLN6 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 7 | deletion of exon 1 | 2013 | 23338040 | |||||||
| 234 | OMIA:001443-9940 | sheep | Merino (Sheep) | Neuronal ceroid lipofuscinosis, 6 | CLN6 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 7 | NC_040258.1:g.16039510G>A | NM_001040289.1:c.184C>T | NP_001035379.1:p.(R62C) | protein and cDNA position based on NP_001035379.1 and NM_001040289.1, respectively | rs399747319 | 2006 | 17046213 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 1702 | OMIA:001443-9615 | dog | Schapendoes (Dog) | Neuronal ceroid lipofuscinosis, 6 | CLN6 | substitution | missense | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 30 | NC_049251.1:g.32682554A>G | XM_038580811.1:c.386T>C | XP_038436739.1:p.(L129P) | 2024 | 38866396 | ||||
| 1030 | OMIA:001962-9542 | Japanese macaque | Neuronal ceroid lipofuscinosis, 7 | CLN7 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | 4 | c.769delA | p.(I257Lfs*36) | 2018 | 30048804 | |||||||
| 690 | OMIA:001506-9615 | dog | Alpine Dachsbracke (Dog) | Neuronal ceroid lipofuscinosis, 8 | CLN8 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 37 | g.30852988_30902901del | c.-14679_*18669del | NM_001012343.1; a homozygous deletion encompassing the entire CLN8 gene | 2017 | 28024876 | g. information obtained from Katz et al. (2017) Neurobiol Dis. doi: 10.1016/j.nbd.2017.08.017 | ||||
| 971 | OMIA:001506-9615 | dog | Saluki (Dog) | Neuronal ceroid lipofuscinosis, 8 | CLN8 | insertion, small (<=20) | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 37 | g.30874636dupT | c.349dupT | p.(E117*) | "an insertion of 1 bp (T) in the CLN8 gene (Fig. S2) in a short T repeat, thereby changing the stretch of 9 T's to a stretch consisting of 10 T's. The exact position of the inserted base could obviously not be verified, given that this was an insertion of a single base in a stretch of nine repeats of the same base (CFA37:g.30874628–30874636). According to the recommended nomenclature, the T insertion was noted as a T duplication in the T farthest in the 3′ direction (g.30874636dupT; c.349dupT)" | 2018 | 29446145 | |||
| 69 | OMIA:001506-9615 | dog | English Setter (Dog) | Neuronal ceroid lipofuscinosis, 8 | CLN8 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 37 | NC_006619.3:g.30874779T>C | NM_001012343.1:c.491T>C | NP_001012343.1:p.(L164P) | 2005 | 15629147 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 338 | OMIA:001506-9615 | dog | Australian Shepherd (Dog) German Shorthaired Pointer (Dog) Huntaway (Dog) New Zealand Heading Dog (Dog) | Neuronal ceroid lipofuscinosis, 8 | CLN8 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 37 | NC_006619.3:g.30883950G>A | NM_001012343.1:c.585G>A | NP_001012343.1:p.(W195*) | NM_001012343: c.585G>A (Guo et al., 2014), Additional breeds based on PMID:40965331 | 2014 | 24953404 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; confirmed by Guo et al. (2019, pages 3, 4, 5 and 6), assuming that the g. coordinate (g.30,895,648) in the abstract of Guo et al. (2019) is a typo. | ||
| 431 | OMIA:000119-9685 | domestic cat | Blood group system AB | CMAH | substitution | regulatory | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B2 | NC_058372.1:g.4640833T>C | published as C-371T; the cat sequenced to create F.catus_Fca126_mat1.0 represents the T allele | 2007 | 17553163 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||||
| 1432 | OMIA:000119-9685 | domestic cat | Blood group system AB | CMAH | substitution | regulatory | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B2 | NC_058372.1:g.4640987G>A | published as G-217A, the cat sequenced to create F.catus_Fca126_mat1.0 represents the G allele | 2007 | 17553163 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||||
| 430 | OMIA:000119-9685 | domestic cat | Blood group system AB | CMAH | insertion, small (<=20) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B2 | NC_058372.1:g.4641133_4641151del | published as "an indel in the exon 1 5' UTR"; Delta-53; Felis_catus_9.0 represents the deletion allele: g.4934941_4934942insAACGAGCAACCGAAGCTG | 2007 | 17553163 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||||||
| 1431 | OMIA:000119-9685 | domestic cat | Blood group system AB | CMAH | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B2 | NC_058372.1:g.4641555C>T | NM_001244985.1:c.139C>T | NP_001231914.1:p.(R47C) | published as c.136C>T | 2014 | 24697343 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 118 | OMIA:000119-9685 | domestic cat | Blood group system AB | CMAH | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B2 | NC_058372.1:g.4641558A>G | NM_001244985.1:c.142G>A | NP_001231914.1:p.(V48M) | published as Felis_catus_6.2: B2:4587414G>A; c.139G>A; p.(V47M); F.catus_Fca126_mat1.0 represents the A allele while transcript NM_001244985.1 represents the G allele | rs5334475157 | 2007 | 17553163 | The genomic location on Felis_catus_9.0 is based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 800 | OMIA:000119-9685 | domestic cat | 2019 TYPING PANEL | CMAH | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B2 | NC_058372.1:g.4641595G>T | NM_001244985.1:c.179G>T | NP_001231914.1:p.(G60V) | rs5334475140 | 2016 | 27755584 | The genomic location on Felis_catus_9.0 was based on Rodney et al. 2021 (PMID: 33785770), updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 801 | OMIA:000119-9685 | domestic cat | Blood group system AB | CMAH | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B2 | NC_058372.1:g.4641603A>G | NM_001244985.1:c.187A>G | NP_001231914.1:p.(I63V) | 2016 | 27755584 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||||
| 119 | OMIA:000119-9685 | domestic cat | 2019 TYPING PANEL | CMAH | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B2 | NC_058372.1:g.4644950A>T | NM_001244985.1:c.268T>A | NP_001231914.1:p.(Y90N) | published as c.265T>A (2007); revised designation of c.268T>A was reported by Kehl et al. (2019); F.catus_Fca126_mat1.0 represents the A allele while transcript NM_001244985.1 represents the T allele. | rs5334475138 | 2007 | 17553163 | The genomic location on Felis_catus_9.0 is based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1446 | OMIA:000119-9685 | domestic cat | Blood group system AB | CMAH | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B2 | NC_058372.1:g.4653784C>A | NM_001244985.1:c.327A>C | NP_001231914.1:p.(E109D) | published as c.327A>C; variant is reported to be not causal for blood type B, but may impact Neu5GC levels (Omi et al.,2016). The Felis_catus_9.0 and F.catus_Fca126_mat1.0 reference genomes represent the C allele, while transcript NM_001244985.1 represents the A allele. |
2016 | 27171395 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 799 | OMIA:000119-9685 | domestic cat | Ragdoll (Cat) | 2019 TYPING PANEL | CMAH | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B2 | NC_058372.1:g.4653821.C>T | NM_001244985.1:c.364C>T | NP_001231914.1:p.(P122S) | rs5334475151 | 2016 | 27171395 | The genomic location on Felis_catus_9.0 is based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1413 | OMIA:000119-9685 | domestic cat | Blood group system AB | CMAH | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B2 | NC_058372.1:g.4659871G>A | NM_001244985.1:c.773G>A | NP_001231914.1:p.(R258Q) | 2021 | 34589535 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||||
| 1430 | OMIA:000119-9685 | domestic cat | Blood group system AB | CMAH | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B2 | NC_058372.1:g.4661662del | NM_001244985.1:c.933del | NP_001231914.1:p.(A312Hfs*6) | 2018 | 30235335 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||||
| 1062 | OMIA:000119-9685 | domestic cat | Ragdoll (Cat) | 2019 TYPING PANEL | CMAH | deletion, small (<=20) | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B2 | NC_058372.1:g.4685206del | NM_001244985.1:c.1322del | NP_001231914.1:p.(L441*) | published as c.1322delT | 2018 | 30235335 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 120 | OMIA:000119-9685 | domestic cat | Blood group system AB | CMAH | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B2 | NC_058372.1:g.4692013A>G | NM_001244985.1:c.1603G>A | NP_001231914.1:p.(D535N) | published as c.1600G>A; p.(D534N); F.catus_Fca126_mat1.0 represents the A allele while NM_001244985.1 represents the G allele | rs5334475141 | 2007 | 17553163 | The genomic location on Felis_catus_9.0 is based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 547 | OMIA:001977-9615 | dog | Shetland Sheepdog (Dog) | Progressive retinal atrophy, due to CNGA1 mutations | CNGA1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 13 | g.43831897_43831900del | c.1752_1755del | p.(T585Sfs*7) | NM_001003222.1; published as c.1752_1755delAACT | 2015 | 26202106 | Genomic and protein coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 548 | OMIA:001481-9615 | dog | Labrador Retriever (Dog) | Achromatopsia-2 | CNGA3 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 10 | g.44234198_44234200del | c.1931_1933del | p.(V644del) | NM_001301112.1; published as c.1931_1933delTGG | rs852784090 | 2015 | 26407004 | Genomic coordinates in CanFam3.1 and EVA ID provided by Robert Kuhn | |
| 97 | OMIA:001481-9615 | dog | German Shepherd Dog (Dog) | Achromatopsia-2 | CNGA3 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 10 | NC_006592.3:g.44234861G>A | NM_001301112.1:c.1270C>T | NP_001288041.1:p.(R424W) | Changed from NC_006592.3:g.44234861C>T to NC_006592.3:g.44234861G>A [09/06/2025] | 2015 | 26407004 | Genomic position in CanFam3.1 provided by Mateo Etcheveste. | ||
| 1016 | OMIA:001481-9940 | sheep | Awassi (Sheep) | Achromatopsia-2 (day blindness) | CNGA3 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 3 | NC_040254.1:g.108958871C>T | XM_027965914.1:c.1618G>A | XP_027821715.1:p.(G540S) | 2017 | 28282490 | Genomic coordinate on Oar_v4.0 (g.102602387G>A) kindly provided by Eyal Seroussi via Elisha Gootwine. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries. | |||
| 317 | OMIA:001481-9940 | sheep | Awassi (Sheep) | Achromatopsia-2 (day blindness) | CNGA3 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oori1 scaffold00739 | 3 | g.263324C>T | c.706C>T | p.(R236*) | In a pers. comm. to FN via Elisha Gootwine, Eyal Seroussi advises that the Oar_v4.0 assembly has errors in the region of of this mutation, such that it cannot be mapped onto that assembly. It can, however, be mapped on to the Ovis aries musimon sequence: "Exon 8 mutation is at position 263,324 in Ovis aries musimon unplaced genomic scaffold, alternate assembly Oori1 scaffold00739 (Sequence ID: NW_011942977.1 Length: 1056687)" | 2010 | 19874885 | |||
| 918 | OMIA:002723-9615 | dog | Papillon (Dog) Phalène (Dog) | Progressive retinal atrophy | CNGB1 | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 2 | g.58622673_58622675delinsCTAGCTAC | c.2387_2389delinsCTAGCTAC | p.(Y796Sfs*7) | NM_001284462.1; NP_001271391.1; published as c.2685delA2687_2688insTAGCTA and p.(Y889Sfs*5); coordinates in the table have been updated to a recent reference genome and / or transcript and updated to HGVS recommendations | rs1152388403 | 2013 | 24015210 | ||
| 631 | OMIA:001365-9615 | dog | Alaskan Malamute (Dog) Miniature Australian Shepherd Dog (Dog) | Achromatopsia (cone degeneration, hemeralopia), AMAL | CNGB3 | cd^AMAL | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 29 | "deletion removing all exons of canine CNGB3" | 2002 | 12140185 | |||||||
| 1400 | OMIA:001365-9913 | taurine cattle | Brown Swiss (Cattle) Original Swiss Brown (Cattle) | Achromatopsia | CNGB3 | OH1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 14 | NC_037341.1:g.76011964G>A | XM_015474554.2:c.751G>A | XP_015330040.2:p.(D251N) | XM_015474554.2: c.751G>A, XP_015330040.2: p.Asp251Asn ENSBTAT00000065296.2:c.751G>A ENSBTAP00000054173.2:p.Asp251Asn | rs716218235 | 2021 | 34830323 | |
| 27 | OMIA:001365-9615 | dog | German Shorthaired Pointer (Dog) | Achromatopsia (cone degeneration, hemeralopia), GSPT | CNGB3 | cd^GSPT | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 29 | NC_006611.3:g.32837065C>T | NM_001003030.1:c.784G>A | NP_001003030.1:p.(D262N) | 2002 | 12140185 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool 30 Dec 2020 Chromosome corrected, thanks to Angelica K Kallenberg | ||
| 1502 | OMIA:002591-9615 | dog | Dalmatian (Dog) | Lysosomal storage disease, CNP-related | CNP | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Dog10K_Boxer_Tasha | 9 | g.20350240del | c.1107del | p.(K370Nfs*11) | ENSCAFT00000102206 | 2022 | 35447247 | |||
| 1680 | OMIA:002591-9615 | dog | Weimaraner (Dog) | Lysosomal storage disease, CNP-related | CNP | substitution | missense | Naturally occurring variant | Not currently evaluated | Dog10K_Boxer_Tasha | 9 | NC_006591.4:g.20355460G>A | XM_844467.6:c.125C>T | XP_849560.2:p.(T42M) | XM_844467.6; XP_849560.2; NC_006591.4 | 2024 | 38397235 | |||
| 1273 | OMIA:002301-9615 | dog | Great Dane (Dog) Labrador Retriever (Dog) Leonberger (Dog) New Zealand Heading Dog (Dog) Pyrenean Shepherd (Dog) Saint Bernard (Dog) | Laryngeal paralysis and polyneuropathy | CNTNAP1 | LPPN3 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | NC_006591.3:g.20298261C>T | XM_548083.6:c.2810G>A | XP_548083.3:p.(G937E) | XM_548083.6:c.2810G>A; XP_548083.3:p.Gly937Glu; variant initially identified in Labrador Retriever, Leonberger and Saint Bernard and later reported in a Pyrenean Shepherd (PMID:37582787) and Great Danes (PMID:40622077) | rs24587752 | 2020 | 33261176 | |
| 172 | OMIA:001718-9823 | pig | Dwarfism, Schmid metaphyseal chondrodysplasia | COL10A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 1 | NC_010443.5:g.81767089C>T | NM_001005153.1:c.1768G>A | NP_001005153.1:p.(G590R) | rs5334475171 | 2000 | 11130976 | The genomic and CDS position was determined by Stephanie Shields and the effect was confirmed with Ensembl VEP (27/05/2020) | |||
| 1795 | OMIA:001718-8090 | Japanese medaka | Skeletal defects, col10a1a-related | col10a1a | deletion, small (<=20) | frameshift | Genome-editing (CRISPR-Cas9) | Not currently evaluated | p.(C633fs) | 5 base pair deletion | 2024 | 38510140 | ||||||||
| 1657 | OMIA:002811-9615 | dog | Old English Sheepdog (Dog) | Multiocular defect | COL11A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 6 | g.47611886T>C | c.1775T>C | p.(F1592S) | 2023 | 38153936 | ||||
| 78 | OMIA:001772-9615 | dog | Labrador Retriever (Dog) | Skeletal dysplasia 2 (SD2) | COL11A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 12 | NC_006594.3:g.2652874C>G | XM_538855.5:c.143G>C | XP_538855.2:p.(R48P) | ROS_Cfam_1.0:g.2983602C>G ENSCAFT00845034709.1:c.143G>C ENSCAFP00845027184.1:p.Arg48Pro | rs851399084 | 2013 | 23527306 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 1634 | OMIA:002793-9685 | domestic cat | American Shorthair (Cat) | Epidermolysis bullosa, junctional, COL17A1-related | COL17A1 | deletion, small (<=20) | splicing | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | D2 | NC_058378.1:g.62124169del | XM_006938156.5:c.3019+1del | variant reported in a single affected cat | 2023 | 37895184 | ||||
| 1635 | OMIA:002793-9685 | domestic cat | European Shorthair (Cat) | Epidermolysis bullosa, junctional, COL17A1-related | COL17A1 | substitution | splicing | Naturally occurring variant | LP | F.catus_Fca126_mat1.0 | D2 | NC_058378.1:g.62149308C>T | XM_006938156.5:c.769+5G>A | XP_006938218.3:p.(V257Gfs*82) | variant described in a single affected cat | 2023 | 37895184 | |||
| 1873 | OMIA:002793-9685 | domestic cat | Domestic Shorthair (Cat) | Epidermolysis bullosa, junctional, COL17A1-related | COL17A1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | D2 | NC_058378.1:g.62154566_62154567del | XM_006938156.5:c.414_415del | XP_006938218.3:p.(S141fs) | Published as chrD2:62154563, a 2-bp deletion in exon 7 / COL17A1:c.415–416. Information in this table has been updated to a recent reference genome and the HGVS 3' rule. Variant reported in a single affected cat. | 2026 | 41588668 | |||
| 839 | OMIA:002127-9913 | taurine cattle | Simmental (Cattle) | Osteogenesis imperfecta, type II, COL1A1-related | COL1A1 | delins, small (<=20) | delins (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 19 | g.36470764_36470767delinsT | c.3145_3148delinsT | p.(A1049_P1050delinsS) | UMD3.1 position is g.37101299_37101302delinsT; cDNA position based on ENSBTAT00000017420.4 | rs876049195 | 2017 | 28904385 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 1031 | OMIA:002127-9913 | taurine cattle | Red Angus (Cattle) | Osteogenesis imperfecta, type II, COL1A1-related | COL1A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.36463798G>A | NM_001034039.2:c.1063G>A | NP_001029211.1:p.(G355S) | Petersen et al. (2019): "PolyPhen-2 predicted the mutation to be “probably damaging” with a score of 1.000 (sensitivity 0.00; specificity 1.00). Similarly, PROVEAN prediction classified the variant as “Deleterious” with a score of − 4.615, exceeding both the default (− 2.5) and stringent (− 4.1) thresholds for this classification." The genomic coordinate in the UMD3.1 assembly is g.37094333G>A (Petersen et al., 2019). The coding sequence coordinates are c.1063G>A (ENSBTAT00000017420.4) (Petersen, pers. comm.) | rs3423092630 | 2019 | 30788588 | ||
| 1289 | OMIA:002127-9913 | taurine cattle | Holstein (black and white) (Cattle) | Osteogenesis imperfecta, type II, COL1A1-related | COL1A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.36473359T>A | NM_001034039.2:c.3917T>A | NP_001029211.1:p.(V1306E) | NM_001034039.2: c.3917T>A; XP_024835395.1: p.Val1306Glu (Jacinto et al., 2021) | rs5334474947 | 2021 | 33672767 | ||
| 1698 | OMIA:002127-9913 | taurine cattle | Normande (Cattle) | Osteogenesis imperfecta, type II, COL1A1-related | COL1A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.36473965G>A | NM_001034039.2:c.4234G>A | NP_001029211.1:p.(D1412N) | 2024 | 38773368 | ||||
| 1838 | OMIA:002127-9940 | sheep | Charollais (Sheep) | Osteogenesis imperfecta, type II | COL1A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v2.0 | 11 | NC_056064.1:g.36197409G>A | XM_027974705.2:c.1189G>A | XP_027830506.1:p.(G397S) | 2025 | 40999323 | ||||
| 959 | OMIA:002126-9615 | dog | Golden Retriever (Dog) | Osteogenesis imperfecta, type III, COL1A1-related | COL1A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | NC_006591.3:g.26193593C>G | NM_001003090.1:c.1145G>C | NP_001003090.1:p.(G382A) | NM_001003090.1; NP_001003090.1; published as c.1276G>C, p.(G208A); coordinates in the table have been updated to a recent reference genome and / or transcript | rs1152388502 | 2000 | 11147834 | ||
| 1837 | OMIA:002112-9913 | taurine cattle | Stabiliser, United Kingdom of Great Britain and Northern Ireland (Cattle) | Osteogenesis imperfecta | COL1A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 4 | NC_037331.1:g.11792118G > A | NM_174520.2:c.1156G > A | NP_776945.1:p.(G386R) | 2025 | 40999323 | ||||
| 762 | OMIA:002112-9615 | dog | Beagle (Dog) | Osteogenesis imperfecta, COL1A2-related | COL1A2 | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 14 | g.(19918265_19918268delinsTGTCATTGG) | c.3656_3859delinsTGTCATTGG | p.(L1286Cfs*31) | NM_001003187.1; NP_001003187.1; "a mutation in which nucleotides 3991-3994 ("CTAG") were replaced with "TGTCATTGG." The first seven bases of the inserted sequence were identical to nucleotides 4002-4008 of the normal canine COL1A2 sequence. The resulting frameshift changed 30 amino acids and introduced a premature stop codon." The genomic information is presented in brackets as the variant was detected in cDNA and the genomic position is predicted. Coordinates in the table have been updated to a recent reference genome and or transcripts. | 2001 | 11393792 | |||
| 1114 | OMIA:002112-9615 | dog | Lagotto Romagnolo (Dog) | Osteogenesis imperfecta, COL1A2-related | COL1A2 | duplication | duplication (in-frame) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 14 | g.19898279_19898281dup | c.877_879dup | p.(P293dup) | NM_001003187.1; NP_001003187.1 | 2019 | 31468557 | |||
| 852 | OMIA:002112-9615 | dog | Chow Chow (Dog) | Osteogenesis imperfecta, COL1A2-related | COL1A2 | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 14 | NC_006596.3:g.19898487G>A | NM_001003187.1:c.936+1G>A | 2018 | 29036614 | |||||
| 1275 | OMIA:001926-9913 | taurine cattle | Holstein Friesian (Cattle) | Bulldog calf | COL2A1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 5 | g.32301911_32308589del | "Sanger sequencing revealed the precise breakpoints of the heterozygous deletion from position 32 301 911 located in intron 25 to 32 308 589 located within exon 45. The 6679 bp deletion includes the entire sequence of 18 exons (26–44) plus the first 36 nucleotides of exon 45" (Jacinto et al., 2020) | 2021 | 33316082 | ||||||
| 840 | OMIA:001926-9913 | taurine cattle | Charolais (Cattle) Salers (Cattle) | Bulldog calf | COL2A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.32301746G>A | NM_001001135.3:c.1799G>A | NP_001001135.2:p.(G600D) | previously listed in OMIA as c.1791G>A, updated to reflect recent transcript inforamtion [03/09/2024] | rs5334474917 | 2017 | 28904385 | ||
| 1241 | OMIA:001926-9913 | taurine cattle | Holstein Friesian (Cattle) | Bulldog calf | COL2A1 | delins, gross (>20) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.32303127_32306640delinsTCTGGGGAGC | deletion encompassing 10 of the 54 coding exons of COL2A1 | 2020 | 32894162 | ||||||
| 842 | OMIA:001926-9913 | taurine cattle | Holstein Friesian (Cattle) | Bulldog calf | COL2A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.32303739G>A | NM_001001135.3:c.2158G>A | NP_001001135.2:p.(G720S) | rs455596159 | 2017 | 28904385 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 414 | OMIA:001926-9913 | taurine cattle | Danish Holstein (Cattle) | bulldog calf | COL2A1 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.32305226G>A | NM_001001135.3:c.2463+1G>A | rs5334475095 | 2016 | 27296271 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 223 | OMIA:001926-9913 | taurine cattle | Holstein Friesian (Cattle) | Bulldog calf | COL2A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.32307658G>A | NM_001001135.3:c.2878G>A | NP_001001135.2:p.(G960R) | rs3423194986 | 2014 | 25017103 | |||
| 841 | OMIA:001926-9913 | taurine cattle | Holstein Friesian (Cattle) | Bulldog calf | COL2A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.32308008G>A | NM_001001135.3:c.2986G>A | NP_001001135.2:p.(G996S) | rs876243579 | 2017 | 28904385 | |||
| 1026 | OMIA:001926-9913 | taurine cattle | Holstein Friesian (Cattle) | Bulldog calf | COL2A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.32308734G>A | NM_001001135.3:c.3166G>A | NP_001001135.2:p.(G1056S) | rs5334475093 | 2019 | 30378686 | |||
| 1835 | OMIA:001926-9913 | taurine cattle | Holstein Friesian (Cattle) | Achondrogenesis | COL2A1 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.32312706_32312717del | NM_001001135.3:c.4432_4443del | NP_001001135.2:p.(G1478_I1481del) | 2025 | 40999323 | ||||
| 1836 | OMIA:001926-9940 | sheep | Charollais (Sheep) | Achondrogenesis type II | COL2A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v2.0 | 3 | NC_056056.1:g.138610131G > A | XM_042246797.1:c.2908G > A | XP_042102731.1:p.(G970S) | 2025 | 40999323 | ||||
| 1889 | OMIA:001926-9823 | pig | Achondrogenesis, type II | COL2A1 | haplotype | frameshift | Genome-editing (CRISPR-Cas9) | Not currently evaluated | Sscofa11.1 | 5 | NC_010447.5:g.[78361637del];[78361641C>T] | XM_021092611.1:c.[1744G>A];[1749del] | XP_020948270.1:p.[(G582S)];[(D584fs)] | 2020 | 32450343 | |||||
| 278 | OMIA:002618-9615 | dog | English Springer Spaniel (Dog) | Nephropathy | COL4A4 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 25 | NC_006607.3:g.39893376G>A | NM_001031818.1:c.2713C>T | NP_001026988.1:p.(Q905*) | NM_001031818.1; NP_001026988.1; published as c.2806C>T and p.(Q904*) | 2012 | 22369189 | |||
| 277 | OMIA:002618-9615 | dog | English Cocker Spaniel (Dog) | Nephropathy | COL4A4 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 25 | NC_006607.3:g.39953906T>A | NM_001031818.1:c.115A>T | NP_001026988.1:p.(K39*) | 2007 | 17552442 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 471 | OMIA:001112-9615 | dog | Navasota (mixed breed) (Dog) | Nephritis, X-linked | COL4A5 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | g.82134508_82134517del | c.513_522del | p.(N172Ifs) | XM_005640969.3; XP_005641026.1; a 10 base pair (TAATCCAGGA) deletion in exon 9 of COL4A5 | 2003 | 12879362 | |||
| 276 | OMIA:001112-9615 | dog | Samoyed (Dog) | Nephritis, X-linked | COL4A5 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | NC_006621.3:g.82196868G>T | NM_001002979.1:c.3079G>T | NP_001002979.1:p.(G1027*) | 1994 | 8171024 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1124 | OMIA:002165-9615 | dog | Labrador Retriever (Dog) | Ehlers-Danlos syndrome, classic type, 1 | COL5A1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | NC_006591.3:g.50806169del | XM_022423936.1:c.3038del | XP_022279644.1:p.(G1013Vfs*260) | XM_022423936.1; XP_022279644.1; published as c.3038delG - "variant arose by a de novo mutation event during the development of the mother." (Bauer et al., 2019) | 2019 | 31546637 | |||
| 1125 | OMIA:002165-9615 | dog | Mixed Breed (Dog) | Ehlers-Danlos syndrome, classic type, 1 | COL5A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | NC_006591.3:g.50832936G>A | XM_022423936.1:c.4711G>A | XP_022279644.1:p.(G1571R) | XM_022423936.1,c.4711G>A; XP_022279644.1,p.(Gly1571Arg) | 2019 | 31546637 | |||
| 1722 | OMIA:002165-9615 | dog | Golden Retriever (Dog) | Ehlers-Danlos syndrome, classic type 1 | COL5A1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Dog10K_Boxer_Tasha | 9 | NC_006591.4:g.50091843C>T | XM_038615652.1:c.2512C>T | XP_038471580.1:p.(R838*) | ENSCAFT00000031582.6:c.2500C>T, p.(Arg834Ter) | 2024 | 39175162 | |||
| 1719 | OMIA:002165-9615 | dog | Mixed Breed (Dog) | Ehlers-Danlos syndrome, classic type 1 | COL5A1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Dog10K_Boxer_Tasha | 9 | NC_006591.4:g.50109824del | XM_038615652.1:c.3371del | XP_038471580.1:p.(E1124Lfs*364) | ENSCAFT00000031582.6:c.3360del, p.(E1121Lfs*364) | 2024 | 39175162 | |||
| 1721 | OMIA:002165-9615 | dog | Dachshund, Miniature (Dog) | Ehlers-Danlos syndrome, classic type 1 | COL5A1 | duplication | frameshift | Naturally occurring variant | Not currently evaluated | Dog10K_Boxer_Tasha | 9 | NC_006591.4:g.50111993dup | XM_038615652.1:c.3675dup | XP_038471580.1:p.(G1226Rfs*62) | Published as g.50111986insC, ENSCAFT00000031582.6:c.3663_3664insC, p.(Gly1222Argfs*62). Coordinates in this table have been adjusted in accordance with the HGVS recommendations. | 2024 | 39175162 | |||
| 1720 | OMIA:002165-9615 | dog | Scottish Terrier (Dog) | Ehlers-Danlos syndrome, classic type 1 | COL5A1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Dog10K_Boxer_Tasha | 9 | NC_006591.4:g.50114284del | XM_038615652.1:c.3908del | XP_038471580.1:(P1303Rfs*186) | Published as g.50114279delC; ENSCAFT00000031582.6:c.3891del; p.(P1299Rfs*186). Coordinates in this table have been adjusted in accordance with the HGVS 3'rule. | 2024 | 39175162 | |||
| 1724 | OMIA:002165-9615 | dog | German Shepherd Dog (Dog) | Ehlers-Danlos syndrome, classic type 1 | COL5A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Dog10K_Boxer_Tasha | 9 | NC_006591.4:g.50116228G>A | XM_038615652.1:c.4117G>A | XP_038471580.1:p.(G1373R) | ENSCAFT00000031582.6:c.4105G>A, p.(Gly1369Arg) | 2024 | 39175162 | |||
| 1723 | OMIA:002165-9615 | dog | Beagle (Dog) | Ehlers-Danlos syndrome, classic type 1 | COL5A1 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | Dog10K_Boxer_Tasha | 9 | NC_006591.4:g.50131170_50131172del | XM_038615652.1:c.5320_5322del | XP_038471580.1:p.(G1774del) | Published as chr9:50131166delGAG, ENSCAFT00000031582.6:c.5296_5298del, p.(Glu1766del). Coordinates in this table have been adjusted in accordance with the HGVS 3'rule. | 2024 | 39175162 | |||
| 1465 | OMIA:002165-9685 | domestic cat | Bombay (Cat) | classical Ehlers-Danlos syndrome | COL5A1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | D4 | NC_058380.1:g.93614145T>A | XM_023242950.2:c.3517A>T | XP_023098718.2:p.(K1173*) | published as c.3514A>T; p.(Lys1172*) | 2022 | 35627182 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1025 | OMIA:002165-9685 | domestic cat | Domestic Shorthair (Cat) | classical Ehlers-Danlos syndrome | COL5A1 | deletion, small (<=20) | frameshift | Naturally occurring variant | LP/P | F.catus_Fca126_mat1.0 | D4 | NC_058380.1:g.93615144del | XM_023242950.2c.3423del | XP_023098718.2:p.(L1142Sfs*134) | published as c.3420delG, HGVS 3' rule applied to g. coordinates | 2018 | 30246406 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1466 | OMIA:002165-9685 | domestic cat | Domestic Shorthair (Cat) | classical Ehlers-Danlos syndrome | COL5A1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | D4 | NC_058380.1:g.93620291del | XM_023242950.2:c.3069del | XP_023098718.2:p.(G1024Vfs*50) | published as c.3066del, p.(Gly1023Valfs*50) | 2022 | 35627182 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1609 | OMIA:002165-9685 | domestic cat | Domestic Medium Hair (Cat) | classical Ehlers-Danlos syndrome | COL5A1 | substitution | splicing | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | D4 | NC_058380.1:g.93694436T>G | XM_023242950.2:c.504-2A>C | r.spl | published as c.501-2A>C | 2023 | 37594181 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1464 | OMIA:002165-9685 | domestic cat | Bengal (Cat) | classical Ehlers-Danlos syndrome | COL5A1 | deletion, gross (>20) | splicing | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | D4 | NC_058380.1:g.93735408_93735429del | XM_023242950.2:c.115_121+15del | r.spl | published as c.112_118+15del, Felis_catus_9.0 coordinates previously listed in OMIA as g.93331577_93331598del were incorrect and should have been g.93331575_93331596del (corrected with change to F.catus_Fca126_mat1.0, 22/06/2025) | 2022 | 35627182 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1696 | OMIA:002165-9685 | domestic cat | Maine Coon (Cat) | classical Ehlers-Danlos syndrome | COL5A1 | deletion, gross (>20) | Naturally occurring variant | P | F.catus_Fcat126_mat1.0 | D4 | NC_058380.1:g.93561989_93595728del | deletion of 33740 base pairs including the last two exons of COL5A1 | 2024 | 38745376 | ||||||
| 1859 | OMIA:002165-9615 | dog | Maltese (Dog) | Ehlers-Danlos syndrome, classic type 1 | COL5A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 9 | NC_049230.1:g.50854306G>A | XM_038548863.1:c.2228G>A | XP_038404791.1:p.(G743E) | 2025 | 41472142 | ||||
| 1263 | OMIA:002295-9913 | taurine cattle | Holstein (black and white) (Cattle) | Ehlers-Danlos syndrome, classic type, 2 | COL5A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.7331916G>T | XM_024979774.1:c.2366G>T | XP_024835542.1:p.(G789V) | XM_024979774.1: c.2366G>T; XP_024835542.1: p.Gly789Val (Jacinto et al., 2020) | rs5334475045 | 2020 | 33143196 | ||
| 1460 | OMIA:002295-9615 | dog | Chihuahua (Dog) | Ehlers-Danlos syndrome, classic type, 2 | COL5A2 | deletion, gross (>20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 36 | g.30548697_30548723del | c.3388_3414del | p.(Lys1130_Asp1138del) | XM_005640393.3; XP_005640450.1 | 2022 | 35627319 | |||
| 340 | OMIA:001967-9615 | dog | Landseer (Dog) | Muscular dystrophy, Ullrich type | COL6A1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 31 | NC_006613.3:g.39303964G>T | XM_003434001.5:c.289G>T | XP_003434049.2:p.(E97*) | XM_003434001.5; XP_003434049.2; previously incorrectly listed in this table as c.289C>T; p.(Q97*) - corrected 8/2/2022 | 2015 | 26438297 | |||
| 1184 | OMIA:002260-9913 | taurine cattle | Holstein Friesian (Cattle) | de novo mutation in an AI sire | COL6A3 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 3 | NC_037330.1:g.116826597G>A | XM_024990262.1:c.5675C>T | XP_024846030.1:p.(T1892M) | Bourneuf et al. (2017) detected COL6A3 g.117453719G>A; p.T1894M as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Holstein AI bull. No information was provided on the descendants of this bull. p. coordinates have been updated to reflect recent NCBI transcript [29/08/2024]. | rs5334475059 | 2017 | 28904385 | ||
| 1625 | OMIA:002274-9615 | dog | American Staffordshire Terrier (Dog) | Muscular dystrophy, COL6A3-related | COL6A3 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 25 | g.48005972del | c.6398del | p.(P2133Rfs*109) | NM_001103215.1; NP_001096685.1; published as g.48287602CG>C in CanFam4 | 2023 | 37706358 | |||
| 1208 | OMIA:002274-9615 | dog | Labrador Retriever (Dog) | Muscular dystrophy, COL6A3-related | COL6A3 | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 25 | NC_006607.3:g.48007994C>T | NM_001103215.1:c.6210+1G>A | NM_001103215.1; CanFam3.1 chr25:48,007,994C > T; NM_001103215.1 c.6210 + 1G > A (Bolduc et al., 2020) | 2020 | 32439203 | ||||
| 1207 | OMIA:002274-9615 | dog | Labrador Retriever (Dog) | Muscular dystrophy, COL6A3-related | COL6A3 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 25 | NC_006607.3:g.48014962G>A | NM_001103215.1:c.4726C>T | NP_001096685.1:p.(R1576*) | NM_001103215.1; NP_001096685.1; CanFam3.1 chr25:48,014,962G > A; NM_001103215.1 c.4726C > T, p.R1576* (Bolduc et al., 2020) | 2020 | 32439203 | |||
| 292 | OMIA:000341-9913 | taurine cattle | Rotes Höhenvieh, Germany (Cattle) Vorderwälder, Germany (Cattle) | Epidermolysis bullosa, dystrophic | COL7A1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 22 | g.51301158C>T | c.4762C>T | p.(R1588*) | rs876174537 | 2012 | 22715415 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed and some variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1276 | OMIA:000341-9615 | dog | Basset Hound (Dog) | Epidermolysis bullosa, dystrophic | COL7A1 | complex rearrangement | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 20 | g.[40524302_40524308del;40524267_40524380dup] | c.[2028_2034del;1993_2050+56dup] | p.(V677Sfs*11) | NM_001002980.1; NP_001002980.1; complex duplication event spanning parts of exon 15 and intron 15 of the COL7A1 gene, starting at position 40,524,267 and ending at 40,524,380 on chromosome 20 (CanFam3.1 assembly) (Garcia et al., 2020). | 2020 | 33291836 | |||
| 357 | OMIA:000341-9615 | dog | Central Asian Shepherd Dog (Dog) | Epidermolysis bullosa, dystrophic | COL7A1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 20 | NC_006602.3:g.40532043C>T | XM_022406202.1:c.4579C>T | XP_022261910.1:p.(R1527*) | 2017 | 28493971 | Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool | |||
| 38 | OMIA:000341-9615 | dog | Golden Retriever (Dog) | Epidermolysis bullosa, dystrophic | COL7A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 20 | NC_006602.3:g.40538034G>A | XM_022406202.1:c.5716G>A | XP_022261910.1:p.(G1906S) | rs1152388417 | 2003 | 12874109 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 641 | OMIA:001523-9615 | dog | Samoyed (Dog) | Oculoskeletal dysplasia 2 | COL9A2 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 15 | a 1,267 bp deletion that eliminates part of the 5’UTR, all of exon 1 and part of intron 1 | 2010 | 20686772 | ||||||||
| 581 | OMIA:001522-9615 | dog | Labrador Retriever (Dog) | Oculoskeletal dysplasia 1 | COL9A3 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 24 | g.46653422_46653423insG | c.10_11insG | p.(A4Gfs*46) | NM_001197171.1; NP_001184100.1; published as "a 1-base insertion (guanine) in exon 1 that changes a string of four guanines (CFA24: 49,699,847–49,699,850; CanFam2) to a string of five guanines (c.7–10insG). ... (p.A4GX46)" Goldstein et al. (2010). Information in this table has been changed in accordance to HGVS 3'rule and updated to the current reference genome. | 2010 | 20686772 | |||
| 1092 | OMIA:001522-9615 | dog | Northern Inuit Dog (Dog) | Oculoskeletal dysplasia 1 | COL9A3 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 24 | NC_006606.3:g.46660067C>T | NM_001197171.1:c.700C>T | NP_001184100.1:p.(R234*) | 2019 | 31415586 | ||||
| 944 | OMIA:001621-9685 | domestic cat | Devon Rex (Cat) Sphynx (Cat) | Muscular dystrophy-dystroglycanopathy (limb-girdle) | COLQ | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | C2 | NC_058376.1:g.132511706C>T | XM_003992132.4:c.1190G>A | XP_003992181.2:p.(C397Y) | rs869320615 | 2015 | 26327126 26374066 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 643 | OMIA:001988-9615 | dog | Bedlington Terrier (Dog) | Wilson disease, COMMD1 type | COMMD1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 10 | deletion "breakpoints were positioned at 65.3091 and 65.3489 Mb of dog chromosome 10, in intron 1 and intron 2 of COMMD1 respectively, a deletion of 39.7 kb" | 2005 | 16293123 | ||||||||
| 1545 | OMIA:002667-9031 | chicken | Feather colour, Inhibitor of gold | COMTD1 | IG | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | GRCg6a | 6 | g.15675521_15675522insCT | c.747_748insCT | p.(Q250fs) | XM_015288295.1; XP_015143781.1 | 2023 | 37068079 | |||
| 215 | OMIA:001529-9913 | taurine cattle | Holstein Friesian (Cattle) | Dominant red | COPA | DR^DR | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 3 | NC_037330.1:g.9361962C>T | NM_001105645.1:c.478C>T | NP_001099115.1:p.(R160C) | rs3423151160 | 2017 | 28904385 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 1506 | OMIA:001274-452646 | American mink | Coat colour, black crystal | COPA | substitution | missense | Naturally occurring variant | Not currently evaluated | NNQGG.v01 | FNWR01000261.1 | g.4876673G>A | c.478C>T | p.(R160C) | 2022 | 35729186 | |||||
| 1012 | OMIA:002159-9694 | tiger | Golden tiger | CORIN | substitution | missense | Naturally occurring variant | Not currently evaluated | c.1759C>T | p.(H587Y) | 2017 | 28281538 | ||||||||
| 1456 | OMIA:002159-9685 | domestic cat | Siberian (Cat) | Extreme sunshine (Siberian recessive extreme wideband) | CORIN | vwb^eSIB | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.165054640G>A | XM_019829551.3:c.839G>A | XP_019685110.2:p.(C280Y) | reported as Genbank ID ON355336 | 2022 | 35574714 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 1313 | OMIA:002159-9685 | domestic cat | Siberian (Cat) | Sunshine (golden) | CORIN | vwb^SIB | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.165124736C>T | XM_019829551.3:c.2383C>T | XP_019685110.2:p.(R795C) | 2021 | 33970502 | Genomic position in Felis_catus_9.0 provided by Joshua Khamis. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1463 | OMIA:002159-9685 | domestic cat | British Shorthair (Cat) | Copper (British recessive wideband) | CORIN | vwb^BSH | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.165124778C>T | XM_019829551.3:c.2425C>T | XP_019685110.2:p.(R809*) | 2022 | 35703390 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1807 | OMIA:001403-9986 | rabbit | Chronic pancreatitis, susceptibility to | CPA1 | substitution | missense | Base-editing | Not currently evaluated | OryCun2.0 | 7 | NC_013675.1:g.14267750A>G | XM_008258192.2:c.580T>C | XP_008256414.1:p.(S194P) | published as p.(S282P) based on human coordinates | 2025 | 40383969 | ||||
| 358 | OMIA:002111-9913 | taurine cattle | Holstein (red and white) (Cattle) | Cataract, recessive, CPAMD8-related | CPAMD8 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 7 | NC_037334.1:g.6073556C>T | XM_015471929.2:c.220C>T | XP_015327415.2:p.(Q74*) | rs5334474964 | 2017 | 28683140 | |||
| 1418 | OMIA:002519-9913 | taurine cattle | Brown Swiss (Cattle) | Haplotype with homozygous deficiency BH24 | CPT1C | BH24 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 18 | NC_037345.1:g.56098048G>A | XM_002695120.5:c.158G>A | XP_002695166.2:p.(G53D) | XM_002695120.5 | rs719328437 | 2021 | 34915862 | |
| 1428 | OMIA:002533-9685 | domestic cat | Domestic Shorthair (Cat) | Osteogenesis imperfecta | CREB3L1 | deletion, small (<=20) | frameshift | Naturally occurring variant | LP/P | F.catus_Fca126_mat1.0 | D1 | NC_058377.1:g.98384181_98384182del | XM_003993204.5:c.370_371del | XP_003993253.2:p.(C124Lfs) | published as c.370_371delTG | 2022 | 35168412 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 916 | OMIA:000881-9685 | domestic cat | Abyssinian (Cat) | Rod-cone dysplasia | CRX | Rdy | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | E2 | NC_058382.1:g.9492897del | XM_045045412.1:c.546del | XP_044901347.1:p.(P185Lfs*2) | published as CRX: n.546delC; in the Felis_catus_9.0 assembly the CRX gene is duplicated and genomic coordinates in this table are given for a more recent reference genome | 2010 | 20053974 | ||
| 1491 | OMIA:001643-10036 | golden hamster | duper | Cry1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | c.578del | p.(P193fs) | published as c.578delC | 2022 | 35471909 | |||||||
| 1176 | OMIA:000168-10141 | domestic guinea pig | Cataract | Cryz | deletion, gross (>20) | splicing | Naturally occurring variant | Not currently evaluated | "a 102-bp deletion towards the 3' end of the coding region. This deletion does not interfere with the reading frame but results in a protein 34 amino acids shorter." (Rodriguez et al., 1992) | 1992 | 1390943 | |||||||||
| 692 | OMIA:000852-9925 | goat | Casein, alpha-S1, reduced concentration | CSN1S1 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 6 | "a 457-bp insertion within exon 19 (last untranslated exon). This insert is a truncated long interspersed repeated element (LINE) containing part of the ORF-2, the 3' UTR and the poly(A) tail of the original retroposon." | 1994 | 7926797 | |||||||||
| 907 | OMIA:001623-9925 | goat | Casein, alpha-S2, absence | CSN1S2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS1.2 | 6 | NC_030813.1:g.86085134G>A | NM_001285585.1:c.374G>A | NP_001272514.1:p.W125* | published as as AJ131465 c.763G>A and p.(T110*), publication identifies that the codon changed is 'TGG' coding for tryptophan (W) - information in the table updated to recent transcript [04/10/2024] | rs268293093 | 2001 | 11419340 | The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries | ||
| 220 | OMIA:002033-9913 | taurine cattle | A2 milk | CSN2 | A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 6 | g.85451298T>G | c.245A>C | p.(H82P) | Note that cattle cannot be genotyped for the A2 allele solely on the basis of the c.245A>C variant because this variant is common to 4 other alleles; see Table 2 of Caroli et al. (2009) J. Dairy Sci. 92, 5335-5352 (Matt McClure, pers. comm.) | rs43703011 | 2013 | 23102962 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 1312 | OMIA:001424-9925 | goat | Absence of β‐casein | CSN2 | CSN2^0 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS1.2 | 6 | NC_030813.1:g.86008404del | XM_013964699.2:c.295del | XP_013820153.1:p.I99Sfs*10 | Changed from g.86008401del to g.86008404del to adhere to the HGVS 3’rule [22/01/10]' previously listed as ENSCHIT00000032661.1:c.175del ENSCHIP00000024801.1:p.Ile59SerfsTer10; update to NCBI transcript information [04/10/24]; Persuy et al. (1999): "allele CSN2^O had a one-nucleotide deletion in the 5' end of exon 7, which introduces a premature stop codon. The open reading frame of allele CSN2^O encodes a shortened polypeptide of 72 amino acids, compared to 223 amino acids for caprine pre beta-casein A." | rs645737170 | 1999 | 10612234 | ||
| 1311 | OMIA:001424-9925 | goat | Absence of β‐casein | CSN2 | CSN2^01 | substitution | regulatory | Naturally occurring variant | Not currently evaluated | ARS1.2 | 6 | NC_030813.1:g.86015651A>G | Cosenza et al. (2016): "nucleotide C .... negatively affects the promoter activity of the CSN2 gene" Synonyms: dbSNP ss1245869815 | rs654545998 | 2007 | 17931404 | The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries | |||
| 1186 | OMIA:002262-9913 | taurine cattle | Montbéliarde (Cattle) | de novo mutation in an AI sire | CSNK1G2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 7 | g.44265842G>C | p.(D164H) | Bourneuf et al. (2017) detected Chr7 CSNK1G2 g.45885860G>C; p.D164H as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Montbéliarde AI bull. No information was provided on the descendants of this bull. | rs5334475073 | 2017 | 28904385 | |||
| 66 | OMIA:001505-9615 | dog | American Bulldog (Dog) | Neuronal ceroid lipofuscinosis, 10 | CTSD | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 18 | NC_006600.3:g.46013354C>T | NM_001025621.1:c.597G>A | NP_001020792.1:p.(M199I) | 2006 | 16386934 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 905 | OMIA:001505-9940 | sheep | Roslagsfår, Sweden (Sheep) | Neuronal ceroid lipofuscinosis, 10 | CTSD | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 21 | NC_040272.1:g.51583020G>A | XM_027959254.1:c.883G>A | XP_027815055.1:p.(D295N) | published as c.934G>A; protein and cDNA positions in this table based on XP_027815055.1 and XM_027959254.1, respectively | 2000 | 10856224 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1517 | OMIA:002607-9685 | domestic cat | Domestic Longhair (Cat) | Pyknodysostosis | CTSK | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | C1 | NC_058375.1:g.105446558G>A | XM_045033477.1:c.724C>T | XP_044889412.1:p.(R242*) | variant is reported in a single affected cat | 2022 | 36532681 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 529 | OMIA:001786-9615 | dog | Beagle (Dog) | Intestinal cobalamin malabsorption due to CUBN mutation | CUBN | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 2 | NC_006584.3:g.19796293del | NM_001003148.1:c.786del | NP_001003148.1:p.(D262Efs*47) | NM_001003148.1; NP_001003148.1; deletion C | rs1152388404 | 2014 | 24164695 | ||
| 447 | OMIA:001786-9615 | dog | Border Collie (Dog) New Zealand Heading Dog (Dog) | Intestinal cobalamin malabsorption due to CUBN mutation | CUBN | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 2 | NC_006584.3:g.19974334del | NM_001003148.1:c.8392del | NP_001003148.1:p.(Q2798Rfs*3) | NM_001003148.1; NP_001003148.1; deletion C; additional breeds based on PMID:40965331 | 2013 | 23613799 | |||
| 1036 | OMIA:001786-9615 | dog | Komondor (Dog) | Intestinal cobalamin malabsorption, CUBN-related | CUBN | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 2 | NC_006584.3:g.19981457G>A | NM_001003148.1:c.8746+1G>A | NM_001003148.1 | 2018 | 30591068 | ||||
| 287 | OMIA:001697-9913 | taurine cattle | Jersey (Cattle) | Abortion due to haplotype JH1 | CWC15 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 15 | NC_037342.1:g.15449431C>T | NM_001046399.2:c.163C>T | NP_001039864.1:p.(R55*) | UMD3.1 position is g.15707169C>T, cDNA and protein positions based on XM_005215764.2 | rs1115118696 | 2013 | 23349982 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 1700 | OMIA:002131-9615 | dog | Mixed Breed (Dog) | Methaemoglobinaemia, CYB5R3-related | CYB5R3 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 10 | NC_006592.3:22836975A>G | NM_001048084.1:c.604A>C | NP_001041549.1:p.(T202A) | reported in a single dog | 2020 | 33293645 | |||
| 1699 | OMIA:002131-9615 | dog | American Pit Bull Terrier (Dog) Mixed Breed (Dog) | Methaemoglobinaemia, CYB5R3-related | CYB5R3 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 10 | NC_006592.3:22841895G>C | NM_001048084.1:c.656G>C | NP_001041549.1:p.(R219P) | 2020 | 33293645 | ||||
| 850 | OMIA:002131-9615 | dog | Mixed Breed (Dog) | Methaemoglobinaemia, CYB5R3-related | CYB5R3 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 10 | NC_006592.3:g.22832963G>A | NM_001048084.1:c.226G>A | NP_001041549.1:p.(G76S) | Published as g.22832963G>A, c.214G>A. Coordinates had been updated to 10:22,832,962G>A, c.227G>A, p.Gly76Ser based on Table 1, Jaffey et al. (2020). After review of the genome browser, coordinates were changed to g.22832963G>A, c.226G>A [09/06/2025]. Reported in a single dog. | 2017 | 28963729 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 967 | OMIA:002131-9615 | dog | Chihuahua (Dog) Mixed Breed (Dog) Pomeranian (Dog) Rat Terrier (Dog) | Methaemoglobinaemia, CYB5R3-related | CYB5R3 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 10 | NC_006592.3:g.22836951A>C | NM_001048084.1:c.580A>C | NP_001041549.1:p.(I194L) | NM_001048084.1; NP_001041549.1 | 2018 | 29356095 | Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. | ||
| 1155 | OMIA:002131-9685 | domestic cat | Domestic Shorthair (Cat) | Methaemoglobinaemia, CYB5R3-related | CYB5R3 | substitution | missense | Naturally occurring variant | LP/P | F.catus_Fca126_mat1.0 | B4 | NC_058374.1:g.135602485C>T | XM_045062469.1:c.547G>A | XP_044918404.1:p.(G183S) | published as "p.Gly209Ser amino acid change in transcript CYB5R3-202 (ENSFCAT00000056925) at position B4:137967506", c. and p. coordinates have been updated to reflect recent transcript and protein inforamtion [08/07/2025] | 2019 | 31650629 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1548 | OMIA:002131-9685 | domestic cat | Domestic Shorthair (Cat) | Methaemoglobinaemia, CYB5R3-related | CYB5R3 | substitution | splicing | Naturally occurring variant | LP/P | F.catus_Fca126_mat1.0 | B4 | NC_058374.1:g.135605715C>T | XM_045062469.1:c.226+5G>A | two transcripts were observed in the cat with the splice variant resulting in two predicted protein variants: XP_044918404.1:p.(G76_Q77insERSPDPARVEPG) and XP_044918404.1:p.(V52Afs*58) | 2023 | 37048064 | ||||
| 1156 | OMIA:002131-9685 | domestic cat | Domestic Shorthair (Cat) | Methaemoglobinaemia, CYB5R3-related | CYB5R3 | substitution | splicing | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | B4 | NC_058374.1:g.135605793C>G | XM_045062469.1:c.154-1G>C | published as a splice acceptor variant at c.232-1G>C in the CYB5R3-202 transcript (ENSFCAT00000056925) at position B4:137970815, c. coordinates updated to reflect recent transcript information [08/07/2025] | 2019 | 31650629 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 1751 | OMIA:000017-8128 | Nile tilapia | Steroid hormone-deprived sex reversal, CYP11A1-related | cyp11a1 | deletion, gross (>20) | Genome-editing (CRISPR-Cas9) | Not currently evaluated | 22 bp deletion in exon 4 | 2024 | 39284885 | ||||||||||
| 629 | OMIA:000017-9986 | rabbit | Adrenal hyperplasia, congenital | CYP11A1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | "a large deletion mutation in the P450scc gene" | 1993 | 7682938 | ||||||||||
| 117 | OMIA:001661-9685 | domestic cat | Adrenal hyperplasia, congenital, due to 11-beta hydroxylase deficiency | CYP11B1 | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | F2 | NC_058385.1:g.81965422G>A | XM_004000154.4:c.1151G>A | XP_004000203.1:p.(R384Q) | published as "a guanosine-to-adenosine mutation in exon 7 that results in an arginine to glutamine amino acid substitution | 2012 | 22827537 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 720 | OMIA:000452-9031 | chicken | Campine (Chicken) Sebright Bantams, United Kingdom of Great Britain and Northern Ireland (Chicken) | Henny feathering | CYP19A1 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | GRCg6a | 10 | g.9683879_9683880insN[7524] | The insertion is 7524bp and "contains an intact endogenous retrovirus that was not found in chickens representing 31 different breeds not showing henny feathering or in samples of the ancestral red junglefowl. The sequence shows over 99% sequence identity to the avian leukosis virus ev-1 and ev-21 strains, suggesting a recent integration. The ERV 3’LTR, containing a powerful transcriptional enhancer and core promoter with TATA box together with binding sites for EFIII and Ig/EBP inside the CYP19A1 5′ untranslated region" (Li et al., 2019) | 1991 | 1939054 | Genomic location and size of the insertion provided by Li et al. (2019) | |||||
| 274 | OMIA:001405-9615 | dog | Beagle (Dog) Huntaway (Dog) New Zealand Heading Dog (Dog) | Metabolizer of a cognitive enhancer | CYP1A2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 30 | NC_006612.3:g.37821686C>T | NM_001008720.1:c.1117C>T | NP_001008720.1:p.(R373*) | Additional breeds based on PMID:40965331 | rs852922442 | 2004 | 15564884 | Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool | |
| 1251 | OMIA:002288-9913 | taurine cattle | Hereford (Cattle) | Mandibulofacial dysostosis | CYP26C1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 26 | g.14404993T>C | c.563T>G | p.(L188P) | ENSBTAT00000056396.3:c.563T>G; ENSBTAP00000050244.2:p.Leu188Arg | rs431913023 | 2020 | 33105751 | ||
| 502 | OMIA:000837-9685 | domestic cat | Domestic Shorthair (Cat) | Vitamin D-deficiency rickets, type IA | CYP27B1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Currently unresolved | F.catus_Fca126_mat1.0 | B4 | NC_058374.1:g.84034173del | XM_003988966.4:c.731del | XP_003989015.2:p.(R244Pfs*32) | published as c.731delG | 2009 | 19138382 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 315 | OMIA:000837-9685 | domestic cat | Siamese (Cat) | Vitamin D-deficiency rickets, type IA | CYP27B1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B4 | NC_058374.1:g.84034267C>A | XM_003988966.4:c.637G>T | XP_003989015.2:p.(E213*) | rs5334475145 | 2012 | 22553308 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 656 | OMIA:000837-9823 | pig | Vitamin D-deficiency rickets, type I | CYP27B1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 5 | NM_213995.1:c.952_1124del | the first of two deletions (173 bp or 329 bp) in the cDNA for cytochromome P450C1 (otherwise known as CYP27B1), | 2003 | 12915218 | |||||||
| 657 | OMIA:000837-9823 | pig | Vitamin D-deficiency rickets, type I | CYP27B1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 5 | NM_213995.1:c.952_1279del | the second of two deletions (173 bp or 329 bp) in the cDNA for cytochromome P450C1 (otherwise known as CYP27B1) | 2003 | 12915218 | |||||||
| 1576 | OMIA:000837-9615 | dog | Pug (Dog) | Vitamin D-deficiency rickets, type IA | CYP27B1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 10 | NC_049231.1:g.2182971G>T | XM_038549826.1:c.261C>A | XP_038405754.1:p.(Y87*) | XM_038549826.1; XP_038405754.1 | 2023 | 37293695 | |||
| 1411 | OMIA:002508-9913 | taurine cattle | Simmental (Cattle) | Haplotype with homozygous deficiency SH8 | CYP2B6 | SH8 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 18 | NC_037345.1:g.50296371A>T | NM_001075173.1:c.938T>A | NP_001068641.1:p.(I313N) | NM_001075173.1 | rs5352006042 | 2021 | 34944310 | |
| 1137 | OMIA:002221-9685 | domestic cat | Domestic Shorthair (Cat) | Vitamin D-deficiency rickets, type Ib | CYP2R1 | deletion, small (<=20) | frameshift | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | D1 | NC_058377.1:g.71033344del | XM_003993015.6:c.1386del | XP_003993064.1:p.(F462Lfs*20) | genomic position in accordance with HGVS 3'-rule | 2019 | 30777056 | Genomic position in Felis_catus_9.0 provided by Joshua Khamis. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 52 | OMIA:002684-9615 | dog | Australian Cattle Dog (Dog) Shetland Sheepdog (Dog) | Leucodystrophy | CYTB | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | M | m.14474G>A | c.14474G>A | p.(V98M) | 2006 | 16026996 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1743 | OMIA:002894-10036 | golden hamster | Dcaf17 deficiency | Dcaf17 | deletion, small (<=20) | frameshift | Genome-editing (CRISPR-Cas9) | Not currently evaluated | BCM_Maur_2.0 | NW_024429189.1:g.39589667_39589671del | XM_040745545.1:c.71_75del | XP_040601479.1:p.(D24Gfs*24) | 2024 | 39239833 | ||||||
| 784 | OMIA:001986-9823 | pig | Severe combined immunodeficiency disease, autosomal, T cell-negative, B cell-negative, NK cell-positive, with sensitivity to ionizing radiation | DCLRE1C | substitution | splicing | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 10 | NC_010452.4:g.46845535G>A | XM_021063988.1:c.678+1G>A | rs5334475180 | 2015 | 26320255 | |||||
| 785 | OMIA:001986-9823 | pig | Severe combined immunodeficiency disease, autosomal, T cell-negative, B cell-negative, NK cell-positive, with sensitivity to ionizing radiation | DCLRE1C | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 10 | NC_010452.4:g.46851262G>A | XM_021063988.1:c.800G>A | XP_020919647.1:p.(Trp267*) | rs5334475181 | 2015 | 26320255 | ||||
| 167 | OMIA:000735-9796 | domestic horse | Belgian Draft (Horse) Connemara Pony (Horse) Haflinger (Horse) Noric (Horse) Rocky Mountain Horse (Horse) Warmblood (Horse) Welsh Pony (Horse) | Ocular squamous cell carcinoma | DDB2 | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 12 | NC_009155.3:g.11726667C>T | XM_023654000.1:c.1013C>T | XP_023509768.1:p.(T338M) | The EquCab2 coordinates, obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool, are g.11608667, c.1013C>T and p.T338M | rs1139682898 | 2017 | 28425625 | The EquCab3 g. coordinates were provided by by Meredith O’Connell, working under the guidance of Professor Ernie Bailey, 5 March 2019. Breed information updated based on PMID: 38600096; 40218305 | |
| 1624 | OMIA:002582-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Hepatic fibrinogen storage disease | DGKG | substitution | missense | Genome-editing (CRISPR-Cas9) | Not currently evaluated | ARS-UCD1.3 | 1 | NC_037328.1:g.81082187C>T | XM_002684869.5:c.2162C>T | XP_002684915.3:p.T721I | XM_002684869.5; XP_002684915.3 | 2023 | 37681469 | |||
| 1335 | OMIA:002377-8845 | swan goose | Lion Head (Goose (domestic)) Sichuan White, China (Goose (domestic)) | Knob, basal | DIO2 | substitution | missense | Naturally occurring variant | Not currently evaluated | AnsCyg_PRJNA183603_v1.0 | NW_013185827.1 | g.642923G>A | p.(P265L) | 2021 | 34193033 | |||||
| 565 | OMIA:002095-9615 | dog | Rhodesian Ridgeback (Dog) | Epilepsy, generalized myoclonic, with photosensitivity | DIRAS1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 20 | g.56474668_56474671del | c.564_567del | p.(D189Afs*11) | XM_005633100.3; XP_005633157.1; published as DIRAS1:c.564_567delAGAC | 2017 | 28223533 | Genomic and protein coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 1412 | OMIA:002505-9913 | taurine cattle | Simmental (Cattle) | Haplotype with homozygous deficiency SH5 | DIS3 | SH5 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 12 | g.47511687_47511687insT | c.2032dup | p.(I678Nfs*2) | NP_025000110.1, XM_025000110.1 | 2021 | 34944310 | ||
| 1308 | OMIA:001484-9685 | domestic cat | Abyssinian (Cat) Burmese (Cat) Maine Coon (Cat) Oriental Shorthair (Cat) | Ticked | DKK4 | Ti^CK | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.40428846C>T | XM_023252567.2:c.53C>T | XP_023108335.2:p.(A18V) | rs5334475164 | 2021 | 33780570 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 1307 | OMIA:001484-9685 | domestic cat | Abyssinian (Cat) | Ticked | DKK4 | Ti^A | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.40429492G>A | XM_023252567.2:c.188G>A | XP_023108335.2:p.(C63Y) | published as g.41621481G>A | rs785541575 | 2021 | 33780570 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. |
| 914 | OMIA:001354-9940 | sheep | Rambouillet (Sheep) | Muscular hypertrophy (double muscling), Callipyge | DLK1 | substitution | regulatory | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v3.0 | 18 | NC_056071.1:g.63330265A>G | "a single A/G polymorphism located at position 103,894 of GenBank AF354168 and position 267 of the GenBank STS AF401294" (Freking et al., 2002) "the CLPG mutation, an A to G transition in a highly conserved dodecamer motif located in the 90-Kb intergenic region separating the Delta-like 1 homologue (DLK1) and Gene trap locus 2 (GTL2) genes in the eponymous imprinted domain" (Xu et al., 2015; PubMed 26474044) In relation to the Oar_v4.0/oviAri4 genome assembly, the location of the causative SNP is OAR18:g.64294536A>G (Ross Tellam, pers. comm. to FN 5 Nov 2020) | rs10721113 | 2002 | 12368241 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries. | |||
| 615 | OMIA:002109-9913 | taurine cattle | Brown Swiss (Cattle) | Tricho-dento-osseous-like syndrome | DLX3 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 19 | g.36665831_36665832insGGAGCACA | c.584_585insGGAGCACAGG | p.(S198Rfs*99) | NM_001081622 position is g.37298375_37298376insGGAGCACA | rs5334475096 | 2017 | 28670783 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 728 | OMIA:001919-9615 | dog | Nova Scotia Duck Tolling Retriever (Dog) | Cleft palate 1 | DLX6 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 14 | g.22068082_22068083insN[2056] | "2056 bp insertion [including LINE1] . . within a highly conserved region of DLX6 intron 2 at cfa14.25016716"[CanFam2.0] | 2014 | 24699068 | ||||||
| 680 | OMIA:001081-9615 | dog | German Shorthaired Pointer (Dog) | Muscular dystrophy, Duchenne type | DMD | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | X | a "deletion encompassing the entire dystrophin [DMD] gene" | 1999 | 10407848 | ||||||||
| 681 | OMIA:001081-9615 | dog | Tibetan Terrier (Dog) | Muscular dystrophy, Duchenne type | DMD | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | X | "a large deletion of exons 8-29" | 2012 | 22218699 | ||||||||
| 729 | OMIA:001081-9615 | dog | Labrador Retriever (Dog) | Muscular dystrophy, Duchenne type | DMD | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | X | "184 nucleotide [pseudoexon] insertion between exon 19 and exon 20, which results in a premature stop codon at the next codon downstream of the insertion" | 2007 | 22218699 Reference not in PubMed; see OMIA 001081-9615 for reference details | ||||||||
| 1395 | OMIA:001081-9823 | pig | Duchenne muscular dystrophy | DMD | DMD^ex52del | delins, gross (>20) | Transgenesis via somatic cell nuclear transfer (SCNT) | Not currently evaluated | X | gene targeting and somatic cell nuclear transfer was used to replace DMD exon 52 with a neomycin resistance cassette | 2013 | 23784375 | ||||||||
| 989 | OMIA:001081-9615 | dog | Poodle, Miniature (Dog) | Muscular dystrophy, Duchenne type | DMD | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | X | "a >5 Mb deletion on the X chromosome, encompassing the entire DMD gene" | 2018 | 29474464 | ||||||||
| 536 | OMIA:001081-9615 | dog | Cocker Spaniel (Dog) | Muscular dystrophy, Duchenne type | DMD | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | X | deletion of four nucleotides in exon 65, with a reading frame shift predicting a premature stop codon at the site of the deletion | 2012 | 22218699 | |||||||
| 922 | OMIA:001081-9685 | domestic cat | Domestic Shorthair (Cat) | Muscular dystrophy, Duchenne type | DMD | deletion, gross (>20) | Naturally occurring variant | P | X | A deletion of the muscle promoter and first exon and the Purkinje neuronal first exon of the DMD gene | 1994 | 7881288 | ||||||||
| 923 | OMIA:001081-9685 | domestic cat | Domestic Shorthair (Cat) | Muscular dystrophy, Duchenne type | DMD | deletion, gross (>20) | Naturally occurring variant | LP/P | X | A large deletion that "involved regions of the dystrophin gene that are poorly characterized, including the cortical neuronal promoter and its first exon and the skeletal neuronal promoter and its first exon" | 2014 | 24446404 | ||||||||
| 957 | OMIA:001081-9615 | dog | Rottweiler (Dog) | Muscular dystrophy, Duchenne type | DMD | not known | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | X | "nonsense mutation in exon 58" | 1994 | Reference not in PubMed; see OMIA 001081-9615 for reference details | |||||||
| 562 | OMIA:001081-9615 | dog | Cavalier King Charles Spaniel (Dog) | Muscular dystrophy, Duchenne type | DMD | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | g.27442996_27443002del | c.6057_6063del | p.(N2021Pfs) | NM_001003343.1; NP_001003343.1; published as c.6051_6057delTCTCAAT based on different transcript | 2016 | 28028563 | |||
| 542 | OMIA:001081-9615 | dog | Norfolk Terrier (Dog) | Muscular dystrophy, Duchenne type | DMD | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | g.27606021del | c.3084delG | p.(G1029Nfs*30) | 2015 | 26401335 | ||||
| 1249 | OMIA:001081-9615 | dog | Jack Russell Terrier (Dog) | Duchenne-type muscular dystrophy | DMD | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | g.27615280_27982912del | c.94-10346_2807-6207del | XM_005641029.1 | 2020 | 33049940 | |||||
| 1234 | OMIA:001081-9615 | dog | Labrador Retriever (Dog) | Labrador Retriever muscular dystrophy (LRMD) | DMD | inversion | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | g.27622834_29823788inv | c.-1490357_2626-947inv | XM_005641029.1 | 2020 | 32767978 | |||||
| 1235 | OMIA:001081-9615 | dog | Border Collie (Dog) | Muscular dystrophy, Duchenne | DMD | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | g.27626466del | c.2841delT | 2018 | 29843823 | ||||||
| 750 | OMIA:001081-9615 | dog | Japanese Spitz (Dog) | Muscular dystrophy, Duchenne type | DMD | inversion | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | g.27631972_33069482inv | c.-4736051_2384-5339inv | XM_005641029.1; "an inversion of a 5.4-Mb fragment of the X chromosome, with one break point (BP1) in the DMD gene . . . and a second break point (BP2) in a gene farther toward the centromere, the RPGR gene". | 2015 | 25644216 | |||||
| 708 | OMIA:001081-9615 | dog | Pembroke Welsh Corgi (Dog) | Muscular dystrophy, Duchenne type | DMD | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | g.27721607_27721608insN[(4800)] | "a long interspersed repetitive element-1 (LINE-1) insertion in intron 13, which introduced a new exon containing an in-frame stop codon" | 2011 | 20714321 | ||||||
| 1492 | OMIA:001081-9615 | dog | Labrador Retriever (Dog) | Muscular dystrophy, Duchenne type | DMD | duplication | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | g.27851768_28247504dup | Shelton et al. (2022): "chrX:27,851,768-27,852,122 bp position (Intron 7 . . .) and chrX:28,247,150-28,247,504 bp position (Intron 1 . . .)" | 2022 | 36041985 | ||||||
| 367 | OMIA:001081-9615 | dog | Cavalier King Charles Spaniel (Dog) | Muscular dystrophy, Duchenne type | DMD | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | NC_006621.3:g.26956239C>T | NM_001003343.1:c.7294+5G>T | NP_001003343.1; experimentally confirmed splice defect; a single nucleotide variant in the 5'-splice site of intron 51 that results in skipping of exon 50 in mRNA transcripts and a predicted premature truncation of the translated protein. Changed from NC_006621.3:g.26956239G>A to NC_006621.3:g.26956239C>T [09/06/2025] | 2010 | 20072625 | ||||
| 1236 | OMIA:001081-9615 | dog | Australian Labradoodle (Dog) | Australian Labradoodle dystrophinopathy | DMD | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | NC_006621.3:g.27621845G>A | NM_001003343.1:c.2668C>T | NP_001003343.1:p.(R890*) | NM_001003343.1; NP_001003343.1; "a C to T transition at base pair 43 in exon 21 of the dystrophin gene" (Shrader et al., 2018) | 2018 | 30286978 | |||
| 366 | OMIA:001081-9615 | dog | Golden Retriever (Dog) | Muscular dystrophy, Duchenne type | DMD | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | NC_006621.3:g.27926946T>C | NM_001003343.1:c.531-2A>G | NM_001003343.1; a point mutation in the consensus splice acceptor site in exon 6 , such that exon 7 is skipped | rs1152388423 | 1992 | 1577476 | |||
| 1684 | OMIA:001888-9685 | domestic cat | Kinkalow (Cat) | Muscular dystrophy, X-linked | DMD | substitution | nonsense (stop-gain) | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | X | NC_058380.1:g.27099390G>A | XM_045050794.1:c.8467C>T | XP_044906729.1:p.(Q2823*) | likely de novo mutation reported in a single cat | 2024 | 38613437 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1667 | OMIA:001888-9685 | domestic cat | Domestic Shorthair (Cat) | Muscular dystrophy, X-linked | DMD | substitution | nonsense (stop-gain) | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | X | NC_058386.1:g.27110574C>T | XM_045050794.1:c.8333G>A | XP_044906729.1:p.(W2778*) | 2024 | 38415938 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 1898 | OMIA:001888-9685 | domestic cat | Domestic Shorthair (Cat) | Muscular dystrophy, X-linked | DMD | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | X | NC_058386.1:g.27875713T>C | XM_045050787.1:c.6287A>G | XP_044906722.1:p.(Q2096R) | Published as ENSFCTP00005038844.1:c.2207T>C (p.(Q736R) - coordinates updated in this table to NCBI transcript. Variant reported in a single cat. | 2026 | 42072044 | |||
| 1656 | OMIA:001081-9685 | domestic cat | Domestic Shorthair (Cat) | Muscular dystrophy, Duchenne type | DMD | substitution | nonsense (stop-gain) | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | X | NC_058386.1:g.27949145C>T | XM_045050794.1:c.4849C>T | XP_044906729.1:p.(Q1617*) | |
2024 | 38180235 | |||
| 1531 | OMIA:001888-9685 | domestic cat | Maine Coon (Cat) | Becker muscular dystrophy | DMD | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | X | NC_058386.1:g.27988938G>A | XM_045050787.1:c.4186C>T | XP_044906722.1:p.(H1396Y) | 2023 | 36834603 | ||||
| 1510 | OMIA:001081-9685 | domestic cat | Maine Coon (Cat) | Muscular dystrophy, Duchenne type | DMD | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | X | NC_058386.1:g.28208148G>A | XM_045050794.1:c.1180C>T | XP_044906729.1:p.(R394*) | rs7111000092 | 2022 | 36359052 | |||
| 1714 | OMIA:001081-9615 | dog | Border Collie (Dog) | Muscular dystrophy, X-linked | DMD | insertion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | ROS_Cfam_1.0 | X | NC_051843.1:g.26431863_26431864insN[162] | NM_001003343.1:c.9271_9272insN[162] | NP_001003343.1:p.(A3091fs*21) | likely de-novo variant present in a single affected dog | 2024 | 39152696 | |||
| 1457 | OMIA:001888-9823 | pig | Becker muscular dystrophy | DMD | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | X | Aihara et al. (2022): "Analysis of dystrophin mRNA showed a 62 base pair insertion between exons 26 and 27. The insertion was derived from intron 26." | 2022 | 35220848 | ||||||||
| 179 | OMIA:001685-9823 OMIA:001888-9823 | pig | Stress syndrome | DMD | substitution | missense | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | X | NC_010461.5:g.28309227G>A | XM_021079545.1:c.5872C>T | XP_020935204.1:p.(R1958W) | Ensembl VEP was used to identify cDNA position in transcript ENSSSCT00000089893.1, SIFT score 0.01 | rs196952080 | 2012 | 22691118 | |||
| 1615 | OMIA:001081-9615 | dog | Brittany Spaniel (Dog) | Muscular dystrophy, Duchenne | DMD | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | X | RSPYR1 retrogene insertion in intron 20; reported in a single dog; reported in a single dog | 2023 | 37628610 | |||||||
| 1616 | OMIA:001081-9615 | dog | French Bulldog (Dog) | Muscular dystrophy, Duchenne | DMD | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | X | g.27774668_27774669insT | c.3371_3372insA | p.(F1125fs) | NM_001003343.1; NP_001003343.1; published as p.(F1125*), reported in a single dog | 2023 | 37628610 | |||
| 1858 | OMIA:001081-9615 | dog | Shiba Inu (Dog) | Muscular dystrophy, X-linked | DMD | deletion, gross (>20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | X | NC_049260.1:28139503_28156189del | NP_001003343.1:p.(V89_Q119del) | "~17 kb deletion that encompasses exon 5 of DMD" | 2025 | 41300820 | ||||
| 1614 | OMIA:001081-9615 | dog | Brittany Spaniel (Dog) | Muscular dystrophy, Duchenne | DMD | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | X | NC_049260.1:g.26939052G>A | NM_001003343.1:c.8059C>T | NP_001003343.1:p.(Q2687*) | NM_001003343.1; NP_001003343.1; reported in 2 related dogs | 2023 | 37628610 | |||
| 1744 | OMIA:001081-9615 | dog | Entlebucher Mountain Dog (Dog) | Muscular dystrophy, Duchenne type | DMD | duplication | frameshift | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | X | NC_049260.1:g.27027497_27,036112dup8616 | NM_001003343.1:c.7528-4048_7645+4450dup | NP_001003343.1:p.(I2549Sfs*3) | 2024 | 39307576 | ||||
| 908 | OMIA:001542-9940 | sheep | Corriedale (Sheep) | Hypophosphatemic rickets, autosomal recessive, 1 | DMP1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 6 | NC_040257.1:g.112910614C>T | XM_012180327.3:c.433C>T | XP_012035717.1:p.(R145*) | Published as g.112213795C>T / c.250C>T. Protein and cDNA positions in this table are based on XP_012035717.1 and XM_012180327.3. | 2011 | 21747952 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 321 | OMIA:001715-9796 | domestic horse | American Trotter (Horse) Bhotia Pony, India (Horse) Chakouyi, China (Horse) French Trotter (Horse) Icelandic Horse (Horse) Kentucky Mountain Saddle, United States of America (Horse) Missouri Fox Trotting Horse (Horse) Morgan (Horse) Paso Fino (Horse) Peruvian Paso (Horse) Quarter Horse (Horse) Rocky Mountain Horse (Horse) Scandinavian Coldblood Trotter (Horse) Spiti Pony, India (Horse) Tennessee Walking Horse (Horse) Thoroughbred (Horse) Zaniskari Pony (Horse) | Gaitedness | DMRT3 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 23 | NC_009166.3:g.22391254C>A | NM_001317265.1:c.902C>A | NP_001304194.1:p.(S301*) | rs1150690013 | 2012 | 22932389 | Breed information updated based PMID:39571791 on PMID:38600096 and PMID:37149793 | ||
| 1352 | OMIA:002442-9823 | pig | Large White (Pig) | Sperm flagella defect | DNAH17 | deletion, small (<=20) | splicing | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 12 | NC_010454.4:g.3556402_3556414del | Nosková et al. (2021): "intronic 13-bp deletion ... causes exon skipping which results in the in-frame loss of 89 amino acids from DNAH17" | rs5334475172 | 2021 | 33724408 | ||||
| 1687 | OMIA:002847-9615 | dog | Portuguese Water Dog (Dog) | Microphthalmos with hematopoietic defects, congenital | DNAJC21 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 4 | NC_049225.1:g.74274883ins[T70]TGCTGCTTGGATT | 2024 | 38682429 | |||||||
| 39 | OMIA:001466-9615 | dog | Boykin Spaniel (Dog) Chesapeake Bay Retriever (Dog) Curly Coated Retriever (Dog) Labrador Retriever (Dog) Pembroke Welsh Corgi (Dog) | Exercise-induced collapse | DNM1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | NC_006591.3:g.55282762C>A | NM_001131049.1:c.767G>T | XP_001124521.1:p.(R256L) | ROS_Cfam_1.0:g.56204742C>A ENSCAFT00845051951.1:c.767G>T ENSCAFP00845040760.1:p.Arg256Leu | rs852832685 | 2008 | 18806795 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 1434 | OMIA:002534-9615 | dog | Border Collie (Dog) | Centronuclear myopathy 1 | DNM2 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 20 | NC_006602.3:g.50423497G>A | XM_005632882.3:c.1393C>T | XP_005632939.1.:p.(R465W) | XM_005632882.3; XP_005632939.1. | 2022 | 35244154 | |||
| 125 | OMIA:001776-9685 | domestic cat | Dihydropyrimidinase deficiency | DPYS | substitution | missense | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | F2 | NC_058385.1:g.49914423C>T | XM_023248231.2:c.1303G>A | XP_023103999.2:p.(G435R) | 2012 | 23430934 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||||
| 1194 | OMIA:002266-9615 | dog | Rottweiler (Dog) | Hyperkeratosis, palmoplantar, DSG1-related | DSG1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 7 | g.58163636_58163640del | c.2541_2545del | p.(G848Wfs*2) | NM_001002939.1; NP_001002939.1; published as c.2541_2545delGGGCT | 2020 | 32344723 | |||
| 1392 | OMIA:002452-9685 | domestic cat | Domestic Shorthair (Cat) | Hair shaft dysplasia | DSG4 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | D3 | NC_058379.1:g.53103168del | XM_019815116.2:c.76del | XP_019670675.2:p.(I26Lfs*4) | 2022 | 34878611 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 1393 | OMIA:002452-9685 | domestic cat | Domestic Shorthair (Cat) | Hair shaft dysplasia | DSG4 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | D3 | NC_058379.1:g.53124305del | XM_019815116.2:c.1777del | XP_019670675.2:p.(H593Tfs*23) | 2022 | 34878611 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 1408 | OMIA:002243-9913 | taurine cattle | Highland (Cattle) | Ichthyosis, DSP-related | DSP | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 23 | NC_037350.1:g.47826600G>T | NM_001192368.2:c.6893C>A | NP_001179297.1:p.(A2298D) | NM_001192368.2; NP_001179297.1 | rs5385033307 | 2022 | 34996433 | ||
| 1710 | OMIA:002243-9615 | dog | Poodle, Miniature (Dog) | Ichthyosis, syndromic | DSP | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 35 | NC_049256.1:g.8804542_8804544del | XM_038584124.1:c.1821_1823del | XP_038440052.1:p.(N608del) | de novo variant in one dog | 2024 | 39136317 | |||
| 1115 | OMIA:002210-9823 | pig | Bama Xiang Zhu, China (Pig) | Congenital hypothyroidosis | DUOX2 | substitution | missense | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 1 | NC_010443.5:g.126625620A>G | NM_213999.2:c.1226A>G | NP_999164.2:p.(D409G) | ENU mutagenesis was used to create these pigs, the mutation is located within an exonic splicing enhancer motif and causes aberrant splicing of DUOX2 transcripts (Cao et al., 2019) | rs5334475175 | 2019 | 30651277 | ||
| 1806 | OMIA:002964-9986 | rabbit | New Zealand White (Rabbit) | Thrombocytopenia | DUT | substitution | missense | Base-editing | Not currently evaluated | OryCun2.0 | 17 | NC_013685.1:g.24154696T>C | XM_002717835.3:c.347A>G | XP_002717881.2:p.(Y116C) | Published as c.3020A>G | 2025 | 40362420 | |||
| 1056 | OMIA:002186-9615 | dog | Boston Terrier (Dog) Bulldog (Dog) French Bulldog (Dog) | Screw tail | DVL2 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 5 | g.32195051del | c.2051del | p.(P684Lfs*26) | XM_005619960.3; XP_005620017.1; published as g.32195043_32195044del; c.2044delC and changed to HGVS nomenclature in this table | 2018 | 30521570 | |||
| 711 | OMIA:000543-9913 | taurine cattle | Danish Holstein (Cattle) | Anhidrotic ectodermal dysplasia | EDA | HED6 | insertion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | X | "a LINE1-derived pseudoexon between EDA exons 1 and 2. The 161-bp-long pseudoexon introduces a shift in reading frame and a premature stop codon early in EDA exon 2" | 2011 | 22034998 | Allele id was copied from Table 1 of Capuzzello et al. (2022) | |||||
| 1739 | OMIA:000543-103695 | central bearded dragon | Scaleless | EDA | Sca | deletion, gross (>20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | "in-frame deletion of 14 amino acids in a highly conserved tumor necrosis factor (TNF) motif of the EDA protein" | 2016 | 28439533 | ||||||||
| 645 | OMIA:000543-9913 | taurine cattle | Deutsche Holstein Schwarzbunt, Germany (Cattle) | Anhidrotic ectodermal dysplasia | EDA | HED1 | deletion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | X | c.397_502del | p.(M133Vfs*111) | a large deletion including exon 3 in the gene for ectodysplasin (ED1; now called EDA) 200922: g. info moved to here (g.85821470) until it can be standardised | 2001 | 11591646 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 Allele id and p. information were copied from Table 1 of Capuzzello et al. (2022) | |||
| 1120 | OMIA:000543-9913 | taurine cattle | Holstein Friesian (Cattle) | Generalized hypohidrotic ectodermal dysplasia | EDA | HED8 | inversion | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | X | g.77174882_80737442inv | Escouflaire et al. (2019): The "first breakpoint . . . [is] between positions 82,271,052 and 82,271,053 bp on chromosome X . . . The second breakpoint is situated at position 86,034,441 bp within the EDA intron 1" | 2019 | 31533624 | Allele id was copied from Table 1 of Capuzzello et al. (2022). | ||||
| 1293 | OMIA:000543-9913 | taurine cattle | Red Angus-Simmental cross | Hypohidrotic ectodermal dysplasia | EDA | HED9 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | X | g.80382423_80435202del | GCF_002263795.1 (O'Toole et al., 2021) | 2021 | 33801223 | Allele id was copied from Table 1 of Capuzzello et al. (2022). | ||||
| 1484 | OMIA:000543-9913 | taurine cattle | British Blue x Holstein-Friesian cross | Anhidrotic ectodermal dysplasia, EDA-related | EDA | HED10 | deletion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | X | g.80516615_80538514del | c.397_502del | p.(M133Vfs*111) | NM_001081743.2; NP_001075212.1 | 2022 | 36068608 | Allele id was copied from Table 1 of Capuzzello et al. (2022). | |
| 586 | OMIA:000543-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Anhidrotic ectodermal dysplasia | EDA | HED7 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | X | g.80802800_80802801insCCCT | c.280_281insAGGG | p.(G94Qfs*49) | rs5334475024 | 2012 | 22497423 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Allele id was copied from Table 1 of Capuzzello et al. (2022). | |
| 1665 | OMIA:000543-9913 | taurine cattle | Fleckvieh-Simmental, Germany (Cattle) | Hypohidrotic ectodermal dysplasia, X-linked | EDA | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | X | g.80417567C>T | c.679G>A | p.(G227R) | NM_001081743.2; NP_001075212.1; published as g.85716041G>A in ARS-UCD2.0 | rs1114816375 | 2023 | 38275590 | ||
| 373 | OMIA:000543-9913 | taurine cattle | Deutsche Holstein Schwarzbunt, Germany (Cattle) | Anhidrotic ectodermal dysplasia | EDA | HED2 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | X | NC_037357.1:g.80411671A>C | NM_001081743.2:c.924+2T>G | c.DNA position is based on NM_001081743.2 | rs5334474632 | 2002 | 12021844 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Allele id was copied from Table 1 of Capuzzello et al. (2022) | |
| 1661 | OMIA:000543-9913 | taurine cattle | Limousin (Cattle) | Hypohidrotic ectodermal dysplasia, X-linked | EDA | HED11 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | X | NC_037357.1:g.80411716T>C | NM_001081743.2:c.881A>G | NP_001075212.1:p.(E294G) | NM_001081743.2; NP_001075212.1 | rs439722471 | 2024 | 38252617 | |
| 1295 | OMIA:000543-9913 | taurine cattle | Holstein Friesian (Cattle) | Anhidrotic ectodermal dysplasia | EDA | HED5 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | X | NC_037357.1:g.80411795C>T | NM_001081743.2:c.802G>A | "a single nucleotide polymorphism (SNP) G/A at the 9th base of exon 8 [GenBank: AJ278907.1 position 30.549] ... Sequencing of the RT-PCR products revealed that the amplified fragment of the affected animals lacked ... exon 8. At the protein level, the exon skipping leads to a frameshift and consequently to a premature stop codon." (Gargani et al., 2011) | 2011 | 21740563 | Allele id and c. information were initially copied from Table 1 of Capuzzello et al. (2022), where this variant was incorreclty listed as g.80411795C>A and c.802C>A. This variant table was corrected on [13/02/2026] based on invaluable feedback from David W. Silversides who noted the error. | ||
| 1294 | OMIA:000543-9913 | taurine cattle | Red Angus-Charolais-Simmental cross | Anhidrotic ectodermal dysplasia | EDA | HED3 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | X | NC_037357.1:g.80415626G>A | NM_001081743.2:c.730C>T | NP_001075212.1:p.(R244*) | rs5334474792 | 2006 | 17616058 Reference not in PubMed; see OMIA 000543-9913 for reference details | The g. coordinate for the named reference genome assembly, together with the c. coordinate, were kindly provided by Tosso Leeb (22 March 2021). Allele id was copied from Table 1 of Capuzzello et al. (2022). | |
| 482 | OMIA:000543-9913 | taurine cattle | Holstein Friesian (Cattle) | Anhidrotic ectodermal dysplasia | EDA | HED4 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | X | NC_037357.1:g.80803015_80803033del | NM_001081743.2:c.48_66del | NP_001075212.1:p.(A16S22fs*55) | "a 19-bp deletion at nucleotides c.48_66 in exon 1 ... . This mutation is predicted to generate a truncated 49 aa protein." | rs5334474984 | 2011 | 21410470 | Allele id and p. information were copied from Table 1 of Capuzzello et al. (2022) |
| 1458 | OMIA:000543-9615 | dog | Mixed Breed (Dog) | X-linked hypohidrotic ectodermal dysplasia | EDA | not known | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | r.385_487del | p.M129fs*112 | NM_001014770.2; NP_001014770.1; EDA transcript lacks 103 nucleotides encoded by exon 2, exon skipping is likely to be caused by an intronic splice variant | 2016 | 27449516 | ||||
| 1017 | OMIA:000543-9615 | dog | Dachshund (Dog) | X-linked hypohidrotic ectodermal dysplasia | EDA | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | g.54509504del | c.842delT | p.(L281Hfs*22) | 2018 | 30276836 | ||||
| 361 | OMIA:000543-9615 | dog | German Shepherd Dog (Dog) | Anhidrotic ectodermal dysplasia | EDA | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | NC_006621.3:g.54511433G>A | NM_001014770.2:c.910-1G>A | NM_001014770.2 | rs1152388425 | 2005 | 16151697 | Genomic coordinates in CanFam3.1 und EVA Id provided by Zoe Shmidt and Robert Kuhn. | ||
| 1705 | OMIA:000543-9685 | domestic cat | Domestic Shorthair (Cat) | Hypohidrotic ectodermal dysplasia | EDA | substitution | missense | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | X | NC_058386.1:g.57148944G>A | XM_011291781.3:c.1042G>A | XP_011290083.1:p.(A348T) | reported in a single cat | 2024 | 39062633 | |||
| 724 | OMIA:001695-8090 | Japanese medaka | Reduced scale-3 | edar | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | "several kb of extra sequence in the 5' UTR that . . . contains out-of-frame start codons and stop codons, [and consequently] the mutant transcript is likely to result in premature initiation and termination of translation and, as a result, the EDAR protein is not synthesized" | 2001 | 11516953 | ||||||||||
| 843 | OMIA:002128-9913 | taurine cattle | Charolais (Cattle) | Anhidrotic ectodermal dysplasia, EDAR-related | EDAR | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 11 | g.44599876_44599877insC | p.(P161Rfs*97) | UMD3.1 position is g.44462236_44462237insC | 2017 | 28904385 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |||
| 1550 | OMIA:002687-9940 | sheep | Fleece variation, wool density | EDAR | substitution | regulatory | Naturally occurring variant | Not currently evaluated | Oar_v4.0 | 3 | g.61927840T>C | the T allele is associated denser wool production in fine wool sheep | rs408766096 | 2024 | 37137429 | |||||
| 1869 | OMIA:002887-37003 | mangrove rivulus | Ectodermal dysplasia, no-fin-ray | edaradd | nfr | substitution | missense | Chemical mutagenesis (ENU) | Not currently evaluated | ASM164957v2 | LH22 | NC_051451.1:g.11425249C>T | XM_017421743.3:c.574C>T | XP_017277232.1:p.(R192C) | 2025 | 39837941 | ||||
| 1738 | OMIA:002887-94885 | corn snake | Scaleless | EDARADD | scl | deletion, small (<=20) | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | UNIGE_PanGut_3.0 | Super-Scaffold_423 | NW_023010793.1:g.39572203_39572204del | XM_034428296.1:c.545_546del | XP_034284187.1:p.(C182*) | 2023 | 37315141 | ||||
| 1474 | OMIA:002560-9913 | taurine cattle | Lidia, Spain (Cattle) | Growth and respiratory lethal syndrome | EDN2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 3 | g.104701617G>A | c.149G>A | p.(C50Y) | ENSBTAG00000021434; ENSBTAT00000028571.3 | 2022 | 35912509 | |||
| 722 | OMIA:001671-9031 | chicken | Bohuslän - Dals svarthöna, Sweden (Chicken) Chinese Xingyi bantam, China (Chicken) Dulong chicken, China (Chicken) Emei Black, China (Chicken) Guangxi Black-bone chicken, China (Chicken) H'mong, Viet Nam (Chicken) Jiuyuan Black, China (Chicken) Kadaknath, India (Chicken) Kedu, Indonesia (Chicken) Luning, China (Chicken) Miyi, China (Chicken) Muchuan Silkies Black, China (Chicken) Nunukan, Indonesia (Chicken) Pengxian Buff, China (Chicken) Piao chicken, China (Chicken) Qiandongnan Xiao Xiang, China (Chicken) Silkie (Chicken) Sumatra (Chicken) Taliu Black-bone chicken, China (Chicken) Tibetan, China (Chicken) Weining, China (Chicken) Wuding, China (Chicken) Wuliangshang Black –bone chicken, China (Chicken) Wumeng Silkies, China (Chicken) Xichuan black-bone chicken, China (Chicken) Xishuangbanna Fighting, China (Chicken) Yeonsan Ogye, Republic of Korea (Chicken) Yimeng Blue, China (Chicken) | Silky/Silkie pigmentation (Fibromelanosis) | EDN3 | FM | complex rearrangement | Naturally occurring variant | Not currently evaluated | 20 | The FM mutation was initially reported as "the duplication of two genomic regions, each larger than 100 kb and separated by 417 kb on wild-type [GGA20] chromosomes". Ma et al. (2025, PMID: 40102581) report additional breeds and provide more detailed information: "The FM allele constitutes a truly complex structural variant involving two large duplications (127.4 kb and 170.5 kb), an inversion and translocation of the 170.5 duplication and with a 412.5 kb non-duplicated intervening region." | 2011 | 22216010 | |||||||
| 1747 | OMIA:002901-8296 | axolotl | Skin colour, white | EDN3 | d | not known | Not currently evaluated | cDNA from animals with the white phenotype lack exon 2 | 2017 | 28127056 | ||||||||||
| 760 | OMIA:002164-9925 | goat | Coat colour, white spotting, EDNRA-related | EDNRA | repeat variation | Naturally occurring variant | Not currently evaluated | 17 | "a 1Mb copy number variant (CNV) harboring 5 genes including EDNRA. The analysis of 358 Boer goats revealed 3 alleles with one, two, and three copies of this CNV. The copy number is correlated with the degree of white spotting in goats" | 2016 | 27329507 | |||||||||
| 160 | OMIA:000629-9796 | domestic horse | American Paint (Horse) Miniature Horse (Horse) Quarter Horse (Horse) Thoroughbred (Horse) | Megacolon | EDNRB | frame overo | delins, small (<=20) | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 17 | NC_009160.3:g.50503041_50503042delinsCT | NM_001081837.2:c.353_354delinsAG | NP_001075306.2:p.(I118K) | NM_001081837.2; NP_001075306.2 | 1998 | 9530628 | ||
| 930 | OMIA:001765-9940 | sheep | West African Dwarf (Sheep) | Waardenburg syndrome, type 4A | EDNRB | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 10 | "a deletion of about 110 kb on sheep chromosome [OAR]10, comprising the entire EDNRB gene" | 2012 | 23300849 | |||||||
| 1632 | OMIA:000375-8932 | rock pigeon | Piebald | EDNRB2 | Group 4 | duplication | Naturally occurring variant | Not currently evaluated | tandem duplication of a 37-kb region spanning from intron 1 of VAMP7 to just 5’ of EDNRB2 | 2023 | 37546953 | |||||||||
| 1631 | OMIA:000375-8932 | rock pigeon | Piebald | EDNRB2 | Group2 | substitution | missense | Naturally occurring variant | Not currently evaluated | p.(A42E) | 2023 | 37546953 | ||||||||
| 1630 | OMIA:000375-8932 | rock pigeon | Piebald | EDNRB2 | Group1 | substitution | missense | Naturally occurring variant | Not currently evaluated | p.(R290C) | 2023 | 37546953 | ||||||||
| 1562 | OMIA:002701-51751 | ball python | Skin colour, EDNRB2-related | EDNRB2 | yellowbelly | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | c.1646del | OP589186.1; 1-bp deletion introduces a frameshift, which removes or alters three of the seven transmembrane helices | 2023 | 37191439 | |||||||
| 1563 | OMIA:002701-51751 | ball python | Skin colour, EDNRB2-related | EDNRB2 | yellowbelly | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | c.1747_1763del | OP589186.1; "17-bp deletion introduces a frameshift into the transcript, which removes or alters two of the seven transmembrane helices" | 2023 | 37191439 | |||||||
| 1564 | OMIA:002701-51751 | ball python | Skin colour, EDNRB2-related | EDNRB2 | specter | substitution | missense | Naturally occurring variant | Not currently evaluated | c.2601G>C | p.(R315P) | OP589186.1 | 2023 | 37191439 | ||||||
| 1567 | OMIA:002701-51751 | ball python | Skin colour, EDNRB2-related | EDNRB2 | asphalt | substitution | splicing | Naturally occurring variant | Not currently evaluated | c.3118G>A | OP589186.1; G-to-A substitution in the sixth splice donor for the sixth intron | 2023 | 37191439 | |||||||
| 1565 | OMIA:002701-51751 | ball python | Skin colour, EDNRB2-related | EDNRB2 | spark | substitution | missense | Naturally occurring variant | Not currently evaluated | c.481G>C | p.(L152F) | OP589186.1 | 2023 | 37191439 | ||||||
| 1566 | OMIA:002701-51751 | ball python | Skin colour, EDNRB2-related | EDNRB2 | gravel | substitution | splicing | Naturally occurring variant | Not currently evaluated | c.499G>A | OP589186.1; G-to-A substitution at the splice donor for the first intron | 2023 | 37191439 | |||||||
| 257 | OMIA:000375-93934 | Japanese quail | Feather colour, panda/dotted white | EDNRB2 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.995G>A | p.(R332H) | 2007 | 17313575 | ||||||||
| 1633 | OMIA:001252-8932 | rock pigeon | Recessive white and bull eye | EDNRB2 | substitution | missense | Naturally occurring variant | Not currently evaluated | 4A | g.11167700C>T | c.766G>A | p.(E256K) | 2023 | 37546953 | ||||||
| 1773 | OMIA:000375-9049 | Indian peafowl | Feather colour, white | EDNRB2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | 4 | g.12583552G>A | p.(W206*) | 2025 | 39965774 | |||||||
| 1164 | OMIA:001252-8843 | domestic goose | Gang, China (Goose (domestic)) | Feather colour, recessive white | EDNRB2 | insertion, small (<=20) | Naturally occurring variant | Not currently evaluated | AnsCyg_PRJNA183603_v1.0 | NW_013185915.1:g.750748_750735insCACAGGTGAGCTCT | 2020 | 32066369 | ||||||||
| 16 | OMIA:001904-9031 | chicken | Feather colour, recessive white | EDNRB2 | mo^w | substitution | missense | Naturally occurring variant | Not currently evaluated | GRCg6a | 4 | g.11164302G>T | c.731G>T | p.(C244F) | NM_204120.1; NP_989451.1; published as c.1008G>T and p.(C244F); coordinates in the table have been updated to a recent reference genome and / or transcript | 2014 | 24466053 | Genomic position in GRCg6a provided by Joshua Khamis. | ||
| 17 | OMIA:001904-9031 | chicken | Feather colour, mottled | EDNRB2 | mo | substitution | missense | Naturally occurring variant | Not currently evaluated | GRCg6a | 4 | g.11166001G>A | c.999G>A | p.(R332H) | NM_204120.1; NP_989451.1; published as c.1272G>A and p.(R332H); coordinates in the table have been updated to a recent reference genome and / or transcript | 2014 | 24466053 | Genomic position in GRCg6a provided by Joshua Khamis. | ||
| 1808 | OMIA:002353-9615 | dog | Weimaraner (Dog) | Congenital mirror movement disorder 1 | EFNB3 | CMM1 | duplication | frameshift | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 5 | NC_049226.1:g.32799629_32799630dup | XM_038536724.1:c.643_644dup | XP_038392652.1:p.(A216Vfs*79) | 2025 | 40401490 | |||
| 1870 | OMIA:003037-9913 | taurine cattle | Blonde d'Aquitaine (Cattle) | Perinatal lethality, EGFR-related | EGFR | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 22 | g.916239C>T | XP_002696936:p.(V876*) | 2026 | 41501727 | |||||
| 1481 | OMIA:002564-9615 | dog | English Springer Spaniel (Dog) | Dyserythropoietic anemia and myopathy syndrome (DAMS) | EHBP1L1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 18 | g.52123541delG | c.3120delC | p.(F1041Sfs*30) | XM_038563927.1; XP_038419855.1 | 2022 | 36140701 | |||
| 1483 | OMIA:002564-9615 | dog | Labrador Retriever (Dog) | Congenital dyserythropoietic anemia and polymyopathy | EHBP1L1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 18 | NC_049239.1:g.52128140G>A | XM_038563927.1:c.388C>T | XP_038419855.1:p.(R130*) | XM_038563927.1; | 2022 | 36011338 | |||
| 1901 | OMIA:003057-9615 | dog | Mixed Breed (Dog) | Cerebellar cortical degeneration, granuloprival | EMC1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Dog10K_Boxer_Tasha | 2 | NC_006584.4:g.75896884C>T | XM_850160.5:c.2041C>T | XP_855253.2:p.(R681W) | 2026 | 42066428 | ||||
| 1753 | OMIA:002904-9913 | taurine cattle | Angus (Cattle) | Male subfertility, EML5-related | EML5 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 10 | NC_037337.1:g.100310158G>A | NM_001206576.1:c.4960C>T | NP_001193505.1:p.(R1654W) | rs380547429 | 2022 | 35478957 | |||
| 452 | OMIA:001805-9615 | dog | Italian Greyhound (Dog) | Amelogenesis imperfecta | ENAM | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 13 | g.59946493_59946497del | c.1991_1995delTTTCC | p.(F665Rfs*3) | XM_539305.4; XP_539305.3; published as c.1991_1995delTTTCC | 2013 | 23638899 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 1044 | OMIA:001805-9615 | dog | Parson Russell Terrier (Dog) | Amelogenesis imperfecta | ENAM | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 13 | NC_006595.3:g.59945218C>T | XM_539305.4:c.716C>T | XP_539305.3:p.(P239L) | XM_539305.4; XP_539305.3 | 2019 | 30877375 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn and Zoe Shmidt. | ||
| 759 | OMIA:000296-9031 | chicken | Duplex comb | EOMES | duplication | Naturally occurring variant | Not currently evaluated | 2 | "a 20 Kb tandem duplication containing several conserved putative regulatory elements located 200 Kb upstream of the eomesodermin gene (EOMES)" | 2015 | 25789773 | |||||||||
| 1 | OMIA:000240-8932 | rock pigeon | Crest | EPHB2 | cr | substitution | missense | Naturally occurring variant | Not currently evaluated | c.???C>T | p.(R758C) | 2013 | 23371554 | |||||||
| 1454 | OMIA:002550-9615 | dog | Rhodesian Ridgeback (Dog) | Early onset adult deafness | EPS8L2 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | UMICH_Zoey_3.1/canFam5 | 18 | g.25868739_25868750del | c.1033_1044del | p.(V345_L348del) | XM_038500406.1; XP_038356334.1; published as 12-bp inframe deletion in EPS8L2 (CFA18:25,868,739-25,868,751 in the UMICH_Zoey_3.1) corresponding to deletion of amino acids VHFL | 2022 | 35385474 | |||
| 1161 | OMIA:000483-9925 | goat | Polled intersex syndrome | ERG | PIS | complex rearrangement | Naturally occurring variant | Not currently evaluated | 1 | "a deletion with a total length of 10 159 bp and an inversely inserted approximately 480 kb-sized duplicated segment of a region located approximately 21 Mb further downstream on chromosome 1 containing two genes, KCNJ15 and ERG" (Simon et al., 2020) | 2020 | 32060960 | ||||||||
| 1169 | OMIA:002543-9031 | chicken | Cleft primary palate | ESRP2 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | GRCg6a | 11 | g.3284041del | rs3386590816 | 2020 | 32162363 | |||||||
| 1439 | OMIA:001457-9685 | domestic cat | Multiple acyl-CoA dehydrogenase deficiency | ETFDH | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.69030128A>C | NM_001290236.1:c.692T>G | NP_001277165.1:p.(F231C) | 2014 | 24142280 | Thanks to Heidi Anderson for alerting OMIA to this paper; 31 March 2022. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||||
| 617 | OMIA:002540-9913 | taurine cattle | Japanese Brown, Japan (Cattle) | Chondrodysplasia | EVC2 | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 6 | g.103609778_103609779delinsG | c.2327_2328delinsG | p.(A776Gfs*22) | Published as c.2054_2055delCAinsG, cDNA and protein position in this table based on ENSBTAT00000005613.6 | rs5334475076 | 2002 | 12136126 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 375 | OMIA:002540-9913 | taurine cattle | Japanese Brown, Japan (Cattle) | Chondrodysplasia | EVC2 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 6 | NC_037333.1:g.103594013C>T | NM_173927.1:c.1356C>T | Variant creates a cryptic splice donor site in exon 11 which is leading to improper splicing at position c.1355 and resulting in the 56-base RNA deletion between 1355 and 1410. The deletion causes a frameshift and premature termination. | rs5334475072 | 2002 | 12136126 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||
| 534 | OMIA:002540-9913 | taurine cattle | Tiroler Grauvieh (Cattle) | Chondrodysplasia | EVC2 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 6 | NC_037333.1:g.103651709_103651710del | NM_173927.1:c.2993_2994del | NP_776352.1:p.(D998Efs*13) | rs5334475061 | 2014 | 24733244 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. 210909 FN: given that the variant is a 2bp del (AC), g.103651710_103651710del needs to be changed. BLASTing with AGAGGAGCAAGAAGAC from Fig.4 indicates that it is 719 and 710 that are deleted. THus the entry is changed to g.103651709_103651710del; and AC is removed from the c. entry. | ||
| 346 | OMIA:002042-9913 | taurine cattle | Belgian Blue (Cattle) | Abortion (embryonic lethality), EXOSC4 | EXOSC4 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 14 | NC_037341.1:g.755826G>A | NM_001078086.2:c.190G>A | NP_001071554.1:p.(R64*) | rs3423357300 | 2016 | 27646536 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1467 | OMIA:002554-9685 | domestic cat | Osteochondromatosis (feline leukemia virus-negative) | EXT1 | duplication | frameshift | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | F2 | NC_058385.1:g.61870704dup | XM_023248762.2:c.1468dup | XP_023104530.1:p.(L490Pfs*31) | 2022 | 35719100 | |||||
| 980 | OMIA:001214-9615 | dog | American Staffordshire Terrier (Dog) | Osteochondromatosis | EXT2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 18 | NC_006600.3:g.45101754G>T | XM_014121199.2:c.924C>A | XP_013976674.1:p.(Y308*) | XM_014121199.2; XP_013976674.1; published as c.969C>A and p.(Y323*); coordinates in the table have been updated to a recent reference genome and / or transcript | 2018 | 29485212 | |||
| 713 | OMIA:000363-9913 | taurine cattle | Holstein (black and white) (Cattle) Sahiwal (Cattle) | Factor XI deficiency | F11 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 27 | a 76-bp insertion in exon 12 of the Factor XI gene 200922: g. and c. info moved here (g.15367048; c.1406ins76) until can be standardised | 2004 | 15566468 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | |||||||
| 591 | OMIA:000363-9913 | taurine cattle | Japanese Black, Japan (Cattle) Sahiwal (Cattle) | Factor XI deficiency | F11 | delins, small (<=20) | delins (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 27 | g.16305660delinsATATGTGCAGAATATA | c.870delinsATATGTGCAGAATATA | P.(F290delinsLYVQNI) | rs5334474726 | 2005 | 16104386 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||
| 702 | OMIA:000363-9615 | dog | Kerry Blue Terrier (Dog) | Factor XI deficiency | F11 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 16 | g.44477343_44477344ins90 | c.819_820ins90 | NM_001135123.1 "an insertion of 90 bp (SINE) inside of coding exon 7" resulting in a "30 amino acids insertion in the A3 domain of FXI serine protease" (Tcherneva et al., 2007). | 2007 | Reference not in PubMed; see OMIA 000363-9615 for reference details | g. and c. coordinates kindly provided by Professor Urs Giger (27 August 2022) | ||||
| 1472 | OMIA:000363-9685 | domestic cat | Maine Coon (Cat) | Factor XI deficiency | F11 | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.17127925G>A | XM_003984601.5:c.1546G>A | XP_003984650.2:p.(V516M) | 2022 | 35627175 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 533 | OMIA:000364-9685 | domestic cat | American Shorthair (Cat) Balinese (Cat) Bengal (Cat) Cymric (Cat) Highlander (Cat) Himalayan (Cat) Maine Coon (Cat) Maine Coon Polydactyl (Cat) Manx (Cat) Minuet (Cat) Munchkin (Cat) Munchkin Longhair (Cat) Ragdoll (Cat) Savannah (Cat) Siamese (Cat) Tennessee Rex (Cat) | Factor XII deficiency | F12 | deletion, small (<=20) | frameshift | Naturally occurring variant | Out of scope | F.catus_Fca126_mat1.0 | A1 | NC_058368.1:g.172794693del | NM_001168212.2:c.1321del | NP_001161684.2:p.(L441Cfs*119) | published as c.1321delC | 2015 | 24793828 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Additional breeds reported based on PMID:35709088. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1815 | OMIA:000364-9685 | domestic cat | Factor XII deficiency | F12 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A1 | NC_058368.1:g.172795562C>T | NM_001168212.2:c.1549C > T | NP_001161684.2:p.(Q517*) | identified in a single cat | 2019 | 31022435 | ||||
| 147 | OMIA:000364-9685 | domestic cat | Balinese (Cat) Bengal (Cat) Bengal Longhair (Cat) Bombay (Cat) British Shorthair (Cat) Devon Rex (Cat) Domestic Shorthair (Cat) Donskoy (Cat) Elf (Cat) Exotic Shorthair (Cat) Highlander (Cat) Himalayan (Cat) Lykoi (Cat) Maine Coon (Cat) Maine Coon Polydactyl (Cat) Minuet (Cat) Minuet Longhair (Cat) Munchkin (Cat) Munchkin Longhair (Cat) Neva Masquerade (Cat) Oriental Longhair (Cat) Oriental Shorthair (Cat) Persian (Cat) Peterbald (Cat) Ragdoll (Cat) Savannah (Cat) Scottish Fold (Cat) Scottish Fold Longhair (Cat) Scottish Straight (Cat) Scottish Straight Longhair (Cat) Selkirk Rex (Cat) Selkirk Rex Longhair (Cat) Siamese (Cat) Siberian (Cat) Sphynx (Cat) Tennessee Rex (Cat) Turkish Angora (Cat) | Factor XII deficiency | F12 | substitution | missense | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | A1 | NC_058368.1:g.172795644G>C | NM_001168212.2:c.1631G>C | NP_001161684.2:p.(G544A) | rs5334475144 | 2017 | 28392508 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Additional breeds reported based on PMID:35709088. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1532 | OMIA:001818-9913 | taurine cattle | Japanese Black, Japan (Cattle) Japanese Brown, Japan (Cattle) | Factor XIII deficiency | F13A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | UMD_3.1.1 | 23 | g.48649432T>C | c.248T>C | p.(F83S) | NM_001167894.1; NP_001161366.1; reported in Japanese Brown in PMID: | 1996 | Reference not in PubMed; see OMIA 001818-9913 for reference details | Variant was first reported by Ogawa and Iga (1996). Variant information in this table is based on supplementary table 1 by Shibutani et al. (2023). | ||
| 148 | OMIA:000361-9783 | Asiatic elephant | Factor VII deficiency | F7 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.202A>G | p.(R68G) | 2017 | 28118558 | ||||||||
| 40 | OMIA:000361-9615 | dog | Airedale Terrier (Dog) Alaskan Husky (Dog) Alaskan Klee Kai (Dog) American Foxhound (Dog) Basset Hound (Dog) Beagle (Dog) Catahoula Leopard Dog (Dog) Dachshund, Miniature Smooth-Haired (Dog) English Foxhound (Dog) Finnish Hound (Dog) German Shorthaired Pointer (Dog) German Wirehaired Pointer (Dog) Giant Schnauzer (Dog) Harrier (Dog) Irish Water Spaniel (Dog) Japanese Spitz (Dog) Miniature Schnauzer (Dog) Papillon (Dog) Phalène (Dog) Redbone Coonhound (Dog) Scottish Deerhound (Dog) Sealyham Terrier (Dog) Welsh Springer Spaniel (Dog) Whippet (Dog) | Factor VII deficiency | F7 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 22 | NC_006604.3:g.60578895G>A | NM_001048033.1:c.407G>A | NP_001041498.1:p.(G136E) | 2006 | 16961583 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; variant initially identified in Beagle and later reported in additional breeds: PMID:17939552; PMID: 27525650; PMID:34544496; PMID:29708978 | |||
| 363 | OMIA:000437-9615 | dog | Irish Setter (Dog) Miniature Schnauzer (Dog) | Haemophilia A | F8 | inversion | splicing | Naturally occurring variant | Not currently evaluated | X | intronic inversion that results in "aberrant splicing and premature termination" | 2002 | 12008949 | |||||||
| 1038 | OMIA:000437-9913 | taurine cattle | Fleckvieh-Simmental, Germany (Cattle) | Haemophilia A | F8 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | X | NC_037357.1:g.36017426A>T | NM_001145508.1:c.134A>T | NP_001138980.1:p.(H45L) | ENSBTAT00000036726.5:c.134A>T; ENSBTAP00000036581.4:p.His45Leu | rs1117392179 | 2018 | 29774585 | ||
| 194 | OMIA:000437-9913 | taurine cattle | Japanese Brown, Japan (Cattle) | Haemophilia A | F8 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | X | NC_037357.1:g.36145188T>A | NM_001145508.1:c.6458T>A | NP_001138980.1:p.(L2153H) | rs456129807 | 2009 | 19456318 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1655 | OMIA:000437-9615 | dog | Border Collie (Dog) | Haemophilia A | F8 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | g.122956942delA | c.3206delA | NM_001003212.1 | 2023 | 38104983 | |||||
| 350 | OMIA:000437-9615 | dog | Old English Sheepdog (Dog) | Haemophilia A | F8 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | NC_006621.3:g.122973422G>A | NM_001003212.1:c.1786C>T | NP_001003212.1:p.(R596*) | 2016 | 27780008 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 100 | OMIA:000437-9615 | dog | German Shepherd Dog (Dog) | Haemophilia A | F8 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | NC_006621.3:g.122975611C>T | NM_001003212.1:c.1700G>A | NP_001003212.1:p.(C567Y) | NM_001003212.1; NP_001003212.1; published as c.1643G>A & p.(C548Y); coordinates in the table have been updated to a recent reference genome and / or transcript. | 2014 | 25040606 | |||
| 99 | OMIA:000437-9615 | dog | Boxer (Dog) | Haemophilia A | F8 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | NC_006621.3:g.122981181G>C | NM_001003212.1:c.1469C>G | NP_001003212.1:p.(P490R) | NM_001003212.1; NP_001003212.1; published as c.1412C>G & p.(P471R); coordinates in the table have been updated to a recent reference genome and/ or transcript | 2014 | 25040606 | |||
| 272 | OMIA:000437-9615 | dog | German Shepherd Dog (Dog) | Haemophilia A | F8 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | NC_006621.3:g.123043081C>T | NM_001003212.1:c.98G>A | NP_001003212.1:p.(W33*) | 2011 | 21949058 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1767 | OMIA:000437-9685 | domestic cat | European Shorthair (Cat) | Haemophilia A | F8 | substitution | splicing | Naturally occurring variant | Currently unresolved | F.catus_Fca126_mat1.0 | X | NC_058386.1:g.126881432A>G | XM_004001054.4:c.6073+2T>C | g. position previously incorrectly listed in this table as NC_058380.1:g.126881432A>G - corrected to NC_058386.1 [17/09/2025] | 2024 | 39447565 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 621 | OMIA:000437-9940 | sheep | Weißes Alpenschaf, Switzerland (Sheep) | Haemophilia A | F8 | delins, small (<=20) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | X | NC_040278.1:g.86301507_86301516delinsTAATTAATACC | NM_001172550.1:c.3107_3116delinsGGTATTAATTA | The 11 bp region in exon 14 that differed between the wild-type and the hemophiliac introduced a premature stop codon | 2010 | 19943872 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries [21/09/06]. After checking the cDNA sequence in Fig. 3 of the paper, IT updated c. coordinates from c.3108_3117delinsGGTATTAATTA to c.3107_3116delinsGGTATTAATTA [10/06/2025]. Published as c.3107del10ins11. | ||||
| 1284 | OMIA:000437-9615 | dog | Rhodesian Ridgeback (Dog) | Haemophilia A | F8 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | X | g.124073876_124073877insN[221] | c.4824_4825insN[221] | NM_001003212.1; published as c.4824_25ins221, genomic coordinates published as chrX: 1240738676_77. After review of the position in the reference genome on the 17/7/2023 the genomic coordinates have been updated to g.124073876_124073877insN[221] in this table. | 2021 | 33494213 | |||||
| 1588 | OMIA:000437-9615 | dog | Labrador Retriever (Dog) | Haemophilia A | F8 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | X | g.124075777_124075778del | c.2923_2924del | p.(E975Kfs*8) | NM_001003212.1; NP_001003212 | 2023 | 37438956 | |||
| 636 | OMIA:000438-9615 | dog | Labrador Retriever (Dog) | Haemophilia B | F9 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | X | a deletion of the entire gene | 1997 | 9394892 | ||||||||
| 637 | OMIA:000438-9615 | dog | American Pit Bull Terrier (Dog) | Haemophilia B | F9 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | X | Gu et al. (1999): "A large deletion mutation was found in 1 breed variant, spanning the entire 5' region of the factor IX gene extending to exon 6". | 1999 | 10544912 | Following Table 3 from Kuder et al. (2021), the breed for this variant has been changed to Pit Bull Terrier. (18th October 2021) | |||||||
| 1039 | OMIA:000438-9615 | dog | Hovawart (Dog) | Haemophilia B | F9 | deletion, small (<=20) | regulatory | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | g.109501492del | c.-73del | NM_001003323.2; Brenig et al. (2019): NC_006621.3:g.109501492delC; "The deletion is located 73 bp upstream of the F9 start codon in the conserved overlapping DNA binding sites of hepatocyte nuclear factor 4alpha and androgen receptor." | 2019 | 30846504 | ||||
| 705 | OMIA:000438-9615 | dog | German Wirehaired Pointer (Dog) | Haemophilia B | F9 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | g.109521130_109521131insN[(1500)] | NM_001003323.2; published as "insert consists of a 5' truncated canine Line-1 followed by an approximately 200-bp 3' poly (A) tract, flanked by a 15-bp direct repeat"; g. coordinate of insertion obtained from Brenig et al. (2019) | 2003 | 14722728 | CanFam3.1 coordinates copied from Table 3 of Kuder et al. (2021) (18 Oct 2021) | |||||
| 467 | OMIA:000438-9615 | dog | Lhasa Apso (Dog) | Haemophilia B | F9 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | g.109521356_109521361delinsT | c.548_553delinsT | p.(R183Lfs*3) | NM_001003323.2; NP_001003323.1; published as "a deletion including nucleotides 772-776 and a C-->T transition at nucleotide 777", coordinates in the table have been updated to a recent reference genome and / or transcript and to HGVS nomenclature | 1996 | 8896410 | CanFam3.1 coordinates copied from Table 3 of Kuder et al. (2021) (18 Oct 2021) | ||
| 1363 | OMIA:000438-9615 | dog | Newfoundland (Dog) | Haemophilia B | F9 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | g.109531586_109531587insA | c.821_822insA | p.(N274Kfs*23) | NM_001003323.2; NP_001003323.1 | 2021 | 34680886 | |||
| 704 | OMIA:000438-9615 | dog | Airedale Terrier (Dog) | Haemophilia B | F9 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | g.109532012_109532013insN[(5000)] | c.1247_1248insN[(5000)] | NM_001003323.2; Gu et al. (1999): "An approximately 5 kb insertion disrupted exon 8 ... associated with alternative splicing between a donor site 5' and acceptor site 3' to the normal exon 8 splice junction, with introduction of a new stop codon. The resultant transcript lacked most of the factor IX catalytic domain and 3' untranslated region." | 1999 | 10544912 | CanFam3.1 coordinates copied from Table 3 of Kuder et al. (2021) (18 Oct 2021) | ||||
| 47 | OMIA:000438-9615 | dog | Rhodesian Ridgeback (Dog) | Haemophilia B | F9 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | NC_006621.3:g.109530868G>A | NM_001003323.2:c.731G>A | NP_001003323.1:p.(G244E) | NM_001003323.2; NP_001003323.1; published as p.(G244E) by Mischke et al. (2011), g. and p. coordinates were copied on the 18th October 2021 from Table 3 of Kuder et al. (2021) (relating to NP_001003323.1 ) as g.109530847G>A and p.(G237E). These g. and p. positions were incorrect. After review of Figure 1 published by Mischke et al. (2011) it was confirmed that the published p. coordinates are consistent with NM_001003323.2:c.731G>A and NP_001003323.1:p.(G244E). The g. coordinates have been updated to a recent reference genome (5th April 2022) | 2011 | 20303304 | Thank you to Agustín Arasanz for identifying that the coordinates published by Kuder et al. (2021) were inconsistent with the originally published information by Mischke et al. (2011) (5th April 2022). | ||
| 46 | OMIA:000438-9615 | dog | Cairn Terrier (Dog) | Haemophilia B | F9 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | NC_006621.3:g.109532018G>A | NM_001003323.2:c.1253G>A | NP_001003323.1:p.(G418E) | NM_001003323.2; NP_001003323.1, published as p.(G379E) by Evans et al. (1989), coordinates in the table have been updated to a recent reference genome and / or transcript | 1989 | 2481310 | c. and p. coordinates updated from Kuder et al. (2021) | ||
| 127 | OMIA:000438-9685 | domestic cat | Domestic Longhair (Cat) | Haemophilia B | F9 | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | X | NC_058386.1:g.114354785G>A | NM_001009377.3:c.383G>A | NP_001009377.1:p.(C128Y) | published as p.(C82Y); coordinates in the table have been updated to a recent reference genome and / or transcript | 2005 | 15822564 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 310 | OMIA:000438-9685 | domestic cat | Haemophilia B | F9 | substitution | nonsense (stop-gain) | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | X | NC_058386.1:g.114374368C>T | NM_001009377.3:c.1150C>T | NP_001009377.1:p.(R384*) | published as p.(R338*); coordinates in the table have been updated to a recent reference genome and / or transcript | 2005 | 15822564 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 1360 | OMIA:002450-9913 | taurine cattle | Chianina (Cattle) | Ichthyosis congenita | FA2H | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 18 | g.2205625_2205626insG | c.9dupC | p.(A4Rfs*142) | NM_001192455.1; NP_001179384.1 | 2021 | 34599683 | |||
| 752 | OMIA:002032-9615 | dog | Border Collie (Dog) Mixed Breed (Dog) | Neuropathy, sensory | FAM134B | inversion | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 4 | g.80439639_86910352inv | "6.47 Mb inversion was identified with breakpoints in intron 3 of FAM134B (chr4:86,910,352) and in an upstream intergenic region (chr4:80,439,639) ... … Analysis of RNAseq data revealed FAM134B was majorly disrupted by the inversion, with novel exons occurring 3′ of the final normally transcribed exon before the inversion, due to cryptic splicing." | 2016 | 27527794 | ||||||
| 1342 | OMIA:002032-9615 | dog | German Spitz (Dog) Mixed Breed (Dog) | Neuropathy, sensory | FAM134B | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 4 | NC_049225.1:G.88169941C>T | NM_001314111.1:c.656C>T | NP_001301040.1:p.(P219L) | Initially reported in a mixed breed dog, later reported in a German Spitz (PMID: 39377488). | 2021 | 34387380 | |||
| 925 | OMIA:001918-9615 | dog | Tibetan Spaniel (Dog) Tibetan Terrier (Dog) | Retinal atrophy, progressive, type 3, FAM161A-related | FAM161A | PRA3 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 10 | g.61822372_61822373insN[(230)] | A ~230bp insertion containing a 132bp short interspersed nuclear element (SINE), near the splice acceptor site of exon 5 CanFam2.0 coordinate published as g.64974130 | 2014 | 24705771 | |||||
| 1706 | OMIA:001918-9615 | dog | English Shepherd (Dog) | Retinal atrophy, progressive, type 6, FAM161A-related | FAM161A | PRA6 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 10 | NC_049231.1:g.63116065_63116066ins[N[210];63116051_63116065] | XM_038551371.1:c.1728_1729ins[N[210];1714-1728] | XP_038407299.1:p.(Q576_M577ins*50)) | published as XP_005626197.1 c.17929_ins210 | 2024 | 39062732 | |||
| 1183 | OMIA:002259-9913 | taurine cattle | Montbéliarde (Cattle) | de novo mutation in an AI sire | FAM189A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 21 | g.28112913T>C | p.(N192S) | Bourneuf et al. (2017) detected FAM189A1 g.28644665T>C; p.N192S as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Montbéliarde AI bull. No information was provided on the descendants of this bull. | rs5334475108 | 2017 | 28904385 | |||
| 102 | OMIA:002015-9615 | dog | Border Collie (Dog) | Dental hypomineralization | FAM20C | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 6 | g.16452327G>A | c.899C>T | p.(A300V) | 2016 | 27187611 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 89 | OMIA:001327-9615 | dog | Bedlington Terrier (Dog) Irish Terrier (Dog) Kromfohrlander (Dog) | Hyperkeratosis, palmoplantar | FAM83G | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 5 | NC_006587.3:g.41055619G>C | XM_003434636.3:c.155G>C | XP_003434684.1:p.(R52P) | 2014 | 24832243 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. Additional breed informationbased on Makri et al. (2021) | |||
| 1511 | OMIA:002600-9986 | rabbit | New Zealand White (Rabbit) | Amelogenesis imperfecta | FAM83H | deletion, gross (>20) | Genome-editing (CRISPR-Cas9) | Not currently evaluated | large deletion of more then 900bp in exon 5 | 2022 | 36300761 | |||||||||
| 460 | OMIA:001683-9615 | dog | Cavalier King Charles Spaniel (Dog) | Congenital keratoconjunctivitis sicca and ichthyosiform dermatosis | FAM83H | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 13 | g.37328057del | c.977del | p.(P326Hfs*258) | NM_001289427.1; NP_001276356.1; genomic position in accordance with HGVS 3'-rule | 2012 | 22253609 | Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. | ||
| 1805 | OMIA:002959-9685 | domestic cat | Russian Blue (Cat) | REM sleep behaviour disorder | FAM8A1 | deletion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B2 | NC_058372.1:g.11622168_11622190del | XM_019831563.3:c.485_507del | XP_019687122.3:p.(Q162Pfs*115) | 2025 | 40266280 | We are greateful to M.C. Temizkan for alerting us to a typographical error in the c. coordinates. [12/12/2025] | |||
| 683 | OMIA:002683-9615 | dog | Basenji (Dog) | Fanconi syndrome | FAN1 | deletion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 3 | NC_049224.1:g. 38383631_38383947del | XM_038532604.1:c.2954_3090+181del | XP_038388532.1:p.(L985Vfs19*) | "317 bp of exon 14 were deleted starting at the second exon14 nucleotide and extending into the 3' untranslated region of FAN1"; details reported by Farias et al. (2024; PMID:39596669) | 2011 | Reference not in PubMed; see OMIA 002683-9615 for reference details | |||
| 646 | OMIA:000151-9913 | taurine cattle | Holstein (black and white) (Cattle) | Brachyspina | FANCI | deletion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 21 | g.20773899_20777226del | p.(V877Lfs*27) | 2012 | 22952632 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||||
| 1880 | OMIA:003045-9615 | dog | Boerboel (Dog) | Autoimmune lymphoproliferative syndrome | FAS | duplication | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 26 | NC_049247.1:g.39040590_39040603 | XM_038576079.1:c.179_192dup | XP_038432007.1:p.(P65Vfs*54) | 2026 | 41742579 | |||||
| 613 | OMIA:002064-9685 | domestic cat | British Shorthair (Cat) | Autoimmune lymphoproliferative syndrome | FASLG | duplication | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | F1 | NC_058384.1:g.14766775dup | NM_001009352.1:c.418dup | NP_001009352.1:p.(R140Kfs*37) | published as c.413_414insA "insertion of an adenine at position 14,607,400 [Felis_Catus_6.2]" (Aberdein et al., 2017); changed in this table to a recent reference genome and HGVS nomenclature | 2017 | 27770190 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 377 | OMIA:000628-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Marfan syndrome | FBN1 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 10 | g.61917867G>A | c.8227-1G>A | rs5334475078 | 2012 | 22221020 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | |||
| 201 | OMIA:000628-9913 | taurine cattle | Limousin (Cattle) | Marfan syndrome | FBN1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 10 | NC_037337.1:g.61831200G>A | NM_174053.2:c.3598G>A | NP_776478.1:p.(E1200K) | rs5334475103 | 2005 | 15776436 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1402 | OMIA:000628-9823 | pig | Marfan syndrome | FBN1 | deletion, small (<=20) | frameshift | Genome-editing (ZFN) | Not currently evaluated | Sscrofa11.1 | 1 | NC_010443.5:g.123246159del | NM_001001771.1:c.1296del | NP_001001771.1:p.(E433Nfs98*) | 2016 | 27074716 | |||||
| 910 | OMIA:000836-9913 | taurine cattle | Blonde d'Aquitaine (Cattle) Limousin (Cattle) | Protoporphyria | FECH | substitution | extension (stop-lost) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 24 | NC_037351.1:g.56787697C>A | NM_174054.2:c.1250G>T | NP_776479.1:p.(*417Lext*27) | rs5334474668 | 1998 | 9784594 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 576 | OMIA:001525-9615 | dog | German Shepherd Dog (Dog) | Leukocyte adhesion deficiency, type III | FERMT3 | insertion, small (<=20) | insertion (in-frame) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 18 | g.52835932_52835933insGGCAGCCGTCTT | c.1349_1350insAAGACGGCTGCC | p.(L450_A451insRRLP) | XM_038425194.1; XP_038281122.1; 12-base pair insertion | 2010 | 20126836 | |||
| 1336 | OMIA:002382-9615 | dog | Dachshund, Miniature Wire-Haired (Dog) | Afibrinogenaemia | FGA | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 15 | NC_006597.3:g.52240694del | XM_532697.6:c.1665delT | XP_532697.6:p.(I555Mfs*33) | Transcript XM_532697.6 / ENSCAFT00000043702.3 | rs1152388481 | 2021 | 34356081 | ||
| 1529 | OMIA:002625-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Skeletal dysplasia, FGD3 related | FGD3 | delins, small (<=20) | missense | Naturally occurring variant | Not currently evaluated | UMD_3.1.1 | 8 | g.85826989_85826990delinsTG | p.(H171C) | 2015 | 26306008 | |||||
| 1326 | OMIA:002374-9913 | taurine cattle | Holstein Friesian (Cattle) Jersey (Cattle) | Charcot Marie Tooth disease | FGD4 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.77262490C>T | XM_024992559.1:c.1671+1G>A | Splice donor mutation based on XM_005206883.3 | rs5334475069 | 2021 | 34045765 | |||
| 941 | OMIA:001723-9940 | sheep | Romney Marsh (Sheep) | Familial episodic ataxia | FGF14 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 10 | NC_040261.1:g.88095843G>A | XM_027973760.1:c.214C>T | XP_027829561.1:p.(Q72*) | Oar_v3.1 position is g.77593415, published as c.46C>T & p.(Q16*), coordinates in this table updated to reflect recent transcript and protein information | 2017 | 29253853 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 327 | OMIA:000889-9031 | chicken | Israeli experimental line, Israel (Chicken) Storrs Connecticut scaleless low line, United States of America (Chicken) UC Davis line, United States of America (Chicken) | Scaleless | FGF20 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | GRCg6a | 4 | g.63270401A>T | c.535A>T | p.(R179*) | 2012 | 22712610 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 929 | OMIA:000272-9615 | dog | Rhodesian Ridgeback (Dog) Thai Ridgeback (Dog) | Ridge & dermoid sinus | FGF3 | Ridge allele | duplication | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 18 | g.48372578_48505893dup133316 | A large ~133,000 bp duplication on chromosome 18, encompassing three FGF genes (FGF3, FGF4, FGF19) and another gene ORAOV1. There is an additional single T inserted between the two copies of the duplication. This is not indicated in the genomic variant designation. | 2007 | 17906623 | |||||
| 694 | OMIA:002542-9615 | dog | Basset Hound (Dog) Cairn Terrier (Dog) Cardigan Welsh Corgi (Dog) Dachshund (Dog) Dandie Dinmont Terrier (Dog) Lancashire Heeler (Dog) Norwich Terrier (Dog) Pekingese (Dog) Pembroke Welsh Corgi (Dog) Petit Basset Griffon Vendeen (Dog) Shih Tzu (Dog) Skye Terrier (Dog) Swedish Vallhund (Dog) Tibetan Spaniel (Dog) West Highland White Terrier (Dog) | Chondrodysplasia | FGF4 retrogene CFA18 | FGF4L1 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 18 | a 5kb insertion containing a FGF4 retrogene, i.e. a processed pseudogene of FGF4: The insertion containing the FGF4 retrogene starts at 23,431,136 on CFA18, which is 25Mb away from the complete (original) FGF4 gene, which is located at CFA18 48413479-48415205 | 2009 | 19608863 | |||||||
| 855 | OMIA:000157-9615 | dog | American Cocker Spaniel (Dog) Basset Hound (Dog) Beagle (Dog) Cardigan Welsh Corgi (Dog) Chesapeake Bay Retriever (Dog) Chihuahua (Dog) Coton de Tulear (Dog) Dachshund (Dog) English Springer Spaniel (Dog) French Bulldog (Dog) Nova Scotia Duck Tolling Retriever (Dog) | Intervertebral disc disease, type I | FGF4 retrogene in CFA12 | FGF4L2 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 12 | " the insertion on CFA12 is 3,209 bp long (GenBank accession no. MF040221) and includes parental FGF4 cDNA (i.e., FGF4 exons spliced without introns) . . . ." 200922: g. info moved here (g.33710178_33710179insMF040221) until it can be standardised | 2017 | 29073074 | ||||||
| 853 | OMIA:002133-9615 | dog | Nova Scotia Duck Tolling Retriever (Dog) | Skeletal dysplasia, FGF4-retrogene-related | FGF4 retrogene on CFA12 | FGF4L2 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 12 | " the insertion on CFA12 is 3,209 bp long (GenBank accession no. MF040221) and includes parental FGF4 cDNA (i.e., FGF4 exons spliced without introns) . . . ." 200922: g. info moved here (g.33710178_33710179insMF040221) until can be standardised | 2017 | 29073074 | ||||||
| 983 | OMIA:000439-9844 | llama | Long hair | FGF5 | haplotype | Naturally occurring variant | Not currently evaluated | A "a single base deletion (c.348delA), [and] a 12-bp insertion (c.351_352insCATATAACATAG)" that comprise a single likely causal variant | 2017 | 29024003 | ||||||||||
| 982 | OMIA:000439-10141 | domestic guinea pig | Long hair | Fgf5 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.403C>T | p.(R135*) | "The data were submitted to the European Variation Archive (accession no. PRJEB24997)" | 2018 | 29603294 | |||||||
| 984 | OMIA:000439-9844 | llama | Long hair | FGF5 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.499C>T | 2017 | 29024003 | |||||||||
| 559 | OMIA:000439-10036 | golden hamster | Hair, long | Fgf5 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | c.546delG | p.(R184Gfs*6) | 2015 | 26481120 | ||||||||
| 347 | OMIA:000439-9793 | ass (donkey) | Âne de Provence, France (Ass) Âne des Pyrénées, France (Ass) Âne grand noir du Berry, France (Ass) Âne normand, France (Ass) | Hair, long | FGF5 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ASM1607732v2 | 3 | NC_052179.1:g.161373495G>A | XM_014836312.2:c.245G>A | XP_014691798.1:p.W82* | 2014 | 25927731 | ||||
| 560 | OMIA:000439-9793 | ass (donkey) | Âne Bourbonnais, France (Ass) Âne des Pyrénées, France (Ass) Âne normand, France (Ass) Poitou (Ass) | Hair, long | FGF5 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ASM1607732v2 | 3 | NC_052179.1:g.161381098_161381099del | XM_014836312.2:c.433_434del | XP_014691798.1:p.M145Vfs*15 | 2014 | 25927731 | ||||
| 1343 | OMIA:000439-9838 | Arabian camel | Long hair | FGF5 | substitution | missense | Naturally occurring variant | Not currently evaluated | CamDro3 | 2 | g.76625546C>T | c.779C>T | p.(P260L) | cDNA and protein positions based on transcript ENSCDRT00005003721.1 | 2021 | 34432312 | ||||
| 952 | OMIA:000439-9615 | dog | Eurasier (Dog) | Long hair | FGF5 | Lh3 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 32 | NC_006614.3::g.4528617_4528632del | NM_001048129.1:c.556_571del | NP_001041594.1:p.(A186Tfs*71) | published as c.556_571del16; p.(A186Tfs*69) | rs397509816 | 2013 | 23384345 | Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. |
| 48 | OMIA:000439-9615 | dog | Afghan Hound (Dog) Belgian Shepherd Dog, Malinois (Dog) Belgian Shepherd Dog, Tervueren (Dog) Border Collie (Dog) Cocker Spaniel (Dog) Collie (Dog) Dachshund (Dog) German Shepherd Dog (Dog) Golden Retriever (Dog) Huntaway (Dog) New Zealand Heading Dog (Dog) Pembroke Welsh Corgi (Dog) Pomeranian (Dog) Samoyed (Dog) | Long hair | FGF5 | Lh1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 32 | NC_006614.3:g.4509367G>T | NM_001048129.1:c.284G>T | NP_001041594.1:p.(C95F) | ROS_Cfam_1.0:g.4533621G>T ENSCAFT00845031580.1:c.290G>T ENSCAFP00845024720.1:p.Cys97Phe. Additional breeds based on PMID:40965331, PMID:41773981 | rs851828354 | 2006 | 16879338 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool |
| 418 | OMIA:000439-9615 | dog | Afghan Hound (Dog) | Long hair | FGF5 | Lh5 | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 32 | NC_006614.3:g.4517257T>A | NM_001048129.1:c.368-11T>A | ROS_Cfam_1.0:g.4541511T>A ENSCAFT00845031580.1:c.368-11T>A | rs397511324 | 2013 | 23384345 | 30 Dec 2020: g. coordinate corrected: thanks to Angelica K Kallenberg | |
| 950 | OMIA:000439-9615 | dog | Afghan Hound (Dog) Belgian Shepherd Dog, Malinois (Dog) Belgian Shepherd Dog, Tervueren (Dog) Eurasier (Dog) | Long hair | FGF5 | Lh4 | duplication | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 32 | NC_006614.3:g.4528620_4528621dup | NM_001048129.1:c.559_560dup | NP_001041594.1:p.(R188Afs*75) | published as c.559_560dupGG and p.(R188Afs*73), |
rs397512451 | 2013 | 23384345 | Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. Additional breeds based on PMID: 41773981 |
| 104 | OMIA:000439-9615 | dog | Akita (Dog) Samoyed (Dog) | Long hair | FGF5 | Lh2 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 32 | NC_006614.3:g.4528639C>T | NM_001048129.1:c.578C>T | NP_001041594.1:p.(A193V) | 2013 | 23384345 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1890 | OMIA:000439-9615 | dog | Mixed Breed (Dog) | Long hair | FGF5 | Lh6 | duplication | frameshift | Naturally occurring variant | Not currently evaluated | Dog10K_Boxer_Tasha | 32 | NC_006614.4:g.37352832dup | NM_001048129.1:c.562dup | NP_001041594.1:p.(R188Pfs*12) | published as NC_006614.4:g.37352830-37352831insG; NM_001048129: c.562_563insC - changed in this table to a duplication based on HGVS nomenclature recommendations |
2026 | 41828909 | ||
| 1891 | OMIA:000439-9615 | dog | Anatolian Shepherd Dog (Dog) Tibetan Mastiff (Dog) | Long hair | FGF5 | Lh7 | substitution | missense | Naturally occurring variant | Not currently evaluated | Dog10K_Boxer_Tasha | 32 | NC_006614.4:g.37352896T>A | NM_001048129.1:c.497A>T | NP_001041594.1:p.(E166V) | 2026 | 41828909 | |||
| 1892 | OMIA:000439-9615 | dog | Tibetan Mastiff (Dog) | Long hair | FGF5 | Lh8 | substitution | missense | Naturally occurring variant | Not currently evaluated | Dog10K_Boxer_Tasha | 32 | NC_006614.4:g.37364148C>A | NM_001048129.1:c.407G>T | NP_001041594.1:p.(R136L) | published as NM_001048129.1:c.410G>T, NP_001041594.1:p.(R137L) |
2026 | 41828909 | ||
| 1893 | OMIA:000439-9615 | dog | Tibetan Mastiff (Dog) | Long hair | FGF5 | Lh9 | substitution | missense | Naturally occurring variant | Not currently evaluated | Dog10K_Boxer_Tasha | 32 | NC_006614.4:g.37364157A>G | NM_001048129.1:c.398T>C | NP_001041594.1:p.(V133A) | 2026 | 41828909 | |||
| 1368 | OMIA:000439-9685 | domestic cat | Maine Coon (Cat) | Long hair | FGF5 | l^MCC2 (M5) | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.139634158C>T | NM_001114546.1:c.577G>A | NP_001108018.1:p.(A193T) | 2021 | 34599367 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 130 | OMIA:000439-9685 | domestic cat | Long hair | FGF5 | l (M4) | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.139634260G>T | NM_001114546.1:c.475A>C | NP_001108018.1:p.(T159P) | published as c.474delT; variant can be in a haplotype with c.474del | rs5334475161 | 2007 | 17433015 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 498 | OMIA:000439-9685 | domestic cat | Maine Coon (Cat) Ragdoll (Cat) | Long hair | FGF5 | l^MCC1 (M3) | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.139634261del | NM_001114546.1:c.474del | published as c.474delT; variant can be in a haplotype with c.475A>C resulting in two different predicted effects on the protein | 2007 | 17433015 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 311 | OMIA:000439-9685 | domestic cat | Norwegian Forest Cat (Cat) | Long hair | FGF5 | l^NFC (M2) | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.139645946G>A | NM_001114546.1:c.406C>T | NP_001108018.1:p.(R136*) | rs5334475123 | 2007 | 17767004 | The genomic location on Felis_catus_9.0 is based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 595 | OMIA:000439-9685 | domestic cat | Ragdoll (Cat) | Long hair | FGF5 | l^Rag (M1) | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.139653676_139653677insA | NM_001114546.1:c.356_357insT | NP_001108018.1:p.(M119Ifs) | published as c.ins356T | 2007 | 17767004 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 1575 | OMIA:000439-9986 | rabbit | Angora (Rabbit) | Hair, long | FGF5 | substitution | missense | Naturally occurring variant | Not currently evaluated | OryCun2.0 | 15 | g.70103616A>G | c.571T>C | p.(L191S) | XM_008267686.2; XP_008265908.1; published as c.T19234C in exon 2; coordinates in this table are based on a recent reference genome | 2023 | 37268908 | |||
| 787 | OMIA:002090-9913 | taurine cattle | Holstein (black and white) (Cattle) | Facial dysplasia syndrome | FGFR2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 26 | NC_037353.1:g.41489034C>A | NM_001205310.1:c.927G>T | NP_001192239.1:p.(W309C) | rs5334475009 | 2017 | 28768473 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1675 | OMIA:001313-9685 | domestic cat | Bengal (Cat) Egyptian Mau (Cat) Toyger (Cat) | Coat texture, glitter | FGFR2 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | D2 | NC_058378.1:g.77479931_77479934insN[585] | a 585-bp cat-specific Endogenous Retroviral Long Terminal Repeat (ERV1-3_FCa-type LTR) element insertion | 2024 | 38531359 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||||
| 1179 | OMIA:001703-9913 | taurine cattle | Holstein (black and white) (Cattle) | Chondrodysplasia, disproportionate | FGFR3 | substitution | extension (stop-lost) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 6 | NC_037333.1:g.116767863C>A | NM_174318.3:c.2408G>T | NP_776743.1:p.(*803Lext*93) | NM_174318.3: c.2408G>T; [XM_024992994.1: p.(Ter803Leuext*93) | rs5334474953 | 2020 | 32239744 | ||
| 225 | OMIA:001703-9940 | sheep | Suffolk (Sheep) | Chondrodysplasia, Spider lamb | FGFR3 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 6 | NC_040257.1:g.128784747A>T | XM_027971315.1:c.2093T>A | XP_027827116.1:p.(V698E) | published as c.1719T>A; p.(V700E); updated to HGVS nomenclature [10/04/2026] | 2006 | 16441300 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 77 | OMIA:001335-9615 | dog | German Shepherd Dog (Dog) | Renal cystadenocarcinoma and nodular dermatofibrosis | FLCN | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 5 | NC_006587.3:g.42186445A>G | XM_005619508.3:c.764A>G | XP_005619565.1:p.(H255R) | rs1152388411 | 2003 | 14532326 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 860 | OMIA:001360-9031 | chicken | Beijing You, China (Chicken) Commercial strain- layer- ISA Brown (Chicken) Commercial strain- layer- Lohmann Brown (Chicken) Marans (Chicken) Rhode Island Red (Chicken) TETRA strain, United States of America (Chicken) Transylvanian Naked Neck (Chicken) | Trimethylaminuria (fishy taint) | FMO3 | substitution | missense | Naturally occurring variant | Not currently evaluated | 8 | c.1034A>T | p.(T329S) | 2005 | 15916878 | ||||||
| 304 | OMIA:001360-9913 | taurine cattle | Swedish Red and White (Cattle) | Trimethylaminuria (fishy taint) | FMO3 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 16 | NC_037343.1:g.38666821C>T | NM_174057.2:c.712C>T | NP_776482.1:p.(R238*) | rs797790546 | 2002 | 12466292 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; rsID gleaned from or confirmed by Table 1 of  Sharma et al. (2017) Animal Genetics 48(3):369-370 | ||
| 531 | OMIA:000526-9615 | dog | Weimaraner (Dog) | Hypomyelination of the central nervous system | FNIP2 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 15 | g.55928287del | c.1078del | p.(I360Lfs*3) | XM_005629382.3; XP_005629439.1; published as CanFam2:58974928delA, XM_532705:c.880delA and p.(I294fs*296) - coordinates in the table have been updated to a recent reference genome and / or transcript and HGVS nomenclature | 2014 | 24272703 | |||
| 571 | OMIA:000323-9615 | dog | Chinese Crested (Dog) Peruvian Hairless Dog (Dog) Xoloitzcuintli (Dog) | Ectodermal dysplasia | FOXI3 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ROS_Cfam_1.0 | 17 | g.38764875_38764881dup | c.57_63dup | p.(A23Rfs*219) | NM_001135646.1; NP_001129118.1 | 2008 | 18787161 | |||
| 1319 | OMIA:001949-9685 | domestic cat | Birman (Cat) | Hypotrichosis, with short life expectancy | FOXN1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | E1 | NC_058381.1:g.18231051_18231054del | XM_019817475.3:c.1030_1033del | XP_019673034.2:p.(L344Gfs) | published as c.1030_1033delCTGT; predicted to cause a frameshift leading to a premature stop codon at position 547 | 2015 | 25781316 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 461 | OMIA:000396-9615 | dog | English Springer Spaniel (Dog) | Fucosidosis, alpha | FUCA1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 2 | g.75665866_75665879del | c.379_392del | p.(A127Vfs*26) | NM_001003250.1; NP_001003250.1; a 14-bp deletion at the 3' end of exon 1 | 1996 | 8730282 | |||
| 178 | OMIA:000862-9823 | pig | Resistance to oedema disease (F18 receptor) | FUT1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 6 | NC_010448.4:g.54079560T>C | ENSSSCT00000051297.2:c.304A>G | ENSSSCP00000062180.1:p.(T102A) | The variant was initially described as c.307G>A and p.A103T by Vögeli et al. 1997. VEP analysis identified the variant as c.304A>G p.T102A in transcript ENSSSCT00000051297.2 | rs335979375 | 2000 | 11132149 | |||
| 1436 | OMIA:002536-9615 | dog | Wirehaired Pointing Griffon (Dog) | Juvenile cataract | FYCO1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 20 | g.42952995del | c.2024delG | p.(S675Tfs*5) | XM_038566669.1; XP_038422597.1 | 2022 | 35205377 | |||
| 1299 | OMIA:002318-9913 | taurine cattle | Montbéliarde (Cattle) | coat colour, dilution (milca) | FZD7 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.90572569G>C | NM_001144091.1:c.1241G>C | NP_001137563.1:p.(G414A) | CDS position in transcript ENSBTAT00000002946.6 based on ENSEMBL Variant Effect Predictor | rs5334475107 | 2021 | 33686687 | ||
| 1361 | OMIA:000418-9615 | dog | German Pinscher (Dog) | Glycogen storage disease Ia | G6PC | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | g.20134857_20134858insN[76] | c.634_635insN[76] | XM_038676372.1; insertion of 60 consecutive adenines and an additional 16 bp duplication of the integration site (Christen et al., 2021) | 2021 | 34610166 | |||||
| 44 | OMIA:000418-9615 | dog | Maltese (Dog) | Glycogen storage disease Ia | G6PC | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | NC_006591.3:g.20138777C>G | NM_001002993.2:c.363G>C | NP_001002993.2:p.(M121I) | NM_001002993.2; NP_001002993.2; published as c.450G>C; coordinates in the table have been updated to a recent reference genome and / or transcript | 1997 | 9259982 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 488 | OMIA:000419-9913 | taurine cattle | Shorthorn (Cattle) | Glycogen storage disease II | GAA | E18 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.52484973_52484974del | NM_173913.2:c.2454_2455del | NP_776338.1:p.(T819R) | 2000 | 10723725 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |||
| 294 | OMIA:000419-9913 | taurine cattle | Blanco Orejinegro, Colombia (Cattle) Brahman (Cattle) | Glycogen storage disease II | GAA | E13 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.52488949G>A | NM_173913.2:c.1783C>T | NP_776338.1:p.(R595*) | UMD3.1 position is g.53105979C>T; variant initially identified in Brahman cattle and later reported in additional breeds:PMID:34779908. | rs5334474904 | 2000 | 10723725 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. |
| 487 | OMIA:000419-9913 | taurine cattle | Blanco Orejinegro, Colombia (Cattle) Brahman (Cattle) Droughtmaster (Cattle) | Glycogen storage disease II | GAA | E7 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.52492405_52492406del | NM_173913.2:c.1057_1058del | NP_776338.1:p.(Y353L) | UMD3.1 position is g.53109436_53109437del; variant initially identified in Brahman cattle and later reported in additional breeds: PMID:28444756, PMID:34779908. | 2000 | 10723725 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||
| 270 | OMIA:000419-9615 | dog | Finnish Lapphund (Dog) Swedish Lapphund (Dog) | Glycogen storage disease II | GAA | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | NC_006591.3:g.1603730C>T | XM_845556.5:c.2237G>A | XP_850649.1:p.(W746*) | 2013 | 23457621 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1827 | OMIA:000419-93934 | Japanese quail | Glycogen storage disease, type II | GAA | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Coturnix japonica 2.1 | c.1096delG | p.(A366Hfs*23) | 2025 | 40870023 | |||||||
| 1544 | OMIA:000419-9685 | domestic cat | Domestic Shorthair (Cat) | Glycogen Storage Disease Type II (Pompe Disease) | GAA | substitution | missense | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | E1 | NC_058381.1:g.59338041G>A | XM_006940652.4:c.1799G>A | XP_006940714.4:p.(R600H) | 2023 | 37106898 | The OMIA curators thank Osamu Yamato for providing the variant information not included in Rakib et al. (2023); 17 April 2023. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 517 | OMIA:000578-9544 | Rhesus monkey | Krabbe disease | GALC | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | c.387delAC | 1997 | 9192853 | ||||||||||
| 953 | OMIA:000578-9615 | dog | Irish Setter (Dog) | Krabbe disease | GALC | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 8 | g.59294611_59294612insN[78] | c.790_791insN[78] | NM_001003238.1; NP_001003238.1; the 78 bp insertion includes a 16-bp insertion site duplication and a 62 bp U4 snRNA-derived sequence; the downstream reading frame is preserved (for sequence details see McGraw et al., 2006) | 2006 | 16490723 | |||||
| 51 | OMIA:000578-9615 | dog | Cairn Terrier (Dog) West Highland White Terrier (Dog) | Krabbe disease | GALC | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 8 | NC_006590.3:g.59311801T>G | NM_001003238.1:c.473A>C | NP_001003238.1:p.(Y158S) | NM_001003238.1; NP_001003238.1 | 1996 | 8661004 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 1607 | OMIA:000578-9615 | dog | Mixed Breed (Dog) | Krabbe disease | GALC | substitution | missense | Naturally occurring variant | Not currently evaluated | Dog10K_Boxer_Tasha | 8 | NC_006590.4:g.58893972G>A | NM_001003238.1:c.149C>T | NP_001003238.1:p.(A50V) | NM_001003238.1; NP_001003238.1; published as NC_006590.4:g.58893972G>A | 2023 | 37593836 | |||
| 1327 | OMIA:002375-9913 | taurine cattle | Holstein Friesian (Cattle) Jersey (Cattle) | Congenital disorder of glycosylation | GALNT2 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 28 | g.2281801G>A | c.1561-1G>A | Splice acceptor mutation based on NM_001193103.1. | rs5334474933 | 2021 | 34045765 | |||
| 1884 | OMIA:003047-9541 | crab-eating macaque | Polycystic kidney disease, GANAB-related | GANAB | substitution | missense | Naturally occurring variant | Not currently evaluated | NM_001285075.1:c.2708T>C | p.(V903A) | 2023 | 36876010 | ||||||||
| 182 | OMIA:001826-9913 | taurine cattle | Holstein (black and white) (Cattle) | Abortion due to haplotype HH4 | GART | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 1 | NC_037328.1:g.1997582A>C | NM_001040473.2:c.869A>C | NP_001035563.1:p.(N290T) | rs465495560 | 2013 | 23762392 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1501 | OMIA:002559-9913 | taurine cattle | Holstein Friesian (Cattle) | Persistent truncus arteriosus | GATA6 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 24 | g.34187181T>A | c.1249A>T | p.(K417X) | ENSBTAT00000007537.6 | 2023 | 36333145 | |||
| 1899 | OMIA:003056-9615 | dog | Mixed Breed (Dog) | Myopathy, GATM-related | GATM | substitution | missense | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 30 | NC_049251.1:g.12010480G>A | NM_001287084.1:c.1240C>T | NP_001274013.1:p.(R414C) | 2026 | 41742483 | ||||
| 231 | OMIA:002621-9940 | sheep | South Down (Sheep) | Gaucher disease, type | GBA | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 1 | NC_040252.1:g.111561271C>T | XM_004002580.4:c.1142G>A | XP_004002629.2:p.(C381Y) | Oar_v3.1 position is g.103978212C>T | rs429928390 | 2017 | 29023809 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 322 | OMIA:000420-9796 | domestic horse | American Paint (Horse) Quarter Horse (Horse) | Glycogen storage disease IV | GBE1 | substitution | nonsense (stop-gain) | Naturally occurring variant | P | EquCab3.0 | 26 | NC_009169.3:g.8667651C>A | NM_001081940.2:c.102C>A | NP_001075409.1:p.(Y34*) | NM_001081940.2; NP_001075409.1 | rs3437568674 | 2004 | 15366377 | The genomic position in EquCab3.0 was provided by Elizabeth Clark, working under the guidance of Professor Ernie Bailey in April 2022 | |
| 742 | OMIA:000420-9685 | domestic cat | Norwegian Forest Cat (Cat) | Glycogen storage disease IV | GBE1 | delins, gross (>20) | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | C2 | NC_058376.1:g.34574435_34612034delinsN[334] | published as "334 bp insertion at the site of a 6.2 kb deletion that extends from intron 11 to intron 12 (g. IVS11+1552_IVS12-1339 del6.2kb ins334 bp), removing exon 12" | 2007 | 17257876 | Genomic position in Felis_catus_9.0 is based on information provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||||
| 744 | OMIA:001245-9031 | chicken | Rhode Island Red (Chicken) | Retinal degeneration I | GC1 | complex rearrangement | Naturally occurring variant | Not currently evaluated | 26 | This allele is characterised by an 81bp insertion adjacent to a 642bp deletion | 1998 | 9448321 | ||||||||
| 1782 | OMIA:002937-51751 | ball python | Skin colour, axanthism | gch2/LOC103050242 | substitution | nonsense (stop-gain) | Not currently evaluated | 2 | g.281146407C>T | c.520C>T | p.(R174*) | The genomic location corresponds to chromosome 2 position 281146407 of the Burmese Python assembly | 2025 | 40235167 | ||||||
| 1494 | OMIA:002579-9913 | taurine cattle | Irish Moiled (Cattle) | Perinatal mortality syndrome, GCK-related | GCK | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 4 | g.77173487A>T | 2022 | 36105082 | ||||||
| 721 | OMIA:000701-9031 | chicken | Naked neck | GDF7 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 3 | a large insertion approximately 260kb downstream from the BMP12 gene (now known as GFD7), increasing the expression of this gene in embryonic skin | 2011 | 21423653 | |||||||||
| 1221 | OMIA:002366-9685 | domestic cat | Toyger (Cat) | Holoprosencephaly | GDF7 | deletion, small (<=20) | frameshift | Naturally occurring variant | LP/P | F.catus_Fca126_mat1.0 | A3 | NC_058370.1:g.124327443_124327449del | XM_023252074.2:c.221_227del | XP_023107842.2:p.(R74Pfs*17) | published as "a 7 bp deletion in the coding region of GDF7 (c.221_227delGCCGCGC [p.Arg74Profs*17]) at the position A3:127002233 (ENSFCAT00000063603)" (Yu et al., 2020) | rs5334475136 | 2020 | 32575532 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 1150 | OMIA:002362-9615 | dog | Entlebucher Mountain Dog (Dog) | Fecundity | GDF9 | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 11 | g.21147009G>A | c.229C>T | p.(P77S) | NM_001168013.1; NP_001161485.1 | 2020 | 31802524 | |||||
| 239 | OMIA:002362-9940 | sheep | Wicklow Cheviot (Sheep) | Fecundity, Thoka, FecG | GDF9 | FecG(T) | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 5 | NC_040256.1:g.46545130T>G | NM_001142888.2:c.1279A>C | NP_001136360.2:p.(S427R) | Oar_v3.1 position is g.41841117T>G; protein and cDNA positions are based on NP_001136360.2 and NM_001142888.2, respectively | 2009 | 19713444 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 242 | OMIA:002362-9940 | sheep | Belclare (Sheep) Cambridge (Sheep) | Fecundity, High fertility, FecG | GDF9 | FecG(H) | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 5 | NC_040256.1:g.46545225G>A | NM_001142888.2:c.1184C>T | NP_001136360.2:p.(S395F) | Oar_v3.1 position is g.41841212G>A; protein and cDNA position based on NP_001136360.2 and NM_001142888.2 respectively | 2004 | 14627550 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 243 | OMIA:002362-9940 | sheep | Gammelnorsk spaelsau, Norway (Sheep) | Fecundity, Norwegian White Sheep | GDF9 | FecG(F) | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 5 | NC_040256.1:g.46545298C>T | NC_040256.1:c.1111G>A | NP_001136360.2:p.(V371M) | Oar_v3.1 position is g.41841285C>T | rs403536877 | 2013 | 23280002 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. |
| 240 | OMIA:002362-9940 | sheep | Pelibuey, Mexico (Sheep) Santa Ines, Brazil (Sheep) | Fecundity, Embrapa, FecG | GDF9 | FecG(E) | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 5 | NC_040256.1:g.46545375A>C | NM_001142888.2:c.1034T>G | NP_001136360.2:p.(F345C) | Oar_v3.1 position is g.41841362T>G; protein and cDNA position based on NP_001136360.2 and NM_001142888.2, respectively | rs1092755620 | 2011 | 20528846 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. |
| 1407 | OMIA:002362-9940 | sheep | Icelandic (Sheep) | Fecundity, Loa, FecG | GDF9 | FecG(L) | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 5 | NC_040256.1:g.46545396_46545399del | NP_001136360.2:p.(N337Rfs*26) | Oar_v3.1 position is g.41841383_41841386del | 2021 | 34967038 | |||
| 246 | OMIA:002362-9940 | sheep | Ile-De-France (Sheep) | Fecundity, Vacaria, FecG | GDF9 | FecG(V) | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 5 | NC_040256.1:g.46545466G>A | NM_001142888.2:c.943C>T | NP_001136360.2:p.(R315C) | Oar_v3.1 position is g.41841453G>A; protein and cDNA positions based on NP_001136360.2 and NM_001142888.2, respectively | 2014 | 25039891 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 444 | OMIA:001514-9615 | dog | English Pointer (Dog) English Springer Spaniel (Dog) French Spaniel (Dog) German Shorthaired Pointer (Dog) | Acral mutilation syndrome | GDNF | substitution | regulatory | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 4 | NC_006586.3:g.70875561C>T | "This variant, located 90 kb upstream of the GDNF gene, a highly relevant neurotrophic factor candidate gene, lies in [the last exon of] a long intergenic non-coding RNAs (lincRNA), GDNF-AS." | 2016 | 28033318 | |||||
| 114 | OMIA:001208-9615 | dog | Labrador Retriever (Dog) | Alexander disease | GFAP | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | NC_006591.3:g.18572769G>A | XM_022422887.1:c.719G>A | XP_022278595.1:p.(R240H) | rs850986067 | 2016 | 26486469 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 293 | OMIA:001442-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Forelimb-girdle muscular anomaly | GFRA1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 26 | NC_037353.1:g.36627244G>A | NM_001105411.1:c.430C>T | NP_001098881.1:p.(Q144*) | rs5334475112 | 2013 | Reference not in PubMed; see OMIA 001442-9913 for reference details | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 655 | OMIA:001089-9823 | pig | Blood group system ABO | GGTA1 | O | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 1 | "the 0 allele has a large deletion between exon 7 of the A0 blood group gene and the neighbouring SURF6". | 2011 | 21554350 | ||||||||
| 190 | OMIA:001473-9915 | indicine cattle (zebu) | Brahman (Cattle) | Dwarfism, growth-hormone deficiency | GH1 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.641C>T | p.(T200M) | Bos indicus cDNA position based on AF034386, protein position based on AAB92549 | 2009 | 19524387 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||||
| 1232 | OMIA:001473-9615 | dog | Chihuahua (Dog) | Dwarfism, growth-hormone deficiency | GH1 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | g.11832438_11832443del | c.573_578del | p.(K191_D193delinsN) | NM_001003168.1; NP_001003168.1; variant initially identified in Chihuahuas and later reported in additional breeds: PMID: 37582787 | 2020 | 32646299 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn | |||
| 660 | OMIA:000309-9031 | chicken | Connecticut (CT) strain, United States of America (Chicken) S2 line, China (Chicken) | Dwarfism, sex-linked | GHR | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | Z | deletion of 1773 bp in the 3' end of the coding region of the growth hormone receptor gene | 1994 | 7964293 | ||||||||
| 677 | OMIA:001920-27706 | largemouth bass | Abortion due to deletion in GHRH | GHRH | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | a 66bp deletion (c.-923_-858del) in the 5' flanking region of the GHRH gene in an autosomal recessive embryonic lethal | 2014 | 24697798 | ||||||||||
| 1362 | OMIA:001152-9031 | chicken | Feather colour, melanotic | GJA5 | delins, gross (>20) | regulatory | Naturally occurring variant | Not currently evaluated | GRCg6a | 1 | g.95256761_95256801delinsAAACTACTGCTTATTAAACTACTACTACTATTTAAGAT | cis-acting regulatory mutation | 2021 | 34607956 | ||||||
| 1832 | OMIA:003004-80972 | clown anemonefish | Skin colour pattern, Snowflake | gja5b | substitution | missense | Naturally occurring variant | Not currently evaluated | c.124G>A | p.(E42K) | 2025 | 40909517 | ||||||||
| 1802 | OMIA:002957-7994 | Mexican tetra | Anophthalmia/microphthalmia | gja8b | substitution | missense | Naturally occurring variant | Not currently evaluated | p.(S89K) | 2024 | 39554031 | |||||||||
| 1803 | OMIA:002957-7994 | Mexican tetra | Anophthalmia/microphthalmia | gja8b | substitution | missense | Naturally occurring variant | Not currently evaluated | p.(T39M) | 2024 | 39554031 | |||||||||
| 794 | OMIA:002119-9615 | dog | Leonberger (Dog) | Polyneuropathy (LPN2) | GJA9 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 15 | g.3863524_3863525del | c.1107_1108delAG | p.(A370Nfs*12) | 2017 | 28841859 | ||||
| 1872 | OMIA:003038-9615 | dog | Labrador Retriever (Dog) | Paw pad hyperkeratosis | GJB6 | substitution | missense | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 25 | NC_049246.1:g.17993749C>T | XM_038573516.1:c.223C>T | XP_038429444.1:p.(R75W) | 2026 | 41601192 | ||||
| 41 | OMIA:000402-9615 | dog | Portuguese Water Dog (Dog) | Gangliosidosis, GM1 | GLB1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 23 | NC_006605.3:g.3754313G>A | NM_001037641.1:c.179G>A | NP_001032730.1:p.(R60H) | published as c.200G>A; coordinates in the table have been updated to a recent reference genome and / or transcript | 2000 | 11032334 | |||
| 462 | OMIA:000402-9615 | dog | Shiba Inu (Dog) | Gangliosidosis, GM1 | GLB1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 23 | NC_006605.3:g.3796317delC | NM_001037641.1:c.1649delC | NP_001032730.1:p.(P550Rfs*50) | 2002 | 12555949 | The variant coordinates are those reported by Pervin et al. (2022) Animals 12(10), 1242. | |||
| 573 | OMIA:000402-9615 | dog | Alaskan Husky (Dog) | Gangliosidosis, GM1 | GLB1 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 23 | NC_006605.3:g.3796356_3796374dup | NM_001037641.1:c.1688_1706dup | NP_001032730.1:p.(T570Pfs*22) | 19 base pair duplication in exon 15. Two different aberrant mRNA transcripts are produced from the mutant allele. The protein variant designation refers to one of these transcripts that includes the mutant exon 15. In the other aberrant transcript, the mutant exon 15 is skipped and a different truncated protein is encoded. | 2005 | 15944348 | |||
| 126 | OMIA:000402-9685 | domestic cat | Korat (Cat) Siamese (Cat) | Gangliosidosis, GM1 | GLB1 | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | C2 | NC_058376.1:g.156332550C>G | NM_001009860.1:c.1448G>C | NP_001009860.1:p.(R483P) | rs5334475143 | 2008 | 18353697 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 230 | OMIA:000402-9940 | sheep | Romney Marsh (Sheep) | Gangliosidosis, GM1 | GLB1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 19 | NC_040270.1:g.8003247C>A | XM_015102219.2:c.686G>T | XP_014957705.2:p.(C299F) | 2012 | Reference not in PubMed; see OMIA 000402-9940 for reference details | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| 302 | OMIA:000689-9913 | taurine cattle | Polled Hereford (Cattle) | Myoclonus | GLRA1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 7 | NC_037334.1:g.63070074G>T | NM_174321.2:c.156C>A | NP_776746.1:p.(Y52*) | rs5334475027 | 2001 | 11178872 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1571 | OMIA:000689-9615 | dog | Miniature Australian Shepherd Dog (Dog) | Hyperekplexia | GLRA1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 4 | g.58338954_58338989del | published as a 36-bp deletion encompassing part of the intron 1 and exon 2 (chr4:g.58,338,953); coordinates in the this table are in accordance with HGVS nomenclature | 2023 | 37222814 | ||||||
| 496 | OMIA:001427-9685 | domestic cat | Gangliosidosis, GM2, GM2A deficiency | GM2A | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A1 | NC_058368.1:g.195482837_195482840del | XM_003981379.6:c.516_519del | XP_003981428.3:p.(V173Sfs*17) | published as c.516_519delGGTC | 2005 | 16200419 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 515 | OMIA:001368-9031 | chicken | Retinopathy globe enlarged | GNB3 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | 1 | c.D153del | 2006 | 17065478 | |||||||||
| 1804 | OMIA:002958-9913 | taurine cattle | Aubrac (Cattle) | Rhizomelic chondrodysplasia punctata | GNPAT | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 28 | NC_037355.1:g.4039268G>A | r.spl | 2024 | 40394457 Reference not in PubMed; see OMIA 002958-9913 for reference details | |||||
| 1035 | OMIA:001248-9685 | domestic cat | Domestic Shorthair (Cat) | Mucolipidosis II | GNPTAB | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B4 | NC_058374.1:g.122140618G>A | XM_003989173.6:c.2644C>T | XP_003989222.3:p.(Q882*) | 2018 | 30591066 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 265 | OMIA:000665-9925 | goat | Anglo-Nubian (Goat) | Mucopolysaccharidosis IIID | GNS | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS1.2 | 5 | NC_030812.1:g.48406875C>T | NM_001285690.1:c.304C>T | NP_001272619.1:p.(R102*) | rs5334475114 | 1995 | 7623459 | The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. Published as c.322C>T. | ||
| 778 | OMIA:001985-9913 | taurine cattle | Simmental (Cattle) | Dwarfism, Fleckvieh | GON4L | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 3 | NC_037330.1:g.15024247del | NM_001192625.1:c.4287del | NP_001179554.1:p.(G1430Kfs*66) | Previously listed as ARS-UCD1.2: g.15024245del and c.4286del; g. and c. updated to reflect HGVS recommendations (3' rule) [29/08/2024] | rs723240647 | 2016 | 27036302 | Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 210909 | |
| 1097 | OMIA:002207-9615 | dog | Cocker Spaniel (Dog) | Bernard-Soulier syndrome, type C | GP9 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 20 | g.3025814_3028273del | c.127_*2052del | XM_846924.3; Gentilini et al. (2019): "The [2460bp] deletion truncates 104 (71%) of the 146 codons of the wildtype canine reading frame." | 2019 | 31484196 | |||||
| 1487 | OMIA:002569-9615 | dog | Poodle (Dog) | Coat colour, dark red | GPR22 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 18 | insertion of a full length SNN retrocopy within the intron of COG5 and 2.8kbp upstream of GPR22 is incompletely associated with the phenotype | 2022 | 36047852 | ||||||||
| 383 | OMIA:000821-9685 | domestic cat | Primary hyperoxaluria type II (Oxalosis II) | GRHPR | substitution | splicing | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | D4 | NC_058380.1:g.58931559G>A | XM_006939292.4:c.507-1G>A | XP_006939354.1:p.(N169Kfs*46) | "point mutation, G to A, . . . at the 3# splice acceptor site of intron 4" | rs5334475152 | 2009 | Reference not in PubMed; see OMIA 000821-9685 for reference details | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1831 | OMIA:003002-9913 | taurine cattle | Simmental (Cattle) | Short stature–auditory depigmentation syndrome | GRID1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 28 | NC_037355.1:g.40526902G>T | XM_024986926.1:c.1466C>A | XP_024842694.1:p.(P489H) | s719437442 | 2025 | 40913728 | |||
| 693 | OMIA:000078-9615 | dog | Coton de Tulear (Dog) | Ataxia, cerebellar | GRM1 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 1 | "a 62-bp truncated retrotransposon insert in exon 8" | 2011 | 21281350 | ||||||||
| 1552 | OMIA:002692-9796 | domestic horse | American Saddle Horse (Horse) American Trotter (Horse) Miniature Horse (Horse) Missouri Fox Trotting Horse, United States of America (Horse) Morgan (Horse) Quarter Horse (Horse) Racking Horse (Horse) Rocky Mountain, United States of America (Horse) Spotted Saddle Horse (Horse) Tennessee Walking Horse (Horse) | Night blindness, congenital stationary, GRM6-related | GRM6 | substitution | missense | Naturally occurring variant | LP | EquCab3.0 | 14 | NC_009157.3:g.2655618C>T | XM_001916934.4:c.533C>T | XP_001916969.3:p.(T178M) | XM_001916934.4; XP_001916969.3; variant initially reported in Tennessee Walking horse and later reported in other breeds [PMID:37815029] | rs1138010744 | 2021 | 32654228 | ||
| 1774 | OMIA:002926-9615 | dog | Labrador Retriever (Dog) | Retinal atrophy, progressive, GTPBP2-related | GTPBP2 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 12 | NC_049233.1:g.12264348_12264350del | XM_038554178.1:c.1607_1609del | XP_038410105.1:p.(A536del) | Published as c.1606_1608del, c. coordinates updated to NCBI transcript | 2025 | 39971978 | ||||
| 1536 | OMIA:002646-9615 | dog | German Spitz (Dog) | Progressive retinal atrophy | GUCY2D | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 5 | g.32849537_32849538insT | c.1598_1599insT | p.(S534Efs*20) | NM_001003207.1; NP_001003207.1 | 2023 | 36872573 | |||
| 1195 | OMIA:002268-9823 | pig | Danish Landrace (Pig) | Vitamin C deficiency | GULO | od | deletion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | 14 | "This deletion includes 77 bp of exon VIII, 398 bp of intron 7 and 3.7 kbp of intron 8, which leads to a frame shift. The mutant protein is truncated to 356 amino acids, but only the first 236 amino acids are identical to the wild-type GULO protein." (Hasan et al., 2004) | 2004 | 15112110 | ||||||
| 58 | OMIA:000667-9615 | dog | Brazilian Terrier (Dog) | Mucopolysaccharidosis VII | GUSB | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 6 | NC_006588.3:g.740428G>A | NM_001003191.1:c.866C>T | NP_001003191.1:p.(P289L) | 2012 | 22815736 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 57 | OMIA:000667-9615 | dog | German Shepherd Dog (Dog) | Mucopolysaccharidosis VII | GUSB | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 6 | NC_006588.3:g.741429C>T | NM_001003191.1:c.497G>A | NP_001003191.1:p.(R166H) | ROS_Cfam_1.0:g.546709C>T ENSCAFT00845023689.1:c.482G>A ENSCAFP00845018598.1:p.Arg161His | rs1152388412 | 1998 | 9521879 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 133 | OMIA:000667-9685 | domestic cat | Mucopolysaccharidosis VII | GUSB | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | E3 | NC_058383.1:g.16002670G>A | NM_001009310.1:c.1051G>A | NP_001009310.1:p.(E351K) | published as "single G-to-A transition at nucleotide position 1074, predicting a glutamate-to-lysine substitution of amino acid residue 351 (E351K)" | rs5334475137 | 1999 | 10366443 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 139 | OMIA:000667-9685 | domestic cat | Mucopolysaccharidosis VII | GUSB | haplotype | delins (in-frame) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | E3 | NC_058383.1:g.[16005726T>G;16005729C>T] | NM_001009310.1:c.[1423T>G;1426C>T] | NP_001009310.1:p.(S475_R476delinsAW) | published as c.1421T>G and c.1424C>T; coordinates in the table have been updated to a recent reference genome and / or transcript | 2015 | 26118695 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 1887 | OMIA:000131-9796 | domestic horse | Blood group K | GYPA | Ka | delins, small (<=20) | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 2 | NC_009145.3:g.88418148_88418149delinsAT | XM_005607829.3:c.145_146delinsAT | XP_005607886.1:p.(D49I) | rs1146637742, rs1137723782 | 2026 | 41837461 | |||
| 163 | OMIA:001158-9796 | domestic horse | American Paint (Horse) Appaloosa (Horse) Belgian Draft (Horse) Quarter Horse (Horse) | Polysaccharide storage myopathy/Exertional rhabdomyolysis | GYS1 | substitution | missense | Naturally occurring variant | P | EquCab3.0 | 10 | NC_009153.3:g.19203501C>T | NM_001126125.2:c.926G>A | NP_001119597.2:p.(R309H) | ENSECAT00000023453.3:c.926G>A ENSECAP00000019426.2:p.Arg309His | rs1150416011 | 2008 | 18358695 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. Breed information updated based on PMID: 38600096 | |
| 924 | OMIA:001374-9615 | dog | Labrador Retriever (Dog) | Centronuclear myopathy, HACD1-related | HACD1 | insertion, gross (>20) | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 2 | g.19371988_19371989ins[N[236];CACACAAAGGTTT] | c.203_204ins[N[236];CACACAAAGGTTT] | NM_001025269.1; published as insertion of a 236 bp antisense canine tRNA-like SINE (EMBL accession no. AJ876906), flanked on both sides by a 13 bp direct duplication of the insertion site; resulting in multiple splicing defects | 2005 | 15829503 | ||||
| 1421 | OMIA:002522-9615 | dog | Norwegian Elkhound (Dog) | Ataxia, HACE1-related | HACE1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 12 | g.62282767del | c.1001del | p.(G334Vfs*34) | ENSCAFT00000072236.1; ENSCAFP00000049888.1 | 2022 | 35061740 | |||
| 709 | OMIA:001561-9615 | dog | Chinese Shar-Pei (Dog) | Periodic Fever Syndrome | HAS2 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 13 | "several copies of a the "meatmouth" (CNV-E) duplication upstream of the HAS2 gene", variant is associated with the disease but may not be causal | 2011 | 21437276 | ||||||||
| 419 | OMIA:000703-9615 | dog | Doberman Pinscher (Dog) | Narcolepsy | HCRTR2 | insertion, gross (>20) | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 12 | g.22603767_22603768insN[226] | c.647-36_647-35insN[226] | NM_001002933.1; a 226 bp SINE insertion in intron 3 of the HCRTR2 gene leads to skipping of exon 4 | 1999 | 10458611 | ||||
| 64 | OMIA:000703-9615 | dog | Dachshund (Dog) | Narcolepsy | HCRTR2 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 12 | NC_006594.3:g.22517939G>A | NM_001002933.1:c.160G>A | NP_001002933.1:p.(E54K) | NM_001002933.1; NP_001002933.1 | 2001 | 11282968 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 368 | OMIA:000703-9615 | dog | Labrador Retriever (Dog) | Narcolepsy | HCRTR2 | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 12 | NC_006594.3:g.22620881G>A | NM_001002933.1:c.1105+5G>A | NM_001002933.1; NP_001002933.1; experimentally confirmed splice defect; skipping of exon 6 in the HCRTR2 mRNA transcript due to a G to A transition at position +5 in the 5′-splice site of intron 6 | rs1152388413 | 1999 | 10458611 | |||
| 1784 | OMIA:000703-9615 | dog | Dogo Argentino (Dog) | Narcolepsy | HCRTR2 | duplication | duplication (in-frame) | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 12 | NC_049233.1:g.22824096_22843670dup | NM_001002933.1:c.403_762dup | NP_001002933.1:p.(T135_Q254dup) | 2025 | 40095233 | ||||
| 296 | OMIA:002230-9913 | taurine cattle | Belted Galloway (Cattle) Brown Swiss (Cattle) | Hypotrichosis | HEPHL1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 29 | NC_037356.1:g.721234T>A | NM_001192511.2:c.1684A>T | NP_001179440.1:p.(K562*) | NC_037356.1 (ARS-UCD1.2 assembly, chromosome 29): g.721234A>T; NM_001192511.2 c.1684A>T; NP_001179440.1: p.Lys562* (Kuca et al., 2021); Variant initially identified in Galloway cattle and later reported in additional breeds: PMID:30014197 | rs5334475051 | 2021 | 33926013 | ||
| 535 | OMIA:001944-9615 | dog | Miniature Schnauzer (Dog) | Spondylocostal dysostosis, autosomal recessive | HES7 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 5 | NC_006587.3:g.32945846del | XM_014113578.2:c.126delG | XP_013969053.2:p.(T43Pfs*24) | 2015 | 25659135 | ||||
| 145 | OMIA:001987-9685 | domestic cat | Japanese Domestic (Cat) | Bobtail | HES7 | JBT | substitution | missense | Naturally occurring variant | Out of scope | F.catus_Fca126_mat1.0 | E1 | NC_058381.1:g.2905189A>G | XM_003996191.5:c.5A>G | XP_003996240.1:p.(V2A) | rs5334475119 | 2016 | 27030474 | The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 1178 | OMIA:001461-9217 | American flamingo | Tay-Sachs disease | HEXA | substitution | missense | Naturally occurring variant | Not currently evaluated | c.1406C>T | p.(P469L) | 2008 | 18693054 | ||||||||
| 1825 | OMIA:001461-9913 | taurine cattle | Angus (Cattle) | Gangliosidosis, GM2 | HEXA | delins, small (<=20) | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD2.0 | 10 | NC_037337.1:g.19269480_19269481delinsGGAGT | NM_001075164.2: c.834_835delinsACTCC) | NP_001068632.1:p.(Y278*) | 2025 | 41290211 | ||||
| 26 | OMIA:001461-9615 | dog | Japanese Chin (Dog) | Gangliosidosis, GM2, type I | HEXA | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 30 | NC_006612.3:g.35841247C>T | XM_544758.6:c.967G>A | XP_544758.2:p.(E323K) | 2013 | 23266199 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 387 | OMIA:001461-9940 | sheep | Jacob (Sheep) | Gangliosidosis, GM2, type I (B variant) | HEXA | substitution | splicing | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 7 | NC_040258.1:g.20584348C>G | NM_001126343.1:c.1330G>C | The variant [c.1330G>C; G444R] at the end of exon 11 effects splicing and results in skipping of exon 11. | 2010 | 20817517 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| 1318 | OMIA:001461-9823 | pig | Wild Boar (Pig) | Gangliosidosis, GM2, type I | HEXA | substitution | missense | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 7 | NC_010449.5:g.60910365C>T | NM_001123221.1:c.1495C>T | NP_001116693.1:p.(R499C) | cDNA positions based on NM_001123221.1 | rs5334475169 | 2021 | 34119419 | ||
| 463 | OMIA:001462-9615 | dog | Poodle, Toy (Dog) | Gangliosidosis, GM2, type II (Sandhoff or variant 0) | HEXB | deletion, small (<=20) | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 2 | NC_006584.3:g.57225684del | XM_022414769.1:c.391del | XP_022270477.1:p.(V131*) | published as c.283delG and p.(V59fs); coordinates in the table have been updated to a recent reference genome and / or transcript | 2012 | 22766310 | |||
| 798 | OMIA:001462-9615 | dog | Shiba Inu (Dog) | Gangliosidosis, GM2, type II (Sandhoff or variant 0) | HEXB | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 2 | NC_006584.3:g.57243656_57243658del | XM_022414769.1:c.849_851del | XP_022270477.1:p.(L284del) | published by Kolicheski et al. (2017) as p.Leu317del and reported by Wang et al. (2018) as p.(L207del) | 2017 | 28833537 | |||
| 497 | OMIA:001462-9685 | domestic cat | Korat (Cat) | Gangliosidosis, GM2, type II (Sandhoff or variant 0) | HEXB | deletion, small (<=20) | frameshift | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | A1 | NC_058368.1:g.139024540del | NM_001009333.2:c.40del | NP_001009333.2:p.(L14Sfs*82) | published as c.39delC; g. and c. coordinates updated to reflect HGVS 3' rule | 1994 | 8178934 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 309 | OMIA:001462-9685 | domestic cat | Japanese Domestic (Cat) | Gangliosidosis, GM2, type II (Sandoff or variant 0) | HEXB | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A1 | NC_058368.1:g.139048794C>T | NM_001009333.2:c.667C>T | NP_001009333.2:p.(R223*) | 2007 | 16872651 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 381 | OMIA:001462-9685 | domestic cat | Burmese (Cat) | Gangliosidosis, GM2, type II (Sandhoff or variant 0) | HEXB | deletion, small (<=20) | splicing | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | A1 | NC_058368.1:g.139054716_139054730del | NM_001009333.2:c.1244-8_1250del | r.(spl?) | 2009 | 19231264 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 741 | OMIA:001462-9685 | domestic cat | Domestic Shorthair (Cat) | Gangliosidosis, GM2, type II (Sandhoff or variant 0) | HEXB | inversion | frameshift | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | A1 | NC_058368.1:g.139055474_139055498inv | NM_001009333.2:c.1467_1491inv | NP_001009333.2:p.(F489Lfs*4) | 2004 | 15081585 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 1584 | OMIA:001243-9601 | Sumatran orangutan | Alkaptonuria | HGD | substitution | missense | Naturally occurring variant | Not currently evaluated | Susiae_PABv2/ponAbe3 | 3 | g.17314095G>A | c.1081G>A | p.(G361R) | 2023 | 37354891 | |||||
| 1170 | OMIA:001311-9615 | dog | Miniature Schnauzer (Dog) | Progressive retinal atrophy, Miniature Schnauzer, type 1 | HIVEP3 | probably not causal, can be used as linked marker for genetic testing | substitution | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 15 | NC_006597.3:g.1432293G>A | "intronic variant in HIVEP3/ENSCAFG00000035604" (Kaukonen et al., 2020). The genetic evidence is unable to distinguish between the HIVEP3 and PPT1 variants as potential causes of PRA. ... functional considerations favor causality of the coding PPT1 structural variant over the intronic HIVEP3 SNV" (Aguirre et al. 2020). | 2020 | 32150541 | |||||
| 530 | OMIA:001493-9685 | domestic cat | Porphyria, acute intermittent | HMBS | deletion, small (<=20) | frameshift | Naturally occurring variant | LP/P | F.catus_Fca126_mat1.0 | D1 | NC_058377.1:g.16579672_16579675del | NM_001177808.1:c.107_110del | NP_001171279.1:p.(D36Vfs*6) | published as c.107_110delACAG | 2013 | 24239138 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 596 | OMIA:001493-9685 | domestic cat | Siamese (Cat) | Porphyria, acute intermittent | HMBS | insertion, small (<=20) | frameshift | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | D1 | NC_058377.1:g.16580212dup | NM_001177808.1:c.189dup | NP_001171279.1:p.(L64Sfs*2) | published as c.189dupT | 2010 | 19934113 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 135 | OMIA:001493-9685 | domestic cat | Porphyria, acute intermittent | HMBS | substitution | missense | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | D1 | NC_058377.1:g.16580358G>A | NM_001177808.1:c.250G>A | NP_001171279.1:p.(A84T) | rs5334475139 | 2010 | 19934113 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 136 | OMIA:001493-9685 | domestic cat | Porphyria, acute intermittent | HMBS | substitution | missense | Naturally occurring variant | LP/P | F.catus_Fca126_mat1.0 | D1 | NC_058377.1:g.16581286C>T | NM_001177808.1:c.445C>T | NP_001171279.1:p.(R149W) | rs5334475165 | 2010 | 19934113 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 402 | OMIA:001493-9685 | domestic cat | Porphyria, acute intermittent | HMBS | substitution | splicing | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | D1 | NC_058377.1:g.16583320G>A | NM_001177808.1:c.826-1G>A | rs5334475129 | 2013 | 24239138 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||||
| 501 | OMIA:001493-9685 | domestic cat | Siamese (Cat) | Porphyria, acute intermittent | HMBS | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | D1 | NC_058377.1:g.16583337_16583339del | NM_001177808.1:c.842_844del | NP_001171279.1:p.(G281del) | published as c.842_844delGAG | 2010 | 19934113 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 689 | OMIA:000299-9986 | rabbit | Dwarf, long-haired Holland Lop (Rabbit) Netherland dwarf (Rabbit) | Dwarfism | HMGA2 | dw | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 4 | "that the dwarf allele constitutes a ~12.1 kb deletion overlapping the promoter region and first three exons of the HMGA2 gene leading to inactivation of this gene." | 2017 | 27986804 | |||||||
| 1824 | OMIA:001968-9796 | domestic horse | German Riding Pony (Horse) New Forest Pony (Horse) Shetland Pony (Horse) Welsh Pony (Horse) | small size | HMGA2 | substitution | missense | Naturally occurring variant | Not currently evaluated | TB-T2T | 6 | NC_091689.1:g.94527217G>A | NM_001433493.1:c.83G>A | NP_001420422.1:pG28E | 2015 | 26474182 | ||||
| 727 | OMIA:000317-9913 | taurine cattle | Highland (Cattle) | Ears, crop | HMX1 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 6 | 76bp duplication of 106,720058 to 106,720,133 on BTA6; UMD3 reference assembly | 2013 | 24194898 | ||||||||
| 1153 | OMIA:001952-9940 | sheep | Altay Fat-Rumped, China (Sheep) Awassi (Sheep) Kazakh Fat-Rumped (Sheep) | Microtia | HMX1 | duplication | Naturally occurring variant | Not currently evaluated | Oar_v4.0 | 6 | g.114173249_114173324dup | He et al. (2020) identified a 76 bp duplication in an evolutionary conserved region downstream of HMX1 (duplication of 76bp segment 6:126893417-126893492) in Altay sheep, the variant was later identified in other breeds and validated (PMID:32481741; PMID:38395239). | 2020 | 31691317 | ||||||
| 1728 | OMIA:002878-9823 | pig | Diabetes mellitus, HNF1A-related | HNF1A | insertion, gross (>20) | Transgenesis via somatic cell nuclear transfer (SCNT) | Not currently evaluated | integration of human HNF1⍺ gene with a P291fsinC mutation | 2009 | 19357985 | ||||||||||
| 624 | OMIA:001952-9823 | pig | Microtia | HOXA1 | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 18 | NC_010460.4:g.45478110delinsTC | XM_003134844.5:c.451delinsTC | XP_003134892.1:p.(A151fs) | Previously listed in OMIA as g.45478109delinsTC and p.(L151fs) - corrected on 29/02/2025 | 2015 | 26035869 | ||||
| 1742 | OMIA:002721-9940 | sheep | Tail length, long | HOXB13 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v2.0 | 11 | NC_056064.1:g.37524995_37524996insN[168] | 2022 | 36068271 | ||||||||
| 751 | OMIA:000668-9031 | chicken | Huiyang Bearded, China (Chicken) | Muffs and beard | HOXB8 | complex rearrangement | Naturally occurring variant | Not currently evaluated | 27 | "The Mb allele differs from the wild-type mb allele by three duplications, one in tandem and two that are translocated to that of the tandem repeat around 1.70 Mb on GGA27 | 2016 | 27253709 | ||||||||
| 1296 | OMIA:000240-9031 | chicken | Crested (Chicken) Polish (Chicken) Silkie (Chicken) | Crest | HOXC10 | duplication | Naturally occurring variant | Not currently evaluated | GRCg6a | 33 | g.7587588_7587784dup | "a 197 bp duplication of an evolutionarily conserved sequence located in the intron of HOXC10 on chromosome 33" (Li et al., 2021) | 2021 | 33704432 | ||||||
| 1800 | OMIA:002769-8090 | Japanese medaka | dorsalfinless | hoxc11a | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 7 | insertion of 12.8 kb transposon-like DNA in 3′ UTR of hoxc11a resulting in reduced expression of hoxc11a |
2024 | 38861596 | |||||||||
| 1286 | OMIA:000806-9925 | goat | Polyceraty | HOXD1 | delins, gross (>20) | Naturally occurring variant | Not currently evaluated | ARS1.2 | 2 | NC_030809.1:g.115652290_116155699delins137kb | 2021 | 33528505 | ||||||||
| 1285 | OMIA:000806-9940 | sheep | Damara (Sheep) Hebridean (Sheep) Jacob (Sheep) Manx Loaghtan (Sheep) Navajo-Churro (Sheep) Sishui, China (Sheep) | Polyceraty | HOXD1 | deletion, small (<=20) | splicing | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 2 | NC_040253.1:g.144548739_144548742del | "a four-nucleotide deletion located at position +4 to +7 bp after exon 1 of the HOXD1 gene ([Oar_v4.0] g.132,832,249_132,832,252del; . . . ), i.e. encompassing three nucleotides (+4, +5, +6) of the consensus splice donor site" (Allais-Bonnet et al., 2021) | 2021 | 33528505 | |||||
| 691 | OMIA:000081-9796 | domestic horse | Arab (Horse) | Atlanto occipital fusion | HOXD3 | deletion, gross (>20) | Naturally occurring variant | VUS | 18 | "a 2.7-kb deletion located 4.4 kb downstream of the end of HOXD4 and 8.2 kb upstream of the start of HOXD3." | 2017 | 28111759 | ||||||||
| 1215 | OMIA:002275-9615 | dog | French Bulldog (Dog) | Coat colour, Cocoa | HPS3 | HPS3^co | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 23 | NC_006605.3:g.43969695G>A | XM_542830.6:c.2420G>A | XP_542830.3:p.(T807*) | XM_542830.6:c.2420G>A; XP_542830.3:p.(Trp807*) | 2020 | 32526956 | ||
| 1731 | OMIA:002275-452646 | American mink | Coat colour, Royal pastel | HPS3 | b | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | NNQGG.v01 | 6 | NC_058096.1:g.75137871_75137872ins[OR863243];75137865_75137871 | 2024 | 38956930 | |||||||
| 789 | OMIA:002116-69293 | three-spined stickleback | Coat colour, albinism, oculocutaneous, HPS5-related | Hps5 | casper | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | "casper mutants have an insertion of a single nucleotide in the 6th exon of Hsp5, predicted to generate an early frameshift" | 2017 | 28739598 | ||||||||
| 1423 | OMIA:002116-9685 | domestic cat | Donskoy (Cat) | Pink-eye | HPS5 | substitution | splicing | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | D1 | NC_058377.1:g.74250261C>T | XM_023239634.2:c.2571-1G>A | 2020 | 32558164 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||||
| 1222 | OMIA:002229-9685 | domestic cat | Lykoi (Cat) | Hypotrichia and Roaning | HR | hr^TN | duplication | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.35878965_35878966dupGT | XM_023252512.2:c.1255_1256dup | XP_023108280.2:p.(Q420Sfs*100) | published as c.1255_1256dupGT | 2020 | 32580512 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 1224 | OMIA:002229-9685 | domestic cat | Lykoi (Cat) | Hypotrichia and Roaning | HR | hr^Fr | delins, small (<=20) | splicing | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.35879114delinsCAG | XM_023252512.2:c.1402+2delinsCAG | published as c.1404+2delTinsCAG; changed to HGVS nomenclature and recent transcript information in this table; "This variant should extend and change the reading frame, including an additional 24 amino acids in the aberrant protein before a stop codon is recognized. Alternatively, a cryptic splice site may be used from within intron 4." (Buckley et al., 2020) | 2020 | 32580512 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1225 | OMIA:002229-9685 | domestic cat | Lykoi (Cat) | Hypotrichia and Roaning | HR | hr^TX | substitution | splicing | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.35883950G>A | XM_023252512.2:c.2112G>A | "This variant likely disrupts the splice donor allowing read-through for an additional 12 amino acids until a stop codon is encountered .... Alternatively, a cryptic splice site may be used from within intron 8." (Buckley et al., 2020) | rs5334475128 | 2020 | 32580512 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 1226 | OMIA:002229-9685 | domestic cat | Lykoi (Cat) | Hypotrichia and Roaning | HR | hr^NC | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.35885221C>T | XM_023252512.2:c.2239C>T | XP_023108280.2:p.(R747*) | previously listed as c.2243C>T, p.(R748*) - updated to reflect recent transcript information [12/07/2025] | rs5334475155 | 2020 | 32580512 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. |
| 1227 | OMIA:002229-9685 | domestic cat | Lykoi (Cat) | Hypotrichia and Roaning | HR | hr^Ca | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.35885692C>T | XM_023252512.2:c.2593C>T | XP_023108280.2:p.(Q865*) | rs5334475120 | 2020 | 32580512 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 1223 | OMIA:002229-9685 | domestic cat | Lykoi (Cat) | Hypotrichia and Roaning | HR | hr^VA | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.35889728_35889729insGACA | XM_023252512.2:c.3389_3390insGACA | XP_023108280.2:p.(S1130Rfs*29) | ENSFCAT00000012982.5; ENSFCAP00000012037.2; published as g.36051555insGACA and c.3389insGACA; changed to reflect HGVS nomenclature in this table | 2020 | 32580512 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 331 | OMIA:001348-9544 | Rhesus monkey | Atrichia with papular lesions | HR | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | MMUL_1 | 8 | g.22046679C>T | c.1831C>T | p.(R611*) | 2002 | 11831740 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||||
| 319 | OMIA:002229-9940 | sheep | Valle del Belice, Italy (Sheep) | Hypotrichosis | HR | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 2 | NC_040253.1:g.45703202C>T | XM_027964354.1:c.1312C>T | XP_027820155.1:p.(Q438*) | Oar_v3.1 position is g.43224867C>T | rs423413166 | 2003 | 12927087 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 1095 | OMIA:002777-9615 | dog | Dachshund (Dog) | Disorder of sexual development, HSD17B3-related | HSD17B3 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 1 | g.70554301_70554302del | c.159_160del | p.(T54Wfs*13) | XM_003638870.2; XP_003638918.1; deletion CA | 2019 | 31476086 | |||
| 456 | OMIA:001758-9615 | dog | Australian Shepherd (Dog) | Cataract, early onset | HSF4 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 5 | g.82198114del | c.971del | p.(P324Hfs*87) | NM_001048121.1; NP_001041586.1; published as g.85286582delC | 2006 | 16939467 | |||
| 568 | OMIA:001758-9615 | dog | Boston Terrier (Dog) Staffordshire Bull Terrier (Dog) | Cataract, early onset | HSF4 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 5 | g.82198114_82198115insG | c.971_972insC | p.(L325Tfs*28) | NM_001048121.1; NP_001041586.1; published as g.85286582_85286583insC | 2006 | 16939467 | |||
| 919 | OMIA:001319-9913 | taurine cattle | Holstein Friesian (Cattle) | Myopathy of the diaphragmatic muscles | HSPA1A | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 23 | Deletion of one of two HSP70 (heat-shock protein) genes in the bovine major histocompatibility complex | 2003 | 12755819 | ||||||||
| 204 | OMIA:001817-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Perinatal weak calf syndrome | IARS | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 8 | NC_037335.1:g.83909754C>G | NM_001101069.2:c.235G>C | NP_001094539.1:p.(V79L) | rs5334475110 | 2013 | 23700453 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1604 | OMIA:000706-9615 | dog | Nederlandse Kooikerhondje (Dog) | Necrotising myelopathy | IBA57 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 14 | g.801179G>A | c.439C>T | p.(R147W) | XM_038686047.1; XP_038541975.1 | 2023 | 37588046 | |||
| 1786 | OMIA:000664-9542 | Japanese macaque | Mucopolysaccharidosis I | IDUA | substitution | missense | Naturally occurring variant | Not currently evaluated | c.786 C>A | p.(H262Q) | 2025 | 40251406 | ||||||||
| 1237 | OMIA:000664-9615 | dog | Golden Retriever (Dog) | Mucopolysaccharidosis I | IDUA | deletion, gross (>20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 3 | g.91523238_91523524del | c.1400-76_1521+89del | p.(G467_E507del) | NM_001313883.1; NP_001300812.1 | 2020 | 32785987 | |||
| 1190 | OMIA:000664-9615 | dog | Boston Terrier (Dog) | Mucopolysaccharidosis I | IDUA | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 3 | g.91534556_91534557insGGGGGCCG | c.19_20insCGGCCCCC | p.(R7Pfs) | NM_001313883.1; NP_001300812.1 | 2020 | 32300136 | |||
| 911 | OMIA:000664-9615 | dog | Plott Hound (Dog) | Mucopolysaccharidosis I | IDUA | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 3 | NC_006585.3:g.91534420C>T | NM_001313883.1:c.155+1G>A | NM_001313883.1 | rs1152388407 | 1992 | 1339393 | |||
| 500 | OMIA:000664-9685 | domestic cat | Domestic Shorthair (Cat) | Mucopolysaccharidosis I | IDUA | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.204935473_204935475del | NM_001305032.1:c.1041_1043del | NP_001291961.1:p.(D348del) | a 3 bp deletion in the IDUA gene; previously listed as c.1042_1044del updated to recent transcript [09/07/2025] | 1999 | 10356309 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1301 | OMIA:002320-9615 | dog | Lapponian Herder (Dog) | Progressive retinal atrophy | IFT122 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 20 | NC_006602.3:g.5648046C>T | XM_533734.6:c.3176G>A | XP_533734.2:p.(R1059H) | Protein and CDS positions based on XP_533734.2 and XM_533734.6 | 2021 | 33606121 | |||
| 1396 | OMIA:001823-9913 | taurine cattle | Holstein Friesian (Cattle) | Haplotype with homozygous deficiency-HH2 | IFT80 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 1 | NC_037328.1:g.107172616del | NM_001098959.1:c.1155del | NP_001092429.1:p.(L385Ffs*3) | published as g.107172616delT, ENSBTAT00000044761.4:c.1140del ENSBTAP00000042227.4:p.Leu381PhefsTer3, c. and p. coordinates updated to NCBI transcripts [29/08/2024] | rs523422030 | 2021 | 34873723 | ||
| 1422 | OMIA:002524-9615 | dog | Height, IGF1-AS related | IGF1-AS (LOC111090066) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 15 | g.41219654T>C | r.1043T>C | XR_002614246.1; C allele associated with smaller height, T allele associated with larger height | rs22397284 | 2022 | 35090588 | ||||||
| 687 | OMIA:000006-9031 | chicken | Chinese Xingyi bantam, China (Chicken) | Achondroplasia, creeper | IHH | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | Gallus_gallus-4.0 | 7 | g.21798705_21810600del | "a 11,896bp large deletion region (chr7: 21,798,705-21,810,600) covering the entire Indian hedgehog (IHH) gene" | 2016 | 27439785 | ||||||
| 337 | OMIA:001899-9796 | domestic horse | Quarter Horse (Horse) Warmblood (Horse) | Incontinentia pigmenti | IKBKG | substitution | nonsense (stop-gain) | Naturally occurring variant | P | EquCab3.0 | X | NC_009175.3:g.126898409C>T | NM_001284533.1:c.184C>T | NP_001271462.1:p.(R62*) | Previously listed as as c.202C>T and p.(R68*), updated in this table to reflect NM_001284533.1 transcript | rs3433281055 | 2013 | 24324710 | Breed information updated based on PMID: 38600096 | |
| 1202 | OMIA:002271-9913 | taurine cattle | Holstein Friesian (Cattle) | Immunodeficiency, IL17Ra-related | IL17RA | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.108813252del | XM_015460734.2:c.180del | XP_015316220.2:p.(C61Afs*62) | published as g.108813251delC, g. coordinates in this table updated to reflect HGVS nomenclature (3' rule) [03/09/2024] | rs5334474974 | 2020 | 32448141 | ||
| 584 | OMIA:000899-9615 | dog | Cardigan Welsh Corgi (Dog) | Severe combined immunodeficiency disease, X-linked | IL2RG | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | g.55483461_55483462insG | c.583_584insC | p.(R195Pfs*5) | NM_001003201.1; NP_001003201.1; "a single nucleotide insertion causing a frameshift". The variant could also be described as a duplication of a cytosine (c.583dup). | 1995 | 8571541 | |||
| 476 | OMIA:000899-9615 | dog | Basset Hound (Dog) | Severe combined immunodeficiency disease, X-linked | IL2RG | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | g.55484657_55484660del | c.30_33del | p.(L11Yfs) | NM_001003201.1; NP_001003201.1; c.30_33delCCTC | 1994 | 7829104 | |||
| 1622 | OMIA:002763-9541 | crab-eating macaque | Severe combined immunodeficiency disease | IL2RG | substitution | nonsense (stop-gain) | Base-editing | Not currently evaluated | Macaca_fascicularis_5.0 | X | g.68110639G>A | c.391C>T | p.(Q131*) | XM_005593892.2; XP_005593949.1 | 2023 | 37661226 | ||||
| 1253 | OMIA:002289-9615 | dog | Lhasa Apso (Dog) | Progressive retinal atrophy 4 (PRA4) | IMPG2 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 33 | " LINE-1 insertion was identified within the critical region in this PRA-affected LA, situated within 200 bp upstream of the interphotoreceptor matrix proteoglycan 2 (IMPG2) gene within the following coordinates: CANFA33: 7,785,475-7,785,491" (Hitti-Malin et al., 2020) | 2020 | 32894063 | |||||||
| 1034 | OMIA:002173-9615 | dog | Norwich Terrier (Dog) | Diffuse cystic renal dysplasia and hepatic fibrosis | INPP5E | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | NC_006591.3:g.49069064G>A | XM_005625109.3:c.1572+5G>A | Dillard et al. (2018): "the identified variant introduces a novel splice site in INPP5E causing a frameshift and formation of a premature stop codon." | 2018 | 30235266 | ||||
| 962 | OMIA:001675-61379 | black-footed cat | Cone-rod dystrophy 2 | IQCB1 | deletion, small (<=20) | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.1282delCT | p.(L428*) | 2017 | 28322220 | ||||||||
| 606 | OMIA:001675-9615 | dog | American Pit Bull Terrier (Dog) | Cone-rod dystrophy 2 | IQCB1 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 33 | g.25078909_25078910insC | c.952_53insC | p.(S319Ifs*12) | 2013 | 24045995 | ||||
| 805 | OMIA:001528-9940 | sheep | INRA 401, France (Sheep) | Fleece variation, woolly | IRF2BP2 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 25 | insertion of an antisense EIF2S2 retrogene (called asEIF2S2) into the 3' UTR of the IRF2BP2 gene | 2017 | 28379502 | |||||||
| 1711 | OMIA:000284-10036 | golden hamster | Diabetes mellitus, type 2 | Irs2 | deletion, gross (>20) | Genome-editing (CRISPR-Cas9) | Not currently evaluated | 2653-bp deletion in exon 1 | 2024 | 39134590 | ||||||||||
| 336 | OMIA:001886-9615 | dog | Chinook (Dog) Karelian Bear Dog (Dog) Norwegian Elkhound (Dog) | Chondrodysplasia, disproportionate short-limbed | ITGA10 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 17 | NC_006599.3:g.58703935G>A | XM_845262.4:c.2083C>T | XP_850355.1:p.(R695*) | XM_845262.4; XP_850355.1, additional breed inforamtion based on PMID:27525650 | 2013 | 24086591 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 1569 | OMIA:001000-9615 | dog | Golden Retriever (Dog) | Thrombastenia | ITGA2B | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | 9 | Published in a conference proceeding as (1924delC) | 2017 | Reference not in PubMed; see OMIA 001000-9615 for reference details | ||||||||
| 369 | OMIA:001000-9615 | dog | Great Pyrenees (Dog) | Thrombasthenia | ITGA2B | duplication | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | g.19057144_19057157dup | c.1360_1373dup | NM_001003163.2; NP_001003163.1; experimentally confirmed splice defect; a 14-base duplication in exon 13 and defective splicing of intron 13 | 2000 | 11105947 | ||||
| 80 | OMIA:001000-9615 | dog | Otterhound (Dog) | Thrombasthenia | ITGA2B | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | NC_006591.3:g.19054488G>C | NM_001003163.2:c.1192G>C | NP_001003163.1:p.(D398H) | NM_001003163.2; NP_001003163.1; published as c.1193G>C / c.1100G>C; substitution of histidine for aspartic acid at position 398 (367). Coordinates in the table have been updated to a recent reference genome and or transcripts. | 2001 | 11703027 | Breed was incorrectly listed as Scottish Deerhound. Changed to Otterhound [19/5/2023] | ||
| 1568 | OMIA:001000-9615 | dog | Mixed Breed (Dog) | Thrombasthenia | ITGA2B | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | NC_006591.3:g.19057141C>T | 1357C>T | NP_001003163.1:p.(R453*) | NM_001003163.2; NP_001003163.1; published as (C1264T) and (R422X), coordinates in this table have been updated to a recent reference genome | 2016 | 26764135 | |||
| 164 | OMIA:001000-9796 | domestic horse | Quarter Horse (Horse) Thoroughbred (Horse) | Thrombasthenia | ITGA2B | substitution | missense | Naturally occurring variant | P | EquCab3.0 | 11 | NC_009154.3:g.19245752G>C | NM_001081793.1:c.215G>C | NP_001075262.1:p.(R72P) | NM_001081793.1; NP_001075262.1; originally published as p.(R41P) and listed by Leite et al. (2019) as c.122G>C; coordinates in this table have been updated to a recent reference genome and / or transcript | 2006 | 16407493 | |||
| 512 | OMIA:001000-9796 | domestic horse | Peruvian Paso (Horse) Quarter Horse (Horse) | Thrombasthenia | ITGA2B | deletion, small (<=20) | Naturally occurring variant | P | EquCab3.0 | 11 | NC_009154.3:g.19247983_19247992del | g.19247983_19247992delCAGGTGAGGA | 2007 | 17338169 | g. coordinates obtained from Dahlgren et al. (2020) | |||||
| 1245 | OMIA:001000-9685 | domestic cat | Domestic Shorthair (Cat) | Glanzmann's thrombasthenia | ITGA2B | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | E1 | NC_058381.1:g.42487303del | XM_003996987.6:c.1839del | XP_003997036.4:p.(P613fs) | published as c.1986delC; p.Pro662fs (Li et al., 2020), previously listed here as Felis_catus 9.0 g.44416063del; coordinates updated to reflect HGVS 3' rule and recent reference genome and transcript [07/07/2025] | rs5334475153 | 2020 | 32935881 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 1809 | OMIA:001000-9685 | domestic cat | Domestic Shorthair (Cat) | Thrombasthenia | ITGA2B | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Felis_catus 9.0 | E1 | NC_018736.3:g:44416063_44416064insGG | XM_003996987.5:c.1839_1840insCC | XP_003997036.3:p.(E614fs) | Published as ENSFCAT00000003056.6:c.1986_1987insCC | 2024 | 38426552 | |||
| 1185 | OMIA:002261-9913 | taurine cattle | Holstein (black and white) (Cattle) | de novo mutation in an AI sire | ITGA3 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 19 | g.36586185G>A | p.(T252M) | Bourneuf et al. (2017) detected ITGA3 g.37219021G>A; p.T252M as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Holstein AI bull. No information was provided on the descendants of this bull. | rs5334475090 | 2017 | 28904385 | |||
| 1577 | OMIA:002718-9913 | taurine cattle | Charolais (Cattle) | Epidermolysis bullosa, junctional, ITGA6-related | ITGA6 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.24112740C>A | NM_001109981.1:c.2160+1G>T | NP_001103451.1:p.(I657Mfs) | NM_001109981.1 | 2023 | 37308849 | |||
| 197 | OMIA:000595-9913 | taurine cattle | Blanco Orejinegro, Colombia (Cattle) Holstein Friesian (Cattle) Jersey (Cattle) Simmental (Cattle) | Leukocyte adhesion deficiency, type I | ITGB2 | BLAD | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 1 | NC_037328.1:g.144770078T>C | NM_175781.1:c.383A>G | NP_786975.1:p.(D128G) | Variant initially identified in Holstein Friesian cattle and later reported in additional breeds. | rs445709131 | 1992 | 1384046 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries. |
| 53 | OMIA:000595-9615 | dog | Irish Red and White Setter (Dog) Irish Setter (Dog) | Leukocyte adhesion deficiency, type I | ITGB2 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 31 | NC_006613.3:g.38537012C>G | XM_014109833.2:c.107G>C | XP_013965308.1:p.(C36S) | ROS_Cfam_1.0: g.38142116C>G ENSCAFT00845038113.1:c.107G>C ENSCAFP00845029856.1:p.Cys36Ser | rs1152388503 | 1999 | 10512685 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 775 | OMIA:000595-9685 | domestic cat | Leukocyte adhesion deficiency, type I | ITGB2 | ITGB-2 missing exon 2 | deletion, gross (>20) | splicing | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | C2 | NC_058376.1:g.1764454_1764477del | XM_045036502.1:c.46_58+11del | Bauer et al. (2017) "24 bp deletion at the exon 2 to intron 2 boundary (c.46_58 + 11del), predicting premature translational termination due to abnormal splicing of exon 1 to exon 3 or 4 | 2017 | 28750142 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 684 | OMIA:001948-9913 | taurine cattle | Charolais (Cattle) | Epidermolysis bullosa, junctionalis, ITGB4 | ITGB4 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 19 | "a 4.4 kb deletion involving exons 17 to 22" of the ITGB4 gene | 2015 | 25890340 | ||||||||
| 1272 | OMIA:001948-9940 | sheep | Mouton vendéen, France (Sheep) | Epidermolysis bullosa, junctionalis, ITGB4 | ITGB4 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 11 | NC_040262.1:g.7412626C>T | XM_027974087.1:c.2791C>T | XP_027829888.1:p.(R931*) | Published as OAR11_v4.0, g.54799925G>A / p.Arg885* | 2020 | 33225458 | |||
| 543 | OMIA:001948-9940 | sheep | Spanish Churro (Sheep) | Epidermolysis bullosa, junctionalis, ITGB4 | ITGB4 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 11 | NC_040262.1:g.7425460_7425463del | XM_027974087.1:c.4412_4415del | Oar_v3.1: g.54849767_54849770del | 2015 | 25955497 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||||
| 1716 | OMIA:002872-9913 | taurine cattle | Holstein Friesian (Cattle) | Bovine lymphocyte intestinal retention defect | ITGB7 | BLIRD | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.26807079G>A | NP_001098835.1:904G>A | NP_001098835.1:p.(G302S) | Published as ENSBTAT00000025279.5:p.(G375S) | rs444441523 | 2023 | Reference not in PubMed; see OMIA 002872-9913 for reference details | |
| 754 | OMIA:002097-9615 | dog | Italian Spinone (Dog) | Ataxia, spinocerebellar | ITPR1 | repeat variation | Naturally occurring variant | Not currently evaluated | 20 | Forman et al. (2015) identified an expanded GAA-repeat in intron 35 of the ITPR1 gene in affected dogs. The wildtype sequence contains 8 GAA repeats. The expanded disease-associated alleles carry an estimated 318-651 GAA repeats. | 2015 | 25354648 | ||||||||
| 1769 | OMIA:002916-9615 | dog | Lancashire Heeler (Dog) | Charcot-Marie-Tooth disease 1J with amelogenesis imperfecta | ITPR3 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 12 | NC_049233.1:g.12:3214076C>T | XM_038553756.1:c.5002C>T | XP_038409684:p.(Q1668X) | 2025 | 39804930 | ||||
| 739 | OMIA:000809-9615 | dog | Mixed Breed (Dog) | Polycythemia | JAK2 | delins, small (<=20) | delins (in-frame) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 1 | g.93416506_93416510delinsTTCCT | c.1849_1853delinsTTCCT | p.(V617_C618delinsFL) | XM_022421838.1; XP_022277546.1; published as a three-base change in codons 617 and 618 of JAK2 giving rise to V617F and C618L, SOMATIC MUTATION/MOSAICISM | 2011 | 21320566 | |||
| 1794 | OMIA:002943-9615 | dog | Shih Tzu (Dog) | Retinal atrophy, progressive, JPH2-related | JPH2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 24 | c.452A>C | p.L151X | 2021 | 34231238 | |||||
| 1390 | OMIA:002483-9913 | taurine cattle | Neuromuscular channelopathy | KCNG1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 13 | NC_037340.1:g.78918850C>A | NM_001205719.1:c.1248G>T | NP_001192648.1:p.(W416C) | NM_001205719.1; NP_001192648.1 | rs3423356335 | 2021 | 34828398 | |||
| 1154 | OMIA:002240-9615 | dog | Norwegian Buhund (Dog) | Ataxia, cerebellar, KCNIP4-related | KCNIP4 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 3 | NC_006585.3:g.88890674T>C | XM_005618660.3:c.436T>C | XP_005618717.1:p.(T146R) | XM_005618660.3; XP_005618717.1 | 2020 | 31999692 | |||
| 612 | OMIA:002089-9615 | dog | Huntaway (Dog) Jack Russell Terrier (Dog) New Zealand Heading Dog (Dog) | Ataxia, cerebellar, KCNJ10-related | KCNJ10 | insertion, small (<=20) | regulatory | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 38 | g.22141027insC | c.*214_*215insC | XM_005640901.1; Gast et al. (2016) "Bioinformatic analysis using RegRNA indicated the KCNJ10:g.22141027insC affecting regulation of gene expression via a regulatory RNA motif or miRNA target site." Additional breeds based on PMID:40965331 | rs1152388457 | 2016 | 27724896 | |||
| 945 | OMIA:002089-9615 | dog | Dachshund (Dog) Jack Russell Terrier (Dog) Parson Russell Terrier (Dog) Russell Terrier (Dog) Smooth Fox Terrier (Dog) Tenterfield Terrier (Dog) | Ataxia, cerebellar, KCNJ10-related | KCNJ10 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 38 | NC_006620.3:g.22140300C>G | XM_545752.6:c.627C>G | XP_545752.3:p.(I209M) | rs1152388456 | 2014 | 37905444 25998802 24708069 | Genomic coordinates in CanFam3.1 and EVA ID provided by Zoe Shmidt and Robert Kuhn. | ||
| 947 | OMIA:002089-9615 | dog | Belgian Shepherd Dog (Dog) Belgian Shepherd Dog, Malinois (Dog) Bouvier des Ardennes (Dog) | Spongy degeneration with cerebellar ataxia 1 (SDCA1) | KCNJ10 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 38 | NC_006620.3:g.22140659T>C | XM_545752.6:c.986T>C | XP_545752.3:p.(L329P) | 2017 | 36426918 27966545 28007838 | Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. | |||
| 1596 | OMIA:002332-9615 | dog | English Springer Spaniel (Dog) | Long QT syndrome | KCNQ1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 18 | NC_006600.3:g.46604412C>A | XM_022405121.1:c.770C>A | XP_022260829.1:p.(T257K) | XM_022405121.1; XP_022260829.1; published as "Genbank KF439050, KCNQ1_T377K" - coordinates in this table are updated to a recent reference genome. | 2015 | 25779927 | |||
| 196 | OMIA:001722-9913 | taurine cattle | Marchigiana (Cattle) Romagnola (Cattle) | Lethal multi-organ developmental dysplasia | KDM2B | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 17 | NC_037344.1:g.53761149G>A | XM_005217983.4:c.2503G>A | XP_005218040.1:p.(D835N) | rs5334475109 | 2012 | 23029151 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 207 | OMIA:002390-9913 | taurine cattle | Brown Swiss (Cattle) Original Swiss Brown (Cattle) | Spinal muscular atrophy | KDSR | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 24 | g.61620302C>T | c.562G>A | p.(A188T) | rs5334475102 | 2007 | 17420465 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 604 | OMIA:000979-9031 | chicken | Talpid-3 | KIAA0586 | insertion, small (<=20) | Naturally occurring variant | Not currently evaluated | 5 | insT | 2006 | 16702409 | |||||||||
| 1005 | OMIA:000527-9913 | taurine cattle | Angus (Cattle) Charolais (Cattle) Uckermärker, Germany (Cattle) | Progressive ataxia | KIF1C | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.26407668C>T | NM_001205802.2:c.608G>A | NP_001192731.2:p.(R203Q); p.(R203_T204delinsQ*) | ENSBTAT00000081136.1:c.608G>A ENSBTAP00000062635.1:p.Arg203Gln Duchesne et al. (2018): "This substitution has two effects: firstly, it modifies a conserved amino acid (p.R203Q). Secondly, it causes an alternative splicing event, resulting in exon 5 skipping in most of the transcripts (p.RT203-204QStop) associated with a drastic reduction of overall mRNA expression and leading to the absence of detectable KIF1C protein in brain extracts from affected cattle." The variant was initially reported in Charolais cattle and later reported in additional breeds (see PMIDs 38338009 and 32281115). | rs800926237 | 2018 | 30067756 | ||
| 1231 | OMIA:002283-9823 | pig | Large White (Pig) | Arthrogryposis multiplex congenita, KIF21A-related | KIF21A | insertion, gross (>20) | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 5 | NC_010447.5:g.70964237_70964238insAAGATAGAGGTTCTTTCCTCTAGACTTGAGGTTCTCCTGGTGTGACAGATGGTTCTTTCCTCT | XM_013997927.2:c.124_125insAGAGGAAAGAACCATCTGTCACACCAGGAGAACCTCAAGTCTAGAGGAAAGAACCTCTATCTT | XP_013853381.2:p.(F42*) | published as NC_010447.5:g70964237_ g70964238insAAGATAGAGGTTCTTTCCTCTAGACTTGAGGTTCTCCTGGTGTGACAGATGGTTCTTTCCTCT; p.Val41_Phe42insTer) (Fang et al., 2020) | rs5334475173 | 2020 | 32686171 | ||
| 1191 | OMIA:002267-9685 | domestic cat | Bengal (Cat) Highlander (Cat) Highlander Shorthair (Cat) Savannah (Cat) | Progressive retinal atrophy | KIF3B | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A3 | NC_058370.1:g.26520830C>T | XM_006929856.5:c.1000G>A | XP_006929918.1:p.(A334T) | rs5334475117 | 2020 | 32386558 | The genomic location on Felis_catus_9.0 is based on Rodney et al. 2021 (PMID: 33785770). Additional breeds reported based on PMID:35709088. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1440 | OMIA:001836-9913 | taurine cattle | Holstein-Friesian, Switzerland (Cattle) | Abortion due to haplotype HH13 | KIR2DS1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 18 | NC_037345.1:g.62758881G>A | NM_001097567.1:c.475C>T | NP_001091036.1:p.(Q159*) | NM_001097567.1; NP_001091036.1 | rs437566778 | 2022 | 35361830 | ||
| 1525 | OMIA:001652-9627 | red fox | Platinum coat colour | KIT | substitution | splicing | Naturally occurring variant | Not currently evaluated | G>A variant in the first nucleotide of KIT intron 17 causes skipping of exon 17 | 2015 | 25662789 | |||||||||
| 1818 | OMIA:000209-30521 | domestic yak | Coat colour, white | KIT | deletion, small (<=20) | regulatory | Naturally occurring variant | Not currently evaluated | 6 | 14bp deletion in KIT promoter | 2025 | 40629379 | ||||||||
| 979 | OMIA:000209-9823 | pig | Dominant white | KIT | I | complex rearrangement | Naturally occurring variant | Not currently evaluated | 8 | This dominant white allele carries at least three causal polymorphisms, namely a 450 kb duplication (originally reported by Johansson Moller (1996); also present in Patch - see OMIA 001743-9825), the splice mutation reported by Marklund et al. (1998) (unique to Dominant white) and smaller duplication(s) (that occur within the 450kb duplication) causing Belt (see OMIA 001745-9825).(with thanks to Leif Andersson). To emphasise the original discovery of the duplication, the ref cited here is Johansson Moller (1996) | 1996 | 8875890 | ||||||||
| 1116 | OMIA:001576-9913 | taurine cattle | Berrenda en Negro, Spain (Cattle) Cikasto govedo, Slovenia (Cattle) Evolèner, Switzerland (Cattle) Gloucester, United Kingdom of Great Britain and Northern Ireland (Cattle) Herens (Cattle) Pinzgau (Cattle) Tux-Zillertaler, Austria (Cattle) | Pinzgauer spotting | KIT | KIT^PINZ | complex rearrangement | Naturally occurring variant | Not currently evaluated | 6 | Briefly: the KIT^PINZ variant is "characterized by the fusion of a duplicated chromosome 4 segment into a deleted part of chromosome 6." (Küttel et al., 2019) In more detail: "a complex structural variant characterized by a ~9.4-kb deletion . . . and in silico evidence for a duplication of ~1.5 kb about 34 kb farther downstream . . . . Apparently, the duplicated copy of the ~1.5-kb segment appears inversely inserted at the upstream breakpoint of the ~9.4-kb deletion . . . . Furthermore, we noticed at the upstream breakpoint of the inversely inserted segment chimeric read pairs in which both ends mapped to chromosome 6 and 4 . . . . The inspection of the sequence coverage of the involved genome region on chromosome 4 indicated a ~310-kb duplication from 84 864 544 to ~85 174 000 bp". (Küttel et al., 2019) | 2019 | 31294880 | |||||||
| 1133 | OMIA:001576-9913 | taurine cattle | Belgian Blue (Cattle) Bohuskulla, Sweden (Cattle) Brown Swiss (Cattle) Fjällnära boskap, Sweden (Cattle) Svensk Fjällras (Cattle) Svensk kullig boskap (skb), Sweden (Cattle) | Coat colour, colour-sided | KIT | Cs(6) | complex rearrangement | Naturally occurring variant | Not currently evaluated | 6 | Durkin et al. (2012): "colour sidedness is determined by a first allele on chromosome 29 (Cs(29)), which results from the translocation of a 492-kilobase chromosome 6 segment encompassing KIT to chromosome 29, and a second allele on chromosome 6 (Cs(6)), derived from the first by repatriation of fused 575-kilobase chromosome 6 and 29 sequences to the KIT locus. We provide evidence that both translocation events involved circular intermediates. This is the first example, to our knowledge, of a phenotype determined by homologous yet non-syntenic alleles that result from a novel copy-number-variant-generating mechanism." | 2012 | 22297974 | Additional breeds based on PMID:40624682 | ||||||
| 715 | OMIA:001743-9823 | pig | Coat colour, patch | KIT | duplication | Naturally occurring variant | Not currently evaluated | 8 | the patch allele comprises a 450kb duplication that includes KIT (roughly in the middle) | 1998 | 9724328 | |||||||||
| 743 | OMIA:001745-9823 | pig | Essex, United Kingdom of Great Britain and Northern Ireland (Pig) Hampshire Down (Sheep) Schwäbisch Hällisches Schwein, Germany (Pig) Wessex Saddleback (Pig) | White belt | KIT | complex rearrangement | Naturally occurring variant | Not currently evaluated | 8 | Hampshire pigs (belted phenotype) have "a 4.3-kb duplication (DUP2) located ~¼100 kb upstream of KIT and a 23-kb duplication (DUP3) ~100 kb downstream of KIT, which in turn contained a fourth ~4.3-kb duplication (DUP4) not present on wild-type chromosomes". Across four breeds, belted pigs always had DUP2 and DUP4, but some lacked DUP3. | 2012 | 23151514 | ||||||||
| 748 | OMIA:000426-9913 | taurine cattle | Bohuskulla, Sweden (Cattle) Chillingham (Cattle) Fjällnära boskap, Sweden (Cattle) Pohjoissuomenkarja, Finland (Cattle) Svensk Fjällras (Cattle) Svensk kullig boskap (skb), Sweden (Cattle) Väneko, Sweden (Cattle) | Gonadal hypoplasia | KIT | cs(29) | complex rearrangement | Naturally occurring variant | Not currently evaluated | 29 | "gonadal hypoplasia in Northern Finncattle and Swedish Mountain cattle is associated with a complex chromosomal rearrangement including a ~500kb duplicated segment from BTA6 which is translocated to BTA29. This duplicated segment includes the entire coding sequence of the KIT gene" | 2013 | 24086604 | Additional breed information based on Hall et al. (2021) and PMID:40624682 | ||||||
| 749 | OMIA:001576-9913 | taurine cattle | Belgian Blue (Cattle) Bohuskulla, Sweden (Cattle) Brown Swiss (Cattle) Fjällnära boskap, Sweden (Cattle) Galloway (Cattle) Pohjoissuomenkarja, Finland (Cattle) Svensk Fjällras (Cattle) Svensk kullig boskap (skb), Sweden (Cattle) Väneko, Sweden (Cattle) White Park, United Kingdom of Great Britain and Northern Ireland (Cattle) | Coat colour, colour-sided | KIT | Cs(29) | complex rearrangement | Naturally occurring variant | Not currently evaluated | 29 | Durkin et al. (2012): "colour sidedness is determined by a first allele on chromosome 29 (Cs(29)), which results from the translocation of a 492-kilobase chromosome 6 segment encompassing KIT to chromosome 29, and a second allele on chromosome 6 (Cs(6)), derived from the first by repatriation of fused 575-kilobase chromosome 6 and 29 sequences to the KIT locus. We provide evidence that both translocation events involved circular intermediates. This is the first example, to our knowledge, of a phenotype determined by homologous yet non-syntenic alleles that result from a novel copy-number-variant-generating mechanism." | 2012 | 22297974 | Additional breeds based on PMID:40624682 | ||||||
| 566 | OMIA:001737-9838 | Arabian camel | Coat colour, white spotting, KIT-related | KIT | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | c.1842delG | p.(M614Ifs*5) | 2017 | 28282952 | ||||||||
| 403 | OMIA:000209-494514 | Arctic fox | Coat colour, dominant white | KIT | substitution | splicing | Naturally occurring variant | Not currently evaluated | c.1867+1G>T | 2013 | 24308634 | |||||||||
| 1762 | OMIA:001737-9913 | taurine cattle | Coat colour, colour-headed | KIT | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 6 | The ARS-UCD1.2 reference genome was generated from a white-headed Hereford. Colour-headed cattle have a deletion of 20.6 kb upstream of KIT relative to the ARS-UCD1.2 reference genome. | 2024 | 39694857 | ||||||||
| 1763 | OMIA:001737-9913 | taurine cattle | Hereford (Cattle) | Coat colour, white-headed | KIT | complex rearrangement | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 6 | The ARS-UCD1.2 reference genome was generated from a white-headed Hereford and contains two copies of a segmental duplication upstream of KIT associated with depigmentation in white-headed cattle. The segments miss 1.8 kb and 800 bp of sequence, respectively, relative to the full 14.3 kb sequence observed in Simmental cattle. | 2024 | 39694857 | |||||||
| 1764 | OMIA:001737-9913 | taurine cattle | Simmental (Cattle) | Coat colour, white-headed | KIT | complex rearrangement | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 6 | The ARS-UCD1.2 reference genome was generated from a white-headed Hereford and contains two copies of a segmental duplication upstream of KIT associated with depigmentation in white- headed cattle. White-headed Simmental cattle contain three copies of the 14.3 kb segmental duplication. |
2024 | 39694857 | |||||||
| 1849 | OMIA:001737-9913 | taurine cattle | Gelbvieh (Cattle) Hereford (Cattle) Holstein Friesian (Cattle) Jersey (Cattle) Maine-Anjou (Cattle) Montbéliarde (Cattle) Normande (Cattle) Red Angus (Cattle) | Coat colour, white spotting | KIT | deletion, gross (>20) | regulatory | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 6 | The ARS-UCD1.2 reference genome was generated from a white-headed Hereford and contains two copies of the deletion allele. Animals with ancestrial / solid colour phenotype have an insertion of either 6948-bp (long) or ~6000-bp (intermediate) ~114-kbp upstream of KIT exon 1 (NM_001166484.1) compared the the reference genome. | 2025 | 41237223 | ||||||
| 1165 | OMIA:001737-9913 | taurine cattle | Brown Swiss (Cattle) | Coat colour, white spotting | KIT | deletion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 6 | g.70239551_70239590del | c.1390_1429del | p.(N464Afs*50) | "NC_037333.1:g.70239551_70239590del; NM_001166484.1:c.1390_1429del; NP_001159956.1:p.(Asn464AlafsTer50)" (Häfliger et al., 2020) | rs5411005071 | 2020 | 32065668 | ||
| 1187 | OMIA:001737-9925 | goat | Barbari (Goat) | White-spotted | KIT | KIT^BAR | repeat variation | Naturally occurring variant | Not currently evaluated | ARS1.2 | 6 | The CNV "started ~63 kb downstream of KIT and covered ~100 kb of the genome reference sequence without known coding DNA. The short read-aligments of read-pairs spanning the amplification breakpoints confirmed that the individual copies of the CNV were arranged in tandem in a head to tail orientation" (Henkel et al., 2019) "70'911'301-70'927'581: deleted; 89'210'545-89'233'246: 3 copies of which 2 are inserted at 70'911'302" (Table S5; Henkel et al., 2019); previously listed in htis table as :g.70859258_70959918 (2 copies) | 2019 | 31841508 | ||||||
| 1188 | OMIA:000209-9925 | goat | Pak Angora, Pakistan (Goat) | White | KIT | KIT^ANG | repeat variation | Naturally occurring variant | Not currently evaluated | ARS1.2 | 6 | This CNV "started ~63 kb downstream of KIT and covered ~100 kb of the genome reference sequence without known coding DNA. The short read-aligments of read-pairs spanning the amplification breakpoints confirmed that the individual copies of the CNV were arranged in tandem in a head to tail orientation" (Henkel et al.,2019); previously listed in this table as g.70859258_70959918 (3 copies) | 2019 | 31841508 | ||||||
| 1201 | OMIA:001737-9925 | goat | Bezoar (Goat) | Wild type or Bezoar | KIT | reference sequence allele | Naturally occurring variant | Not currently evaluated | ARS1.2 | 6 | "The coverage plot of bezoars (BEZ) does not show any copy number variation and represents the wildtype allele." (Henkel et al., 2019) | 2019 | 31841508 | |||||||
| 150 | OMIA:000209-9793 | ass (donkey) | Coat colour, dominant white | KIT | W | substitution | missense | Naturally occurring variant | Not currently evaluated | ASM1607732v2 | 3 | NC_052179.1:g.139882496A>C | XM_014853517.2:c.662A>C | XP_014709003.2:p.(Y221S) | 2015 | 25818843 | ||||
| 405 | OMIA:001737-9793 | ass (donkey) | Coat colour, white spotting, due to KIT | KIT | Ws | substitution | splicing | Naturally occurring variant | Not currently evaluated | ASM1607732v2 | 3 | NC_052179.1:g.139911533T>A | XM_014853517.2:c.1978+2T>A | 2015 | 25818843 | |||||
| 570 | OMIA:001737-9615 | dog | Coat colour, white spotting, KIT-related | KIT | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 13 | g.47144513_47144514insA | c.140_141insA | p.(L48Vfs*10) | NM_001003181.1; NP_001003181.1; "a 1-bp insertion of an adenine 70 bases downstream of the beginning of exon 2." The variant represents a duplication of an adenine and could also be described as c.140dup. | 2013 | 23134432 | ||||
| 464 | OMIA:001516-9615 | dog | Gastrointestinal stromal tumor | KIT | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 13 | g.47178531_47178536del | c.1664_1669del | NM_001003181.1; deletion of AGTGGA; SOMATIC MUTATION | 2010 | 20950418 | ||||||
| 465 | OMIA:001516-9615 | dog | Gastrointestinal stromal tumor | KIT | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 13 | g.47178534_47178539del | c.1667_1672del | NM_001003181.1; deletion of GGAAGG; SOMATIC MUTATION | 2010 | 20950418 | ||||||
| 459 | OMIA:001737-9615 | dog | Coat colour, white spotting, KIT-related | KIT | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 13 | g.47179174_47179176del | c.1936_1938del | p.(L646del) | NM_001003181.1; NP_001003181.1; published as c.1960_1962delCTC; p.(L654del); coordinates in the table have been updated to a recent reference genome and / or transcript | 2013 | 23659249 | Dr. Wanda M. Gerding provided additional sequence information to facilitate identification of the genomic position in CanFam3.1 | |||
| 1331 | OMIA:000209-9796 | domestic horse | American Paint (Horse) American Trotter (Horse) Belgian Draft (Horse) Icelandic Horse (Horse) Quarter Horse (Horse) Thoroughbred (Horse) Welsh Pony (Horse) | White spotting | KIT | W32 | substitution | missense | Naturally occurring variant | LB/B | EquCab3.0 | 3 | NC_009146.3:g.79538738C>T | NM_001163866.1:c.2878G>A | NP_001157338.1:p.(A960T) | cDNA position previously listed as c.3214G>A; p.(A1072T) based on transcript ENSECAT00000014037.3 [16/04/2024] | rs1141982296 | 2021 | 34223905 | Breed information updated based on PMID: 38600096 |
| 882 | OMIA:000209-9796 | domestic horse | Süddeutsches Kaltblut, Germany (Horse) | Coat colour, dominant white | KIT | W11 | substitution | splicing | Naturally occurring variant | P | EquCab3.0 | 3 | NC_009146.3:g.79540429C>T | NM_001163866.1:c.2684+1G>A | rs5334475183 | 2009 | 19456317 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | ||
| 939 | OMIA:000209-9796 | domestic horse | Thoroughbred (Horse) | Coat colour, dominant white | KIT | W26 | deletion, small (<=20) | frameshift | Naturally occurring variant | VUS | EquCab3.0 | 3 | NC_009146.3:g.79540694del | NM_001163866.1:c.2536del | NP_001157338.1:p.(S846Vfs*15) | NM_001163866.1; NP_001157338.1; published as c.2536delA | rs3101685403 | 2018 | 29333746 | |
| 873 | OMIA:000209-9796 | domestic horse | Oldenburg (Horse) | Coat colour, dominant white | KIT | W16 | substitution | missense | Naturally occurring variant | LP/P | EquCab3.0 | 3 | NC_009146.3:g.79540741T>A | NM_001163866.1:c.2489A>T | NP_001157338.1:p.(K830I) | rs5334475213 | 2011 | 21554354 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 883 | OMIA:000209-9796 | domestic horse | Miniature Horse (Horse) Quarter Horse (Horse) Shetland Pony (Horse) | Coat colour, dominant white | KIT | W13 | substitution | splicing | Naturally occurring variant | P | EquCab3.0 | 3 | NC_009146.3:g.79544066C>G | NM_001163866.1:c.2472+5G>C | NM_001163866.1 | rs3102773259 | 2011 | 21554354 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 889 | OMIA:000209-9796 | domestic horse | Thoroughbred (Horse) | Coat colour, dominant white | KIT | W14 | deletion, gross (>20) | deletion (in-frame) | Naturally occurring variant | LP/P | EquCab3.0 | 3 | NC_009146.3:g.79544098_79544151del | NM_001163866.1:c.2392_2445del | NP_001157338.1:p.(H798_N815del) | NM_001163866.1; NP_001157338.1 | 2011 | 21554354 | genomic coordinates updated from g.79544151_79544204del to g.79544098_79544151del in EquCab3.0 [17/09/2023] | |
| 891 | OMIA:000209-9796 | domestic horse | Icelandic Horse (Horse) | White spotting | KIT | W21 | deletion, small (<=20) | frameshift | Naturally occurring variant | P | EquCab3.0 | 3 | NC_009146.3:g.79544174del | NM_001163866.1:c.2369delC | NP_001157338.1:p.(A790Efs*20) | rs5334475210 | 2015 | 26059442 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 885 | OMIA:000209-9796 | domestic horse | Appaloosa (Horse) Haflinger (Horse) Lipizzan horse (Horse) Noric (Horse) Quarter Horse (Horse) | Coat colour, dominant white | KIT | sabino 1 (SB1) | substitution | splicing | Naturally occurring variant | P | EquCab3.0 | 3 | NC_009146.3:g.79544206A>T | "SNP AX-103727726 (ECA3:77735520; SB1, SNP KI16+1037A)" (Druml et al., 2018) | rs5334475211 | 2005 | 16284805 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | ||
| 893 | OMIA:000209-9796 | domestic horse | Trottatore Italiano, Italy (Horse) | Coat colour, dominant white | KIT | W24 | substitution | splicing | Naturally occurring variant | LP/P | EquCab3.0 | 3 | NC_009146.3:g.79545245C>T | NM_001163866.1:c.2349+1G>A | rs3443588955 | 2017 | 28856698 | |||
| 1462 | OMIA:000209-9796 | domestic horse | American Trotter (Horse) | Dominant white spotting | KIT | W33 | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 3 | NC_009146.3:g.79545248T>A | NM_001163866.1:c.2347A>T | NP_001157338.1:p.(N783Y) | NC_009146.3; previously listed as ENSECAT00000014037.3: c.2783A>T / p.(N895Y) [16/04/2024] | 2022 | 35641888 | ||
| 881 | OMIA:000209-9796 | domestic horse | Icelandic Horse (Horse) | Coat colour, dominant white | KIT | W8 | substitution | splicing | Naturally occurring variant | P | EquCab3.0 | 3 | NC_009146.3:g.79545374C>T | NM_001163866.1:c.2222-1G>A | NM_001163866.1 | rs3434854925 | 2009 | 19456317 | ||
| 1778 | OMIA:000209-9796 | domestic horse | Warmblood (Horse) | White spotting | KIT | W38 | substitution | splicing | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 3 | NC_009146.3:g.79545867C>A | NM_001163866.2:c.2221+5G>T | 2025 | 40218308 | ||||
| 886 | OMIA:000209-9796 | domestic horse | Thoroughbred (Horse) | Coat colour, dominant white | KIT | W5 | deletion, small (<=20) | frameshift | Naturally occurring variant | P | EquCab3.0 | 3 | NC_009146.3:g.79545900del | NM_001163866.1:c.2193delG | NP_001157338.1:p.(T732Qfs*9) | rs5334475194 | 2009 | 19456317 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 878 | OMIA:000209-9796 | domestic horse | Freiberger (Horse) | Coat colour, dominant white | KIT | W1 | substitution | nonsense (stop-gain) | Naturally occurring variant | P | EquCab3.0 | 3 | NC_009146.3:g.79545942G>C | NM_001163866.1:c.2151C>G | NP_001157338.1:p.(Y717*) | rs5334475201 | 2007 | 17997609 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 877 | OMIA:000209-9796 | domestic horse | American Paint (Horse) American Trotter (Horse) Appaloosa (Horse) Arab (Horse) Belgian Draft (Horse) Clydesdale (Horse) Freiberger (Horse) Friesian (Horse) German Riding Pony (Horse) Morgan (Horse) Noric (Horse) Oldenburg (Horse) Quarter Horse (Horse) Shetland Pony (Horse) Thoroughbred (Horse) Tori hobune, Estonia (Horse) Traditional Gypsy Cob, United Kingdom of Great Britain and Northern Ireland (Horse) Warmblood (Horse) Welsh Pony (Horse) | Coat colour, dominant white | KIT | W20 | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 3 | NC_009146.3:g.79548220T>C | NM_001163866.1:c.2045G>A | NP_001157338.1:p.(R682H) | ENSECAT00000014037.3:c.2381A>G ENSECAP00000011188.2:p.His794Arg; reference genome corresponds to g.79548220T and the transcript NM_001163866.1 represents g.79548220C | rs1143160924 | 2013 | 23659293 | Variant coordinates initially gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124. Breed information updated based on PMID:38600096, PMID41865906 |
| 1261 | OMIA:000209-9796 | domestic horse | Berber, Germany (Horse) | Extensive coat white patterning | KIT | W30 | substitution | missense | Naturally occurring variant | LP/P | EquCab3.0 | 3 | NC_009146.3:g.79548244A>T | NM_001163866.1:c.2021T>A | NP_001157338.1:p.(L674H) | published as g.79548244, c.2020T>A; p.L674H (Martin et al., 2020) - changed to NM_001163866.1:c.2021T>A [16/042024] | rs5334475224 | 2020 | 33111383 | |
| 890 | OMIA:000209-9796 | domestic horse | Thoroughbred (Horse) | White spotting | KIT | W22 | deletion, gross (>20) | Naturally occurring variant | P | EquCab3.0 | 3 | NC_009146.3:g.79548925_79550822del | 1898bp deletion | 2017 | 28444912 | |||||
| 868 | OMIA:000209-9796 | domestic horse | Thoroughbred (Horse) | Coat colour, dominant white | KIT | W2 | substitution | missense | Naturally occurring variant | P | EquCab3.0 | 3 | NC_009146.3:g.79549540C>T | NM_001163866.1:c.1960G>A | NP_001157338.1:p.(G654R) | rs5334475198 | 2007 | 17997609 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 869 | OMIA:000209-9796 | domestic horse | Camarillo White Horse, United States of America (Horse) | Coat colour, dominant white | KIT | W4 | substitution | missense | Naturally occurring variant | P | EquCab3.0 | 3 | NC_009146.3:g.79549781G>A | NM_001163866.1:c.1805C>T | NP_001157338.1:p.(A602V) | Previously incorrectly listed as g.79549780G>A [16/04/2024] | 2007 | 17997609 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 871 | OMIA:000209-9796 | domestic horse | Holsteiner (Horse) | Coat colour, dominant white | KIT | W9 | substitution | missense | Naturally occurring variant | LP/P | EquCab3.0 | 3 | NC_009146.3:g.79549797C>T | NM_001163866.1:c.1789G>A | NP_001157338.1:p.(G597R) | rs5334475209 | 2009 | 19456317 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 872 | OMIA:000209-9796 | domestic horse | Arab (Horse) | Coat colour, dominant white | KIT | W15 | substitution | missense | Naturally occurring variant | LP/P | EquCab3.0 | 3 | NC_009146.3:g.79550351A>G | NM_001163866.1:c.1597T>C | NP_001157338.1:p.(C533R) | rs5334475202 | 2011 | 21554354 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 1777 | OMIA:000209-9796 | domestic horse | Anglo-Arab (Horse) Zangersheide, Belgium (Horse) | White spotting | KIT | W37 | insertion, small (<=20) | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 3 | NC_009146.3:g.79551903_79551904insA | NM_001163866.2:c.1512_1513insT | NP_001157338.2:p.(N505*) | published as g.79551897_79551898insA - coordinates in this table consider the 3'rule of the HGVS recommendations | 2025 | 40218308 | |||
| 940 | OMIA:000209-9796 | domestic horse | Thoroughbred (Horse) | Coat colour, dominant white | KIT | W27 | substitution | missense | Naturally occurring variant | LP | EquCab3.0 | 3 | NC_009146.3:g.79551937A>C | NM_001163866.1:c.1473T>G | NP_001157338.1:p.(C491W) | NM_001163866.1; NP_001157338.1 | rs3110307743 | 2018 | 29333746 | |
| 884 | OMIA:000209-9796 | domestic horse | CH-Warmblut, Switzerland (Horse) | Coat colour, dominant white | KIT | W18 | substitution | splicing | Naturally occurring variant | P | EquCab3.0 | 3 | NC_009146.3:g.79553751C>T | NM_001163866.1:c.1346+1G>A | rs5334475221 | 2013 | 23659293 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | ||
| 876 | OMIA:000209-9796 | domestic horse | Arab (Horse) | Coat colour, dominant white | KIT | W19 | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 3 | NC_009146.3:g.79553776T>C | NM_001163866.1:c.1322A>G | NP_001157338.1:p.(Y441C) | rs5334475217 | 2013 | 23659293 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 1476 | OMIA:000209-9796 | domestic horse | American Paint (Horse) American Trotter (Horse) Appaloosa (Horse) Arab (Horse) Mangalarga (Horse) Morgan (Horse) Mustang (Horse) Quarter Horse (Horse) Rocky Mountain, United States of America (Bighorn sheep) Warmblood (Horse) | Increased white spotting | KIT | W34 | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 3 | NC_009146.3:g.79566881T>C | NM_001163866.1:c.1171A>G | NP_001157338.1:p.(T391A) | Previously listed as ENSECAT00000014037.3:c.1495A>G; ENSECAP00000011188.2:p.(T499A) [16/04/2024] | rs1140732842 | 2022 | 35953947 | Breed information updated based on PMID: 38600096 |
| 887 | OMIA:000209-9796 | domestic horse | Quarter Horse (Horse) | Coat colour, dominant white | KIT | W10 | deletion, small (<=20) | frameshift | Naturally occurring variant | P | EquCab3.0 | 3 | NC_009146.3:g.79566923_79566926del | NM_001163866.1:c.1126_1129del | NP_001157338.1:p.(E376Ffs*3) | NM_001163866.1; NP_001157338.1; published as c.1126_1129delGAAC | 2009 | 19456317 | Genomic coordinates updated in this table from g.79566926_79566929del in EquCab3.0 after feedback from Micaela Vierra identified that these coordinates were incorrect [27/09/2023]. | |
| 870 | OMIA:000209-9796 | domestic horse | Thoroughbred (Horse) | Coat colour, dominant white | KIT | W6 | substitution | missense | Naturally occurring variant | VUS | EquCab3.0 | 3 | NC_009146.3:g.79573754C>T | NM_001163866.1:c.856G>A | NP_001157338.1:p.(G286R) | rs5334475167 | 2009 | 19456317 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 892 | OMIA:000209-9796 | domestic horse | Arab (Horse) | White spotting | KIT | W23 | substitution | splicing | Naturally occurring variant | VUS/LB | EquCab3.0 | 3 | NC_009146.3:g.79578484C>G | NM_001163866.1:c.756+1G>C | rs1095048836 | 2017 | 28378922 | |||
| 879 | OMIA:000209-9796 | domestic horse | Arab (Horse) | Coat colour, dominant white | KIT | W3 | substitution | nonsense (stop-gain) | Naturally occurring variant | P | EquCab3.0 | 3 | NC_009146.3:g.79578535T>A | NM_001163866.1:c.706A>T | NP_001157338.1:p.(K236*) | rs5334475200 | 2007 | 17997609 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 938 | OMIA:000209-9796 | domestic horse | Thoroughbred (Horse) | Coat colour, dominant white | KIT | W25 | substitution | missense | Naturally occurring variant | LP | EquCab3.0 | 3 | NC_009146.3:g.79578573A>G | NM_001163866.1:c.668T>C | NP_001157338.1:p.(L223P) | NM_001163866.1; NP_001157338.1 | rs3103992630 | 2018 | 29333746 | |
| 888 | OMIA:000209-9796 | domestic horse | Thoroughbred (Horse) | Coat colour, dominant white | KIT | W12 | deletion, small (<=20) | frameshift | Naturally occurring variant | P | EquCab3.0 | 3 | NC_009146.3:g.79579774_79579778del | NM_001163866.1:c.559_563del | NP_001157338.1:p.(S187Rfs*10) | NM_001163866.1; NP_001157338.1; published as c.559_563delTCTGC | rs5334475188 | 2010 | Reference not in PubMed; see OMIA 000209-9796 for reference details | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 |
| 1779 | OMIA:000209-9796 | domestic horse | White spotting | KIT | W39 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 3 | NC_009146.3:g.79579796G>A | NM_001163866.2:c.541C>T | NP_001157338.2:p.(R181*) | 2025 | 40218308 | ||||
| 1091 | OMIA:000209-9796 | domestic horse | German Riding Pony (Horse) | White spotting | KIT | W28 | deletion, gross (>20) | splicing | Naturally occurring variant | LP/P | EquCab3.0 | 3 | NC_009146.3:g.79579925_79581197del | 1273bp deletion affecting partial intron 2 and exon 3, may impact splicing | 2019 | 31463981 | ||||
| 880 | OMIA:000209-9796 | domestic horse | Thoroughbred (Horse) | Coat colour, dominant white | KIT | W7 | substitution | splicing | Naturally occurring variant | LP/P | EquCab3.0 | 3 | NC_009146.3:g.79580000C>G | NM_001163866.1:c.338-1G>C | rs5334475216 | 2009 | 19456317 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | ||
| 1330 | OMIA:000209-9796 | domestic horse | Quarter Horse (Horse) | White spotting | KIT | W31 | insertion, small (<=20) | frameshift | Naturally occurring variant | P | EquCab3.0 | 3 | NC_009146.3:g.79618532_79618533insA | NM_001163866.1:c.30_31insT | NP_001157338.1:p.(L11Sfs*115) | 2021 | 34223905 | |||
| 1854 | OMIA:000209-9796 | domestic horse | Japanese Draft, Japan (Horse) | Coat colour, dominant white | KIT | W17 | substitution | missense | Naturally occurring variant | LP | EquCab3.0 | 3 | NC_009146.3:g.[79548244A>G;79548265T>A] | NM_001163866.1:c.[2000A>T;2021T>C] | NP_001157338.1:p.[(E667D);(L674P)] | The two variants forming this haplotype were previously listed in OMIA as two variants (W17a; omia.variant:874; rs5334475222 and W17b; omia.variant:875; rs5334475224). Changed to this haplotype based on Tozaki et al. (2020, PMID:33376443) [28/11/2025]. | 2011 | 33376443 21554354 | Thanks to Tosso Leeb for bringing the information reported by Tozaki et al. (2020) to our attention. | |
| 1695 | OMIA:001737-9685 | domestic cat | Coat colour, salmiak | KIT | w^sal | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.161142882_161237957del | a novel 94 991 bp deletion in the 65875 bp downstream region of the KIT gene | 2024 | 38721753 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||||
| 620 | OMIA:001580-9685 | domestic cat | Birman (Cat) | Feet white (gloving) | KIT | g | delins, small (<=20) | delins (in-frame) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.161337385_161337386deinsTG | NM_001009837.3:c.1035_1036delinsCA | NP_001009837.3:p.(E345_H346delinsDN) | Montague et al. (2014) describe this variant as "two adjacent missense mutations". | 2010 | 21147473 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 994 | OMIA:000209-9685 | domestic cat | Domestic Longhair (Cat) | Coat colour, dominant white | KIT | W | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.161388687_161388688insN[617] | published as "a FERV1 long terminal repeat (LTR) is associated with all Dominant White individuals" | 2014 | 25085922 | Genomic position in Felis_catus_9.0 is based on information provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||||
| 732 | OMIA:001737-9685 | domestic cat | Coat colour, white spotting, KIT-related | KIT | S | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.161388687_161388688insN[7125] | "an insertion of an entire feline endogenous retrovirus (FERV1) into intron 1 of the KIT gene." | 2014 | 25085922 | Genomic position in Felis_catus_9.0 is based on information provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||||
| 1505 | OMIA:000449-452646 | American mink | Shadow coat colour | KIT | S^h | substitution | missense | Naturally occurring variant | Not currently evaluated | NNQGG.v01 | NWR01000037.1 | g.6253028G>T | c.2374G>T | p.(D792Y) | 2022 | 35481560 | ||||
| 391 | OMIA:001216-9823 | pig | Coat colour, roan | KIT | not known | splicing | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 8 | NM_001044525.1:c.757_925del | a U(26) repeat in intron 5 of the KIT gene, which is likely to mediate skipping of exon 5 of the gene in some tissues including skin | 2011 | 21749430 | ||||||
| 1248 | OMIA:002287-9823 | pig | Bama Xiang Zhu, China (Pig) | Hypopigmentation (piebald) and deafness | KIT | substitution | missense | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 8 | NC_010450.4:g.41485957T>A | NM_001044525.1:c.2418T>A | NP_001037990.1:p.(D806E) | ENU mutagenesis was used to create these pigs, NM_001044525.1; c.2418T>A; NP_001037990.1; p.(D806E) (Xu et al., 2020) | 2020 | 33042408 | |||
| 1135 | OMIA:001745-9823 | pig | Cinta Senese, Italy (Pig) | White belt | KIT | substitution | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 8 | NC_010450.4:g.41488472C>T | NM_001044525.1:c.2502C>T | NP_001037990.1:p.(P834P) | Variant is not causal, marker for phenotype in some breeds. Ensembl VEP analysis suggests that this can be a synonymous or 3_prime_UTR_variant depending on the transcript analysed. | rs328592739 | 2016 | Reference not in PubMed; see OMIA 001745-9823 for reference details | |||
| 1725 | OMIA:001737-89462 | water buffalo | Coat colour, white spotting, KIT-related | KIT | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | UOA_WB_1 | 7 | NC_037551.1:47207784A>T | NM_001290952.1:c.2016T>A | NP_001277881.1:p.(Y672*) | 2024 | 39048931 | |||||
| 1102 | OMIA:000209-30538 | alpaca | Classic grey coat colour | KIT | substitution | missense | Naturally occurring variant | Not currently evaluated | VicPac3.2 | 2 | NW_021964157.1:g.38170962G>A | XM_031688000.1:c.391G>A | XP_031543860.1:p.G131R | published as c.376G>A and p.(G126R), coordinates in this table are based on supplementary table 4 in Tan et al. (2024) | 2019 | 31297861 | ||||
| 757 | OMIA:001787-9615 | dog | Poodle, Standard (Dog) | Squamous cell carcinoma of the digit | KITLG | repeat variation | Naturally occurring variant | Not currently evaluated | 15 | a copy number variant (CNV) of KITLG | 2013 | 23555311 | ||||||||
| 186 | OMIA:001216-9913 | taurine cattle | Belgian Blue (Cattle) Shorthorn (Cattle) | Roan | KITLG | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:18262908G>T | NM_174375.2:c.653C>A | NP_776800.1:p.(A218D) | rs5366937507 | 1999 | 10384045 | NM_174375.2; NP_776800.1; published as c.654 variant, p.Ala193Asp. Variant information in this table were originally based on information listed in Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The coordinates were corrected after Cord Drögemüller notified OMIA curators that the previously listed variant was not present in roan cattle [17/11/2022] | ||
| 1145 | OMIA:002228-9615 | dog | Nova Scotia Duck Tolling Retriever (Dog) Poodle (Dog) | Pigment intensity | KITLG | repeat variation | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 15 | Weich et al. (2020): "the reference genome shows two tandem copies of the CNV spanning a region of approximately 12 kb. The CNV is located in an intergenic region about 152 kb upstream from the closest gene, KITLG." 200922: g. info moved here (g.29821450_29832950) until it can be standardised | 2020 | 31936656 | |||||||
| 1152 | OMIA:002237-8090 | Japanese medaka | Few melanophore | kitlga | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | Otsuki et al. (2020): "the phenotype of fm medaka is attributable to insertion of a Tcb1-like transposon at the kitlga locus" | 2020 | 31757930 | ||||||||||
| 74 | OMIA:000819-9615 | dog | Shih Tzu (Dog) | Prekallikrein deficiency | KLKB1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 16 | NC_006598.3:g.44501415A>T | XM_022403603.1:c.988T>A | XP_022259311.1:p.(F330I) | 2011 | 20736516 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1495 | OMIA:002425-9615 | dog | Chinese Shar-Pei (Dog) | Ichthyosis, KRT1-related | KRT1 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 27 | g.44229728_44229730del | c.567_569del | p.(N190del) | NM_001003392.1; NP_001003392.1 | 2022 | 36251712 | |||
| 364 | OMIA:001415-9615 | dog | Norfolk Terrier (Dog) | Hyperkeratosis, epidermolytic | KRT10 | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | NC_006591.3:g.21866234G>T | XM_014116588.2:c.1125+1G>T | XM_038676544.1; XP_038532472.1; experimentally confirmed splice defect; a single base GT>TT change in the consensus 5'-splice site of intron 5 | 2005 | 16029326 | ||||
| 1579 | OMIA:001415-9615 | dog | Chihuahua (Dog) | Ichthyosis, epidermolytic | KRT10 | substitution | missense | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 9 | NC_049230.1:g.21814695G>A | XM_038547368.1:c.437G>A | XP_038403296:p.(R146H) | XM_038547368.1; XP_038403296 | 2023 | 37332248 | |||
| 1229 | OMIA:002281-9685 | domestic cat | Domestic Shorthair (Cat) | Epidermolysis bullosa, simplex, KRT14-related | KRT14 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | E1 | NC_058381.1:g.40385540G>A | XM_003996860.6:c.979C>T | XP_003996909.3:p.(Q327*) | 2020 | 32657488 | Genomic position in Felis_catus_9.0 provided by Joshua Khamis. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 936 | OMIA:002088-9615 | dog | Dogue de Bordeaux (Dog) | Palmoplantar keratoderma, nonepidermolytic, focal 1 | KRT16 | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | g.[21170012_21170013delinsCGGA;21170030del] | c.[1147_1148delinsCGGA;1165del] | p.(V383Rfs) | XM_548101.4; XP_548101.2; published as p.(E392*) - protein coordinates updated to HGVS nomenclature | 2015 | 25521457 | |||
| 856 | OMIA:003039-9796 | domestic horse | Bashkir Curly (Horse) Curly Horse (Horse) | Curly coat | KRT25 | Crd | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 11 | NC_009154.3:g.21962991G>A | NM_001346190.1:c.266G>A | NP_001333119.1:p.(R89H) | rs1095048844 | 2017 | 29686323 29141579 | Variant coordinates obtained from and/or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 777 | OMIA:000246-9913 | taurine cattle | Aberdeen-Angus (Cattle) Ayrshire (Cattle) Montbéliarde (Cattle) Simmental (Cattle) | Curly hair, karakul-type | KRT27 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.40982250G>C | NM_001075815.1:c.276C>G | NP_001069283.1:p.(N92K) | rs384881761 | 2014 | 25017103 | Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | ||
| 1265 | OMIA:002081-9913 | taurine cattle | Belgian Blue (Cattle) | Epidermolysis bullosa, simplex, KRT5-related` | KRT5 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.27367611_27367613del | NM_001008663.1:c.534_536del | NP_001008663.1:p.(N178del) | Publised as '27367604delCAA' coordinates in the table have been updated to reflect HGVS nomenclature (3' rule) [03/09/2024] | 2020 | 33135329 | |||
| 192 | OMIA:002081-9913 | taurine cattle | Friesian cross (Cattle) Jersey cross | Epidermolysis bullosa | KRT5 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.27371128G>A | NM_001008663.1:c.1432G>A | NP_001008663.1:p.(E478K) | rs5334474982 | 2005 | 15955091 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1480 | OMIA:002081-9615 | dog | Cardigan Welsh Corgi (Dog) | Epidermolysis bullosa, simplex, KRT5-related | KRT5 | substitution | missense | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 27 | NC_049248.1:g.44080887C>T | NM_001346035.1:c.1426G>A | NP_001332964.1:p.(E476K) | NM_001346035.1; NP_001332964.1 | 2022 | 36004757 | |||
| 1697 | OMIA:002081-9615 | dog | German Shepherd Dog (Dog) | Epidermolysis bullosa simplex, localized, KRT5-related | KRT5 | delins, small (<=20) | delins (in-frame) | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 27 | NC_049248.1:g.44081942_44091959del | NM_001346035.1:c.988_1005del | NP_001332964.1:p.(N330_D335del) | 2024 | 38742646 | ||||
| 662 | OMIA:000394-9031 | chicken | Frizzle | KRT6A | deletion, gross (>20) | splicing | Naturally occurring variant | Not currently evaluated | GRCg6a | 33 | g.5251413_5251496del | p.(V311_K333del) | NM_001001313.2; NP_001001313.2; published as a 84bp deletion that covers positions −24 of exon 5 to +59 of intron 5 of KRT6A (called KRT75 in an earlier genome assembly); the deletion activates a cryptic splice site resulting in a 69 bp in-frame deletion in mRNA after splicing and a deletion of 23-amino acids (position 311–333) | 2012 | 22829773 | |||||
| 1337 | OMIA:002114-9913 | taurine cattle | Hereford (Cattle) | Hypotrichosis, KRT71-related | KRT71 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.27331221_27331228del | NM_001075970.1:c.281_288del | NP_001069438.1:p.(M94Nfs*14) | cDNA and protein positions based on NM_001075970.1 and NP_001069438.1, respectively | 2021 | 34356054 | 210909: FN checked the ARS-UCD1.2 assembly, and discovered that the deletion spans 27331221 to 27331228. Thus g.27331221delTGTGCCCA was changed to g.27331221_27331228del. From NCBI's genome browser, worked out that the c. notation needs to be changed from c.281delTGTGCCCA to c.281_288del. | ||
| 1043 | OMIA:000245-9615 | dog | Bichon Frise (Dog) Chesapeake Bay Retriever (Dog) Curly Coated Retriever (Dog) Irish Terrier (Dog) Lagotto Romagnolo (Dog) Spanish Water Dog (Dog) | Curly coat | KRT71 | c^2 | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 27 | g.2543230_2543237delinsACA | c.1266_1273delinsACA | p.(S422Rfs) | NM_001197029.1; NP_001183958.1 | 2019 | 30444027 30456859 | Genomic position in CanFam3.1 provided by Mateo Etcheveste and Robert Kuhn. | |
| 35 | OMIA:000245-9615 | dog | Huntaway (Dog) New Zealand Heading Dog (Dog) Portuguese Water Dog (Dog) | Curly coat | KRT71 | c^1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 27 | NC_006609.3:g.2539211C>T | NM_001197029.1:c.451C>T | NP_001183958.1:p.(R151W) | NM_001197029.1; NP_001183958.1, additional breeds based on PMID:40965331 | rs23373415 | 2009 | 19713490 | Genomic coordinates in CanFam3.1 and EVA ID provided by Robert Kuhn |
| 382 | OMIA:001583-9685 | domestic cat | Sphynx (Cat) | Sphynx hairless | KRT71 | Re^HR | substitution | splicing | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B4 | NC_058374.1:g.78941699C>T | NM_001195239.1:c.816+1G>A | rs5334475135 | 2010 | 20953787 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 394 | OMIA:001712-9685 | domestic cat | Selkirk Rex (Cat) | Curly coat, Selkirk rex | KRT71 | Re^S | substitution | splicing | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B4 | NC_058374.1:g.78943283C>G | NM_001195239.1:c.445-1G>C | 2013 | 23770706 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 380 | OMIA:001581-9685 | domestic cat | Devon Rex (Cat) | Curly coat, Devon rex | KRT71 | re | haplotype | splicing | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B4 | NC_058374.1:g.[78939377_78939378insA;78939389_78939390insCTCCAACT;78939390_78939470del] | NM_001195239.1:c.[1108-4_1184del;1184_1185insAGTTGGAG;1196_1197insT] | 2010 | 20953787 | Genomic position in Felis_catus_9.0 is based on information provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 1549 | OMIA:002687-9940 | sheep | Fleece variation, fine wool | KRT74 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_v4.0 | 3 | NC_019460.2:g.133486008C>A | XM_004006324.3:c.367C>A | XP_004006373.1:p.(H123N) | XM_004006324.3; XP_004006373.1; the C allele is associated with wool fineness | rs427563779 | 2024 | 37137429 | |||
| 1398 | OMIA:002486-9031 | chicken | Kirin (Chicken) Xiushui Yellow (Chicken) | Frizzle | KRT75L4 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | GRCg6a | 33 | g.5285437_5285451del | g.5285437-5285451delGATGCCGGCAGGACG | 2018 | 30572816 | ||||||
| 735 | OMIA:001371-9615 | dog | Staffordshire Bull Terrier (Dog) | L-2-hydroxyglutaricacidemia | L2HGDH | delins, small (<=20) | delins (in-frame) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 8 | g.26723470_26723472delinsAAG | c.1298_1300delinsCTT | p.(L433_H434delinsPY) | XM_858437.5; XP_863530.2; published as ENSCAFG00000014237; CanFam1.0: (c[1297T→C; 1299c→t]; p[Leu433Pro; His434Tyr]; coordinates in the table have been updated to a recent reference genome and / or transcript | 2007 | 17475916 | |||
| 427 | OMIA:001371-9615 | dog | Yorkshire Terrier (Dog) | L-2-hydroxyglutaricacidemia | L2HGDH | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 8 | NC_006590.3:g.26760351T>C | XM_858437.5:c.1A>G | XP_013971359.1:p.(M1?) | XM_858437.5; published as p.(Met1?) | 2012 | 22843824 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 1317 | OMIA:001371-9685 | domestic cat | Domestic Longhair (Cat) | L-2-hydroxyglutaric aciduria | L2HGDH | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B3 | NC_058373.1:g.97844907T>C | XM_023255678.2:c.1301A>G | XP_023111446.2:p.(H434R) | rs5334475154 | 2021 | 34062805 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1535 | OMIA:001371-9685 | domestic cat | Domestic Shorthair (Cat) | L-2-hydroxyglutaricacidemia | L2HGDH | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B3 | NC_058373.1:g.97881395G>A | XM_023255679.2:c.397C>T | XP_023111447.2:p.(Q133*) | 2023 | 36880414 | ||||
| 1399 | OMIA:002459-9615 | dog | Staffordshire Bull Terrier (Dog) | Congenital muscular dystrophy | LAMA2 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 1 | g.67734331_67736575del | c.610-1412_789+653del | XM_003432522.2; | 2022 | 34854126 | |||||
| 1389 | OMIA:002459-9615 | dog | Italian Greyhound (Dog) | Congenital muscular dystrophy | LAMA2 | CMD | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 1 | NC_006583.3:g.67883271G>A | XM_022419950.1:c.3285G>A | XP_022275658.1:p.(W1095*) | XM_022419950.1; XP_022275658.1 | 2021 | 34828429 | ||
| 701 | OMIA:001677-9615 | dog | German Pointer (Dog) | Epidermolysis bullosa, junctionalis, LAMA3 | LAMA3 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 7 | "insertion (4818+207ins6.5 kb) of repetitive satellite DNA within intron 35 of the gene (LAMA3)" | 2005 | 15737193 | ||||||||
| 909 | OMIA:001677-9913 | taurine cattle | Belgian Blue (Cattle) | Epidermolysis bullosa, junctionalis, LAMA3-related | LAMA3 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 24 | g.32749369G>A | c.7549C>T | p.(R2517*) | rs5334475046 | 2015 | 26370913 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1324 | OMIA:001677-9615 | dog | Australian Cattle Dog X | Epidermolysis bullosa, junctionalis, LAMA3 | LAMA3 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 7 | g.64427161T>A | c.8615T>A | p.(D2867V) | cDNA and protein positions based on XM_537297.6 and XP_537297.2, respectively | 2021 | 34250689 | |||
| 658 | OMIA:001677-9796 | domestic horse | American Saddle Horse (Horse) | Epidermolysis bullosa, junctionalis, LAMA3-related | LAMA3 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 8 | NC_009151.3:g.48678342_48684920del | "6589-bp deletion spanning exons 24-27 . . . in the LAMA3 gene in American Saddlebred foals" | 2009 | 19016681 | Coordinates in EquCab3.0 kindly provided by Haley Rutstein, working under the guidance of Professor Ernie Bailey. | |||||
| 1387 | OMIA:002479-9913 | taurine cattle | Romagnola (Cattle) | Hemifacial microsomia | LAMB1 | HFM | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 4 | NC_037331.1:g.49019693G>A | NM_001206519.1:c.2002C>T | NP_001193448.1:p.(R668C) | NM_001206519.1; NP_001193448.1; | 2022 | 34796979 | ||
| 1781 | OMIA:002269-9940 | sheep | Bleu Du Maine (Sheep) | Junctional epidermolysis bullosa | LAMB3 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v2.0 | 12 | NC_056065.1:g.73166198delG | XM_042229255.1:c.3051 + 1delG | XP_042085189.1:p.(V1018Ffs*12) | the 1-bp deletion affects the first nucleotide of intron 20 at the exon/intron boundary and mary result in altered splicing of exon 20 | 2025 | 40100311 | |||
| 1239 | OMIA:002269-9615 | dog | Australian Shepherd (Dog) | Epidermolysis bullosa, junctionalis, LAMB3-related | LAMB3 | JEB | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 7 | NC_006589.3:g.8286613A>G | XM_014115071.2:c.1174T>C | XP_013970546.1:p.(C392R) | NC_006589.3:g.8286613A>G; XM_014115071.2:c.1174T>C; XP_013970546.1:p.Cys392Arg | 2020 | 32906717 | ||
| 682 | OMIA:001678-9913 | taurine cattle | Hereford (Cattle) | Epidermolysis bullosa, junctionalis, LAMC2 | LAMC2 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 16 | "2.4 kb deletion encompassing the first exon of the LAMC2 gene" | 2015 | 25888738 | ||||||||
| 599 | OMIA:001678-9796 | domestic horse | Belgian Draft (Horse) Breton, France (Horse) Cavallo Agricolo Italiano da Tiro Pesante Rapido, Italy (Horse) Comtois (Horse) | Epidermolysis bullosa, junctionalis, LAMC2-related | LAMC2 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 5 | NC_009148.3:g.17498175dup | NM_001081768.1:c.1372dup | NP_001075237.1:p.(R458Pfs) | NM_001081768.1; NP_001075237.1; published as c.1368insC; coordinates in the table have been updated to HGVS nomenclature (3'-rule) and recent reference genome and / or transcript inforamtion 1,372 Protein position: 458 | 2002 | 12230513 | The genomic position in EquCab3.0 was provided by Margaret Higgins, working under the guidance of Professor Ernie Bailey [April 2022] | ||
| 507 | OMIA:001678-9940 | sheep | German Blackheaded Mutton (Sheep) | Epidermolysis bullosa, junctionalis, LAMC2-related | LAMC2 | deletion, small (<=20) | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 12 | NC_040263.1:g.68856318_68856319del | NM_001142358.1:c.2746_2747del | NP_001135830.1:p.(A928*) | FM872310 c.2746delCA | 2011 | 21573221 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1168 | OMIA:002251-9615 | dog | Airedale Terrier (Dog) | Surfactant metabolism dysfunction, pulmonary | LAMP3 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 34 | NC_006616.3:g.16092728C>T | XM_843796.4:c.1159G>A | XP_848889.2:p.(E387K) | 2020 | 32150563 | ||||
| 1371 | OMIA:002460-9615 | dog | Labrador Retriever (Dog) | Muscular dystrophy-dystroglycanopathy | LARGE | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 10 | NC_006592.3:g.30357716C>T | XM_531751.6:c.1363C>T | XP_531751.3:p.(R455*) | 2021 | 34654610 | ||||
| 449 | OMIA:001160-9986 | rabbit | Hyperlipidaemia | LDLR | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | "an in-frame deletion of 12 nucleotides that eliminates four amino acids from the cysteine-rich ligand binding domain of the LDL receptor" | 1986 | 3010466 | |||||||||
| 1556 | OMIA:000499-9544 | Rhesus monkey | Hypercholesterolaemia | LDLR | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | 19 | p.(W284*) | G>A in exon 6 in position 914 of the human cDNA resulting in p.(W284*) | 1990 | 2326270 | |||||||
| 1557 | OMIA:000499-9544 | Rhesus monkey | Hypercholesterolaemia | LDLR | substitution | missense | Naturally occurring variant | Not currently evaluated | 19 | c.245G>A | p.(C82Y) | 2023 | 37186395 | |||||||
| 1817 | OMIA:000499-9685 | domestic cat | Korat (Cat) | Hypercholesterolaemia | LDLR | substitution | nonsense (stop-gain) | Not currently evaluated | F.catus_Fca126_mat1.0 | A2 | NC_058369.1:g.8410638G>A | XM_003981898.6:c.2274G>A | XP_003981947.3:p.(W758*) | published with mRNA position XM_003981898.6:c.2406G>A, changed in the OMIA variant table to CDS position based on feedback from Jenna Himawan [16/09/2025] | 2024 | Reference not in PubMed; see OMIA 000499-9685 for reference details | ||||
| 987 | OMIA:000499-9823 | pig | Hypercholesterolaemia | LDLR | substitution | missense | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 2 | NC_010444.4:g.69841413C>T | NM_001206354.2:c.343C>T | NP_001193283.1:p.(R115C) | Published as p.(R84C) - p. and c. coordinates updated to recent transcript/protein ID (29/01/2025) | rs701604154 | 1998 | 9556295 | The genomic location on Sscrofa11.1 was determined and the effect was confirmed with Ensembl VEP by Stephanie Shields (27/05/2020) | ||
| 269 | OMIA:001596-9615 | dog | Lagotto Romagnolo (Dog) | Epilepsy, benign familial juvenile | LGI2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 3 | NC_006585.3:g.85210442A>T | XM_022416405.1:c.1558A>T | XP_022272113.1:p.(K520*) | XM_022416405.1; XP_022272113.1; published as c.1552A>T & p.(K518*); coordinates in the table have been updated to a recent reference genome and / or transcript | 2011 | 21829378 | |||
| 1862 | OMIA:003031-9685 | domestic cat | Deafness, LHFPL5-realated | LHFPL5 | substitution | splicing | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B2 | NC_058372.1:g.34339237A>G | XM_003986102.4:c.413‐2A>G | 2025 | 41400044 | ||||||
| 362 | OMIA:002314-9615 | dog | Czechoslovakian Wolfdog (Dog) German Shepherd Dog (Dog) Saarloos Wolfhond (Dog) Tibetan Terrier (Dog) White Swiss Shepherd Dog (Dog) | Pituitary dwarfism | LHX3 | delins, small (<=20) | splicing | Naturally occurring variant | Not currently evaluated | 9 | "a deletion of one of six 7 bp [GTGTTTT] repeats in intron 5 of LHX3" | 2011 | 22132174 | additioanl breeds added based on PMID:33890524 & PMID:40833232 | ||||||
| 608 | OMIA:002314-9615 | dog | German Shepherd Dog (Dog) | Pituitary dwarfism | LHX3 | duplication | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | NC_006591.3:g.49252491_49252493dup | NM_001197187.1:c.545_547dup | NP_001184116.1:p.(N182dup) | published as c.545_547dupACA | 2011 | 22132174 | Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. | |||
| 1415 | OMIA:002516-9913 | taurine cattle | Brown Swiss (Cattle) Original Swiss Brown (Cattle) | Haplotype with homozygous deficiency OH4 | LIG3 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.15080336_15080341del | NM_001038107.2:c.2483_2484+4delAGGTG | NP_001033196.1:p.K828fs | NM_001038107.2 | rs5381613636 | 2021 | 34915862 | ||
| 1842 | OMIA:003023-9913 | taurine cattle | Brown Swiss (Cattle) | Ataxia | LIPC | ATX | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 10 | NC_037337.1:g.51715800G>C | NM_001035410.1:c.924C>G | NP_001030487.1:p.(F308L) | 2026 | 42007389 | |||
| 450 | OMIA:001566-9986 | rabbit | Rex coat | LIPH | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | 14 | c.1362delA | 2011 | 21552526 | |||||||||
| 1203 | OMIA:002273-9685 | domestic cat | Ural Rex (Cat) | Curly coat, Ural Rex | LIPH | urx | delins, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | C2 | NC_058376.1:g.81753670_81753676delinsC | XM_019840031.3:c.477_483delinsC | XP_019695590.2:p.(S160_G161del) | changed from c.478_483del to c.477_483delinsC in accordance with HGVS nomenclature [17/2/2022] | 2020 | 32463158 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 649 | OMIA:002389-9685 | domestic cat | Highlander (Cat) Maine Coon (Cat) Maine Coon Polydactyl (Cat) | Spinal muscular atrophy | LIX1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A1 | NC_058368.1:g.158510559_158648551del | published as "a ~140 kb deletion removing exons 4-6 of LIX1 and all except exon 1 of LNPEP" Previously listed incorrectly in this table as NC_058368.1:g.159254616_159394886del. Coordinates updated to the correct position NC_058368.1:g.158510559_158648551del based on feedback from Bojana Matić. [04/04/2026]. |
2006 | 16899656 | Genomic position in Felis_catus_9.0 is based on information provided by Leslie Lyons and Reuben Buckley. Additional breeds reported based on PMID:35709088. | |||||
| 663 | OMIA:001612-9031 | chicken | Silkie (Chicken) | Oligozeugodactyly | LMBR1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 2 | "a large deletion in LMBR1-intron 5, eliminating most of the limb-specific enhancer conserved sequence." | 2011 | 21509895 | ||||||||
| 434 | OMIA:000810-9685 | domestic cat | Polydactyly | LMBR1 | Pd^UK2 | substitution | regulatory | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A2 | NC_058369.1:g.167522322T>A | regulatory variant in the ZPA regulatory sequence (ZRS); published as AGACACAG[A/T]AATGAG | 2008 | 18156157 | Genomic position in Felis_catus_9.0 provided by Joshua Khamis. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||||
| 433 | OMIA:000810-9685 | domestic cat | Polydactyly | LMBR1 | Pd^UK1 | substitution | regulatory | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A2 | NC_058369.1:g.167522546C>G | regulatory variant in the ZPA regulatory sequence (ZRS); published as CC[G/C]GTG | 2008 | 18156157 | Genomic position in Felis_catus_9.0 provided by Joshua Khamis, Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||||
| 432 | OMIA:000810-9685 | domestic cat | Maine Coon (Cat) | Polydactyly | LMBR1 | Pd^Hw | substitution | regulatory | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A2 | NC_058369.1g.167522324T>C | regulatory variant in the ZPA regulatory sequence (ZRS); published as AGACAC[A/G]GAAATGAG |
2008 | 18156157 | Genomic position in Felis_catus_9.0 provided by Joshua Khamis, Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 1583 | OMIA:002700-9615 | dog | Australian Shepherd (Dog) | Hyposegmentation of granulocytes | LMBR1L | substitution | splicing | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 27 | NC_049248.1:g.41169674C>T | XM_038577534.1:c.191+1G>A | XM_038577534.1 | 2023 | 37347778 | ||||
| 1823 | OMIA:002977-9796 | domestic horse | Freiberger (Horse) | Hypertriglyceridemia-induced pancreatitis | LMF1 | HIP | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | EquCab3.0 | NC_009156.3:g.42,935,259_42,935,263delinsTCT | XM_023616679.1:c.369_373delinsTCT | XP_023472447.1:p.(L125Rfs*193 | 2025 | 40764662 | ||||
| 1521 | OMIA:001213-9986 | rabbit | Emery-Dreifuss muscular dystrophy | LMNA | substitution | missense | Base-editing | Not currently evaluated | p.(L530P) | 2022 | 35282412 | |||||||||
| 1672 | OMIA:002796-9541 | crab-eating macaque | Cardiomyopathy, dilated, LMNA-related | LMNA | substitution | splicing | Base-editing | Not currently evaluated | MFA1912RKSv2 | 1 | NC_052255.1:g.93546791T>C | XM_045371898.1:c.357-2A>G | 2024 | 38559624 | ||||||
| 1401 | OMIA:001213-9823 | pig | Yucatan Miniature, United States of America (Pig) | Hutchinson-Gilford progeria syndrome | LMNA | substitution | splicing | Genome-editing (CRISPR-Cas9) | Not currently evaluated | Sscrofa11.1 | 4 | NC_010446.5:g.93900345G>A | NM_001111257.2:c.1824C>T | 2019 | 30911407 | |||||
| 1638 | OMIA:002796-9615 | dog | Nova Scotia Duck Tolling Retriever (Dog) | Cardiomyopathy, dilated, LMNA-related | LMNA | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 7 | g.41688530del | c.1726del | p.(D576Tfs*124) | NM_001287151.1; NP_001274080 | 2023 | 37925523 | |||
| 1797 | OMIA:002953-9823 | pig | Cardiomyopathy, hypertrophic | LOC100736765 | substitution | missense | Base-editing | Not currently evaluated | Sscrofa11.1 | 7 | NC_010449.5:g.75685084C>T | XM_021099233.1:c.1360C>T | XP_020954892.1:p.(R454C) | Published as p.(R453C) | 2024 | 38862020 | ||||
| 1046 | OMIA:001701-13146 | budgerigar | Feater colour, blue | LOC101880715 | substitution | missense | Naturally occurring variant | Not currently evaluated | 1 | NW_004848279.1:g.21369066T>C | XM_005153087.1c.1930T>C | p.(R644W) | 2017 | 28985565 | ||||||
| 915 | OMIA:001694-9940 | sheep | Polypay (Sheep) | Resistance to lentivirus | LOC105603932 | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 20 | g.32931861_32931862del | Published as ZNF389 deletion(NC_019477.1:g.29500068_29500069delAT ovine chromosome 20, NCBI dbSNP ss748775100). | rs397514112 | 2013 | 24303974 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||||
| 393 | OMIA:000344-9031 | chicken | Fayoumi (Chicken) | Epilepsy | LOC430486 | delins, small (<=20) | splicing | Naturally occurring variant | Not currently evaluated | 25 | c581-4CC>TG | 2011 | 22046416 | |||||||
| 1816 | OMIA:002971-9615 | dog | Beagle (Dog) Pembroke Welsh Corgi (Dog) | GST‐theta enzyme activity, deficiency | LOC477558 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 26 | NC_006608.3:g.28565797_28565802del | XM_851878.6:c.385_390del | XP_856971.3:p.(D129_Q130del) | 2017 | 29105159 | ||||
| 108 | OMIA:002071-9615 | dog | Labrador Retriever (Dog) | Macular corneal dystrophy | LOC489707 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 5 | NC_006587.3:g.75279762C>A | XM_005620685.3:c.814C>A | XP_005620742.1:p.(R272S) | The genomic position was previously listed incorrectly in OMIA as CanFam3.1 g.75279699C>A and was corrected based on feedback from Martina Tunjić [01/05/2025]. | 2016 | 26585178 | |||
| 1151 | OMIA:001928-9615 | dog | Golden Retriever (Dog) | Myasthenic syndrome, congenital, COLQ-related | LOC608697 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 23 | NC_006605.3:g.27175559G>A | XM_858278.5:c.880G>A | XP_863371.1:p.(G294R) | 2020 | 31769119 | ||||
| 900 | OMIA:001928-9615 | dog | Labrador Retriever (Dog) | Myasthenic syndrome, congenital | LOC608697 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 23 | NC_006605.3:g.27176737T>C | XM_858278.5:c.1010T>C | XP_863371.1:p.(I337T) | XM_858278.5; XP_863371.1 | 2014 | 25166616 | Genomic position in CanFam3.1 provided by Robert Kuhn | ||
| 1314 | OMIA:002336-9615 | dog | Rottweiler (Dog) | Nonsyndromic hearing loss | LOXHD1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 7 | g.44806821G>C | c.5747G>C | p.(G1914A) | XM_022421426.1, c.5747G>C; J9PAE4, p.(G1914A) (Hytönen et al., 2021) | 2021 | 33983508 | |||
| 522 | OMIA:001684-9685 | domestic cat | Cornish Rex (Cat) German Rex (Cat) | Curly/woolly coat, Cornish Rex and German Rex | LPAR6 | r | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A1 | NC_058368.1:g.22865220_22865223del | NM_001309049.1:c.250_253del | NP_001295978.1:p.(F84Efs*9) | c.250_253delTTTG | 2013 | 23826204 | The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 131 | OMIA:001210-9685 | domestic cat | Hyperlipoproteinaemia | LPL | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.37910025C>T | NM_001042567.1:c.1315G>A | NP_001036032.1:p.(G439R) | published as c.1234G>A and p.(G412R); coordinates in the table have been updated to a recent reference genome and / or transcript | 1996 | 8636438 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 1260 | OMIA:001486-9615 | dog | Beagle (Dog) | Night blindness, congenital stationary, LRIT3-related | LRIT3 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 32 | g.30038863del | c.763del | p.(K245Nfs*5) | c.763delG | 2019 | 31578364 | |||
| 1878 | OMIA:002765-7957 | goldfish | Celestial eye | lrp2a | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | 9 | g.28575379C>T | 2025 | 41226661 | ||||||||
| 1877 | OMIA:002765-7957 | goldfish | Telescope eye | lrp2a | insertion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | ASM336829v1 | 9 | 13-kBP insertion in intron 45 due to insertion of foamy-like endogenous retrovirus resulting in premature stop codon | 2020 | 32392470 | |||||||
| 1876 | OMIA:002765-7957 | goldfish | Telescope eye | lrp2a | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ASM336829v1 | 9 | NC_039251.1:g.7990395C>A | XM_026271200.1:c.13549G>T | XP_026126985.1:p.(G4517*) | published as p.G4480* | 2020 | 32392470 | ||||
| 1875 | OMIA:002765-7957 | goldfish | Telescope eye | lrp2a | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ASM336829v1 | 9 | NC_039251.1:g.8006317G>T | XM_026271200.1:c.10386C>A | XP_026126985.1:p.(Y3462*) | published as p.(Y3425*) | 2020 | 32392470 | ||||
| 627 | OMIA:000963-9913 | taurine cattle | Holstein Friesian (Cattle) | Syndactyly (mule foot) | LRP4 | delins, small (<=20) | delins (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 15 | g.76800972_76800973delinsAT | c.4863_4864delinsAT | p.(N1621_G1622delinsKC) | Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4 | 2006 | 16859890 | |||
| 378 | OMIA:000963-9913 | taurine cattle | Angus (Cattle) | Syndactyly (mule foot) | LRP4 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 15 | NC_037342.1:g.76792588C>T | NM_001077843.1:c.5385+1G>A | "a G to A transition at the first nucleotide in the splice donor site of intron 37" | rs5334475003 | 2006 | 16963222 | Variant information was initially kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4 | ||
| 769 | OMIA:000963-9913 | taurine cattle | Simmental (Cattle) | Syndactyly (mule foot) | LRP4 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 15 | NC_037342.1:g.76807508C>T | NM_001077843.1:c.3595G>A | NP_001071311.1:p.(G1199S) | rs3423411024 | 2007 | 17319939 | Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4 | ||
| 768 | OMIA:000963-9913 | taurine cattle | Simmental Charolais Cross | Syndactyly (mule foot) | LRP4 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 15 | NC_037342.1:g.76812187C>T | NM_001077843.1:c.2719G>A | NP_001071311.1:p.(G907R) | rs5334474664 | 2007 | 17319939 | Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4 | ||
| 1844 | OMIA:000963-9913 | taurine cattle | Holstein Friesian (Cattle) | Syndactyly (mule foot) | LRP4 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 15 | NC_037342.1:g.76819481G>A | NM_001077843.1:c.1480C>T | NP_001071311.1:p.(R494C) | rs380401761 | 2025 | 40999323 | |||
| 1882 | OMIA:000963-9913 | taurine cattle | Limousin (Cattle) | Syndactyly, syndromic | LRP4 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 15 | NC_037342.1:g.76826546C>A | NM_001077843.1:c.170G>T | NP_001071311.1:p.(C57F) | 2026 | 41854179 | ||||
| 610 | OMIA:002017-9685 | domestic cat | Siamese (Cat) | Glaucoma 3, primary congenita | LTBP2 | duplication | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B3 | NC_058373.1:g.119460393_119460396dup | XM_023255858.2:1431_1434dup | XP_023111626.2:p.(A479Gfs) | published as "a 4-bp insertion in exon 8 located at chrB3: 120995236"[felCat5], previous listed as c.1449_1452dup, p.(A485Gfs) - updated to recent transcript [12/07/2025] | 2016 | 27149523 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1394 | OMIA:002485-9685 | domestic cat | British Shorthair (Cat) | Skeletal dysplasia, LTBP3-related | LTBP3 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | D1 | NC_058377.1:g.108455125del | XM_023240055.2:c.158del | XP_023095823.2:p.(G53Afs*16) | genomic coordinates updated to reflect HGVS 3'-rule [12/07/2025] | 2021 | 34946872 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 605 | OMIA:001721-32536 | cheetah | Coat colour, king | LVRN | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | p.(N977Kfs*110) | 2012 | 22997338 | |||||||||
| 307 | OMIA:001429-9685 | domestic cat | Blotched tabby | LVRN | Ta^b2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A1 | NC_058368.1:g.94477275C>A | XM_045057766.1:c.176C>A | XP_044913701.1:p.(S59*) | 2012 | 22997338 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 1429 | OMIA:001429-9685 | domestic cat | Tabby, atypical swirl | LVRN | Ta^as | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A1 | NC_058368.1:g.94477515A>C | XM_045057763.1: c.416A>C | XP_044913698.1:p.(T139N) | associated with an atypical swirled pattern but is incompletely penetrant. F.catus_Fca126_mat1.0 reference sequence represents the C allele / p.(N139T) | 2012 | 22997338 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 124 | OMIA:001429-9685 | domestic cat | Blotched tabby | LVRN | Ta^b1 | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A1 | NC_058368.1:g.94477781G>A | XM_045057766.1:c.682G>A | XP_044913701.1:p.(D228N) | 2012 | 22997338 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 308 | OMIA:001429-9685 | domestic cat | Blotched tabby | LVRN | Ta^b3 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A1 | NC_058368.1:g.94536796G>A | XM_045057763.1:c.2522G>A | XP_044913698.1:p.(W841*) | Felis_catus_9.0 represents the A allele | 2012 | 22997338 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1348 | OMIA:002431-9694 | tiger | Pseudomelamism | LVRN | substitution | missense | Naturally occurring variant | Not currently evaluated | PanTig1.0 | A1 | c.1360C>T | p.H454Y | Sagar et al. (2021): "[Assembly PanTig1.0(GCF_000464555.1)]. . . . (Taqpep c.1360C > T); XP_007086933.1) of the protein (Taqpep p.H454Y)" | 2021 | 34518374 | |||||
| 518 | OMIA:000185-452646 | American mink | Chediak-Higashi syndrome | LYST | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | c.9468delC | 2013 | 22762706 | ||||||||||
| 1359 | OMIA:002449-94885 | corn snake | Skin colour, lavender | LYST | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.9508C>T | p.(Q3169*) | 2020 | 33020272 | ||||||||
| 183 | OMIA:000185-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Chediak-Higashi syndrome | LYST | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 28 | NC_037355.1:g.8464077T>C | NM_174020.2:c.6044A>G | NP_776445.1:p.(H2015R) | rs481318527 | 1999 | 10594238 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1147 | OMIA:000185-9685 | domestic cat | Persian (Cat) | Chediak-Higashi disease | LYST | repeat variation | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | D2 | NC_058378.1:g.13064245_13083649dup | NM_001290242.1:c.8347-2422_9548+1749dup | a tandem segmental duplication encompassing exons 30 through to 38 | 2020 | 31919397 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||||
| 249 | OMIA:000625-10141 | domestic guinea pig | Mannosidosis, alpha | Man2b1 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.679C>T | p.(R227W) | 2002 | 11959458 | ||||||||
| 199 | OMIA:000625-9913 | taurine cattle | Galloway (Cattle) | Mannosidosis, alpha | MAN2B1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 7 | NC_037334.1:g.12840983G>A | NM_174561.2:c.662G>A | NP_776986.2:p.(R221H) | rs5334474945 | 1997 | 9208932 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 198 | OMIA:000625-9913 | taurine cattle | Angus (Cattle) Murray Grey (Cattle) | Mannosidosis, alpha | MAN2B1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 7 | NC_037334.1:g.12842292T>C | NM_174561.2:c.961T>C | NP_776986.2:p.(F321L) | rs5334474873 | 1997 | 9208932 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1628 | OMIA:000625-9615 | dog | Doberman Pinscher (Dog) | Mannosidosis, alpha | MAN2B1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Dog10K_Boxer_Tasha | 20 | NC_006602.4:g.49320989A>G | XM_005632833.4:c.311A>G | XP_005632890.1:p.(D104G) | XM_005632833.4; XP_005632890.1 | 2023 | 37761886 | |||
| 499 | OMIA:000625-9685 | domestic cat | Persian (Cat) | Mannosidosis, alpha | MAN2B1 | deletion, small (<=20) | frameshift | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | A2 | NC_058369.1:g.8955977_8955980del | NM_001009222.1:c.1749_1752del | NP_001009222.1:p.(Q584Afs) | 1997 | 9396732 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 297 | OMIA:000626-9913 | taurine cattle | Salers (Cattle) | Mannosidosis, beta | MANBA | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 6 | NC_037333.1:g.22188765G>A | NM_174387.2:c.2574G>A | NP_776812.1:p.(W858*) | rs5334475094 | 1999 | 10594236 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 451 | OMIA:000626-9925 | goat | Mannosidosis, beta | MANBA | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS1.2 | 6 | NC_030813.1:g.22409150del | NM_001285691.1:c.1398del | NP_001272620.1:p.(W466fs) | rs5334475113 | 1996 | 8921369 | The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries | |||
| 1093 | OMIA:000626-9615 | dog | Mixed Breed (Dog) | Beta mannosidosis | MANBA | duplication | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 32 | g.24057654_24057658dup | c.2377_2381dup | p.(H794Hfs) | XM_005639236.3; XP_005639293.1; published as c.2377_2381dupTATCA | 2019 | 31439511 | Genomic and protein coordinates in CanFam3.1 provided by Robert Kuhn | |||
| 1072 | OMIA:000626-9615 | dog | German Shepherd Dog (Dog) | Beta mannosidosis | MANBA | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 32 | NC_006614.3:g.24147500A>T | XM_005639236.3:c.560T>A | XP_005639293.1:p.(I187N) | 2019 | 30983534 | ||||
| 1636 | OMIA:000626-9685 | domestic cat | Domestic Shorthair (Cat) | Mannosidosis, beta | MANBA | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.119398498G>A | XM_023252901.2:c.2509G>A | XP_023108669.2:p.(G837R) | variant was reported in a single affected cat, previously listed as c.2506G>A, p.(G836R) - updated to recent transcript information [11/07/2025] | 2024 | 37913889 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1473 | OMIA:002381-9913 | taurine cattle | Romagnola (Cattle) | Skeletal-cardio-enteric dysplasia | MAP2K2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 7 | NC_037334.1:g.19923991C>T | NM_001038071.2:c.535G>A | NP_001033160.2:p.(R179W) | NM_001038071.2; NP_001033160.2; possible de-novo causal variant | 2021 | 34209498 | |||
| 943 | OMIA:001432-9615 | dog | Dachshund, Miniature Long-Haired (Dog) | Cone-rod dystrophy 4 | MAP9 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 15 | g.52905336_52927296del | c.75+181_1378-215del | XM_005629374.1; An approximately 22kb deletion "approximately 30 Mb upstream of RPGRIP1 . . . The deletion breakpoints were identified in MAP9 intron 10 and in a downstream partial MAP9 pseudogene." … " The size of the deletion based on genome build CanFam3.1 MAP9_corrected is 21,961 bp, with deletion breakpoints in intron 10 of MAP9 and MAP9." See PMID:38752391 for additional breed information. | 2016 | 27017229 | |||||
| 1416 | OMIA:002517-9913 | taurine cattle | Brown Swiss (Cattle) Original Swiss Brown (Cattle) | Haplotype with homozygous deficiency BH6 | MARS2 | BH6 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.86191230G>A | NM_001098971.1:c.1553G>A | NP_001092441.1:p.(R518Q) | NM_001098971.1 | rs434672528 | 2021 | 34915862 | |
| 1646 | OMIA:002804-9544 | Rhesus monkey | Germline mutation rate | MBD4 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | MMul10 | 2 | g.147059371del | c.984del | p.(I330Sfs*2) | ENSMMUG00000012723 | 2023 | 37984997 | ||||
| 413 | OMIA:002021-9796 | domestic horse | Quarter Horse (Horse) Warmblood (Horse) | Coat colour, brindle 1 | MBTPS2 | substitution | splicing | Naturally occurring variant | Not currently evaluated | EquCab3.0 | X | NC_009175.3:g.17286855T>C | XM_023634090.1:c.1340+4T>C | Published as c.1437+4T>C - updated in this table to reflect XM_023634090.1 transcript coordinates | rs3434246715 | 2016 | 27449517 | Breed information updated based on PMID: 38600096 | ||
| 674 | OMIA:001199-30640 | gray squirrel | Melanism (black) | MC1R | E^B | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | MC1RΔ24 allele E^B ["at amino acid positions 87-94"] | 2009 | 19643815 | |||||||||
| 1007 | OMIA:001199-10141 | domestic guinea pig | Brown coat colour | MC1R | e (MC1R*4) | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | Vidal (2018): "a deletion of 2760 bp, including the entire MC1R coding region" | 2018 | 30101449 | |||||||||
| 250 | OMIA:001199-46844 | Geoffroy's cat | Melanism (black coat) | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | p.(C125R) | 2015 | 25695801 | |||||||||
| 1328 | OMIA:000374-495946 | Eleonora's falcon | Feather colour, extended black | MC1R | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | p.(M114_V117del) | 2011 | 21696477 | |||||||||
| 1100 | OMIA:000374-57662 | red-footed booby | White plumage | MC1R | haplotype | Naturally occurring variant | Not currently evaluated | p.(M85V) + p.(R207H) | 2007 | 17602182 | ||||||||||
| 1173 | OMIA:001199-37349 | woolly mammoth | Light hair colour | MC1R | not known | missense | Naturally occurring variant | Not currently evaluated | p.(R67C) | 2006 | 16825562 | |||||||||
| 1101 | OMIA:000374-70340 | Lesser snow goose | Blue plumage | MC1R | not known | missense | Naturally occurring variant | Not currently evaluated | p.(V85M) | 2004 | 15031505 | |||||||||
| 262 | OMIA:001199-494514 | Arctic fox | Blue coat colour | MC1R | Ed | haplotype | missense | Naturally occurring variant | Not currently evaluated | p.[(G5C);(F280C)] | The blue (Ed) allele is a haplotype comprising two missense variants (p.Gly5Cys and p.Phe280Cys) (Våge et al., 2005) | 2005 | 15982782 | |||||||
| 1271 | OMIA:001199-30532 | fallow deer | Coat colour, white | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | c.143T>C | p.(L48P) | 2020 | 33213385 | ||||||||
| 1765 | OMIA:002770-51751 | ball python | Skin colour, Clown colour morph | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | 3 | c.149G>A | p.(S50N) | 2025 | 39609249 | |||||||
| 180 | OMIA:001199-9870 | reindeer | Coat colour, extension | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | c.218T>C | p.(M73T) | 2014 | 25039753 | ||||||||
| 1002 | OMIA:002156-46218 | Chinese painted quail | Feather colour, Blue Face | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | c.271G>A | p.(E92K) | 2018 | 29974967 | ||||||||
| 448 | OMIA:001199-9986 | rabbit | California (Rabbit) Champagne-Silberkaninchen, Germany (Rabbit) Checkered Giant Checkered Small Dutch (Rabbit) New Zealand White (Rabbit) White Giant (Rabbit) | Dominant black or Steel | MC1R | E(D) or E(S) | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | c.280_285del | 2006 | 16978179 | ||||||||
| 630 | OMIA:001199-9986 | rabbit | Coloured dwarf Dutch (Rabbit) English Lop English Spot (Rabbit) Fauve de Borgogne (Rabbit) Lop Lop dwarf New Zealand Red (Rabbit) Saxon Gold Thüringer (Rabbit) | Red/fawn/yellow | MC1R | e | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | c.304_333del30 | 2006 | 16978179 | ||||||||
| 1350 | OMIA:001199-9915 | indicine cattle (zebu) | Guzerat (Cattle) | Red | MC1R | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | c.311delT | p.(G104Vfs*) | 2021 | 34555208 | ||||||||
| 18 | OMIA:001494-9103 | turkey | Feather colour, dominant black | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | c.364A>T | p.(I122F) | 2010 | 20634512 | ||||||||
| 1329 | OMIA:000374-120794 | gyrfalcon | Feather colour, extended black | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | c.376A>G | p.(I126V) | 2012 | 22497627 | ||||||||
| 1733 | OMIA:001199-30532 | fallow deer | Coat colour, menil | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | c.714G>A | p.(G236D) | 2024 | 39202415 | ||||||||
| 1006 | OMIA:001199-10141 | domestic guinea pig | Brown coat colour | MC1R | e (MC1R*2) | substitution | missense | Naturally occurring variant | Not currently evaluated | c.749T>C | p.(L250Q) | 2018 | 30101449 | |||||||
| 181 | OMIA:001199-9870 | reindeer | Coat colour, extension | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | c.839T>G | p.(F280C) | 2014 | 25039753 | ||||||||
| 1351 | OMIA:001199-9915 | indicine cattle (zebu) | Sahiwal (Cattle) | Red | MC1R | Naturally occurring variant | Not currently evaluated | c.844C>A | p.(T281 N) | 2021 | 33512595 | |||||||||
| 1003 | OMIA:002155-46218 | Chinese painted quail | Feather colour, Red Breasted | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | c.872C>T | p.(P292L) | 2018 | 29974967 | ||||||||
| 1346 | OMIA:001199-37190 | antarctic fur seal | Hypopigmentation (blond) | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | c.872C>T | p.(S291F) | 2016 | 27547348 | ||||||||
| 19 | OMIA:001494-9103 | turkey | Feather colour, black-wing bronze | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | c.887C>T | p.(A296V) | 2010 | 20634512 | ||||||||
| 1009 | OMIA:001199-9838 | Arabian camel | White coat colour | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | c.901C>T | p.(R301C) | KU179867; c.901C>T; p.R301C | 2018 | 29893870 | |||||||
| 328 | OMIA:001494-9103 | turkey | Bronze feathers | MC1R | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.96G>A | 2010 | 20634512 | |||||||||
| 256 | OMIA:001435-93934 | Japanese quail | Feather colour, extended brown | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | c.?G>A | p.(E92K) | 2006 | 16734695 | ||||||||
| 1160 | OMIA:001199-9986 | rabbit | Angora (Rabbit) Checkered Giant Dutch (Rabbit) Giant Grey Japanese (Rabbit) Rheinische Schecken (Rabbit) | Japanese brindling | MC1R | eJ | haplotype | Naturally occurring variant | Not currently evaluated | c.[124G>A;125_130del6] | "6 bp-in frame deletion flanked by a G > A transition in 5' (c.[124G>A;125_130del6]) that was present in all animals with Japanese brindling coat colour and pattern." (Fontanesi et al., 2010) | 2010 | 20594318 | |||||||
| 1848 | OMIA:001199-37699 | marsupial mole | Coat colour, wildtype | MC1R | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | reference sequence | the normal cream coat colour of marsupial moles is likley due to an MC1R in-frame stop codon at position 160 | 2025 | 41119986 | |||||||||
| 1509 | OMIA:001199-9913 | taurine cattle | Abondance (Cattle) Brown Swiss (Cattle) Evolèner, Switzerland (Cattle) Herens (Cattle) Holstein Friesian (Cattle) Itäsuomenkarja, Finland (Cattle) Original Swiss Brown (Cattle) Rotes Höhenvieh, Germany (Cattle) Simmental (Cattle) | Recessive red | MC1R | e^v2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 18 | NC_037345.1:g.14705638G>A | NM_174108.2:c.263G>A | NP_776533.1:p.(S88N) | NM_174108; NP_776533 | rs5412784355 | 2022 | 35451516 | |
| 1167 | OMIA:001544-9913 | taurine cattle | Rat-tail syndrome | MC1R | E^D | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 18 | NC_037345.1:g.14705671T>C | NM_174108.2:c.296T>C | NP_776533.1:p.(L99P) | rs109688013 | 2016 | 27037038 | |||
| 185 | OMIA:001199-9913 | taurine cattle | Angus (Cattle) Holstein Friesian (Cattle) Icelandic Cattle (Cattle) | Dominant black | MC1R | E^D | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 18 | NC_037345.1:g.14705671T>C | NM_174108.2:c.296T>C | NP_776533.1:p.(L99P) | NM_174108; NP_776533 | rs109688013 | 1995 | 8535072 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool |
| 485 | OMIA:001199-9913 | taurine cattle | Angus (Cattle) Fries Roodbont, Netherlands (Cattle) Simmental (Cattle) | Recessive red | MC1R | e | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 18 | NC_037345.1:g.14705685del | NM_174108.2:c.310del | NP_776533.1:p.(G104Vfs*53) | NM_174108; NP_776533 | rs110710422 | 1995 | 8535072 | Variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) |
| 1508 | OMIA:001199-9913 | taurine cattle | Angus (Cattle) Brown Swiss (Cattle) Evolèner, Switzerland (Cattle) Herens (Cattle) Holstein Friesian (Cattle) Limousin (Cattle) Normande (Cattle) Original Swiss Brown (Cattle) Witrood Ras van Belgie, Belgium (Cattle) | recessive red | MC1R | e^v1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 18 | NC_037345.1:g.14705799C>T | NM_174108.2:c.424C>T | NP_776533.1:p.(R142C) | NM_174108; NP_776533 | rs3423445958 | 2022 | 35451516 | |
| 1332 | OMIA:001199-9925 | goat | Murcia-Granada (Goat) | Black coat colour | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS1.2 | 18 | NC_030825.1:g.16105786C>G | XM_018063150.1:c.801C>G | XP_017918639.1:p.(C267W) | rs669694251 | 2009 | 19706191 | |||
| 996 | OMIA:001199-9793 | ass (donkey) | Âne de Provence, France (Ass) Âne des Pyrénées, France (Ass) Âne normand, France (Ass) Miniature, United States of America (Ass) | Coat colour, red | MC1R | e | substitution | missense | Naturally occurring variant | Not currently evaluated | ASM1607732v2 | 28 | NC_052204.1:g.63570188T>C | XM_014836533.2:c.629T>C | XP_014692019.1:p.(M210T) | 2014 | 25155046 | |||
| 997 | OMIA:001199-9615 | dog | Alaskan Husky (Dog) Siberian Husky (Dog) | White coat colour | MC1R | e^3 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 5 | g.63694433_63694434del | c.816_817del | p.(I272Mfs*22) | NM_001014282.2; NP_001014304.2; published as c.816_817delCT | 2018 | 29932470 | Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. | |
| 34 | OMIA:001590-9615 | dog | Belgian Shepherd Dog, Malinois (Dog) Huntaway (Dog) Leonberger (Dog) New Zealand Heading Dog (Dog) | Black melanistic mask | MC1R | E^M | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 5 | g.63694460C>T | c.790A>G | p.(M264V) | Additional breeds based on PMID:40965331 | rs24201590 | 2003 | 12692165 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. Correction to genomic details provided by Professor Claire Wade. |
| 343 | OMIA:001199-9615 | dog | Huntaway (Dog) Irish Setter (Dog) Labrador Retriever (Dog) New Zealand Heading Dog (Dog) | Red/yellow coat | MC1R | e^1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 5 | NC_006587.3:g.63694334G>A | NM_001014282.2:c.916C>T | NP_001014304.2:p.(R306*) | NM_001014282.2; NP_001014304.2; ROS_Cfam_1.0:g.63922309A>G, additional breeds based on PMID:40965331 | rs851563576 | 2000 | 10602988 | Genomic location provided by Professor Claire Wade |
| 1645 | OMIA:001199-9615 | dog | Alaskan Klee Kai (Dog) Alaskan Malamute (Dog) Basenji (Dog) Basset Fauve de Bretagne (Dog) Beagle (Dog) Chesapeake Bay Retriever (Dog) Chihuahua (Dog) Chinese Crested (Dog) Chinook (Dog) English Foxhound (Dog) Finnish Hound (Dog) Finnish Lapphund (Dog) Finnish Spitz (Dog) Karelian Bear Dog (Dog) Lapponian Herder (Dog) Peruvian Hairless Dog (Dog) Phalène (Dog) Plott Hound (Dog) Saarloos Wolfhond (Dog) Siberian Husky (Dog) Tamaskan Dog (Dog) | Coat colour, reduced expression of eumelanin | MC1R | e^A | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 5 | NC_006587.3:g.63694349G>A | NM_001014282.2:c.901C>T | NP_001014304.2:p.(R301C) | NM_001014282.2; NP_001014304.2; variant was initially identified in ancient canids and later reported in additional breeds PMID:33292722 | 2013 | 24098367 | ||
| 1681 | OMIA:001199-9615 | dog | English Cocker Spaniel (Dog) | Coat colour, sable | MC1R | e^H | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 5 | NC_006587.3:g.63695000C>T | NM_001014282.2:c.250G>A | NP_001014304.2:p.(D84N) | NM_001014282.2; NP_001014304.2; NC_006587.3 | 2024 | 38282569 | ||
| 32 | OMIA:001495-9615 | dog | Afghan Hound (Dog) Saluki (Dog) | Grizzle | MC1R | E^G | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 5 | NC_006587.3:g.63695017C>A | NM_001014282.2:c.233G>T | NP_001014304.2:p.(G78V) | NM_001014282.2; NP_001014304.2 | 2010 | 20525767 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn | |
| 998 | OMIA:001199-9615 | dog | Australian Cattle Dog (Dog) | Cream coat colour | MC1R | e^2 | substitution | regulatory | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 5 | NC_006587.3:g.63695679C>G | NM_001014282.1:c.-432G>C | NM_001014282.1 | 2018 | 29932470 | |||
| 154 | OMIA:001199-9796 | domestic horse | American Trotter (Horse) Arab (Horse) Belgian Draft (Horse) Clydesdale (Horse) Freiberger (Horse) Icelandic Horse (Horse) Morgan (Horse) Quarter Horse (Horse) Shetland Pony (Horse) Thoroughbred (Horse) Warmblood (Horse) Welsh Pony (Horse) | Coat colour, chesnut | MC1R | e | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 3 | NC_009146.3:g.36979560C>T | NM_001114534.1:c.248C>T | NP_001108006.1:p.(S83F) | rs68458866 | 1996 | 8995760 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. Breed information updated based on PMID: 38600096 | |
| 155 | OMIA:001199-9796 | domestic horse | Belgian Draft (Horse) | Coat colour, chesnut | MC1R | e^a | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 3 | NC_009146.3:g.36979562G>A | NM_001114534.1:c.250G>A | NP_001108006.1:p.(D84N) | rs3443929753 | 2000 | 11086549 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. Breed information updated based on PMID: 38600096 | |
| 123 | OMIA:001199-9685 | domestic cat | Norwegian Forest Cat (Cat) | Coat colour, amber | MC1R | e | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | E2 | NC_058382.1:g.61570294G>A | NM_001009324.1:c.250G>A | NP_001009324.1:p.(D84N) | rs5334475156 | 2009 | 19422360 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 561 | OMIA:001199-9685 | domestic cat | Burmese (Cat) | Coat colour, russet | MC1R | e^r | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | E2 | NC_058382.1:g.61570484_61570486del | NM_001009324.1:c.440_442del | NP_001009324.1:p.(F147del) | published as c.439_441del and p.(F146del); coordinates in the table have been updated to a recent reference genome and / or transcript. | 2017 | 27671997 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 1090 | OMIA:001199-9685 | domestic cat | Kurilian Bobtail (Cat) | Coat colour, copal | MC1R | e^c | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | E2 | NC_058382.1:g.61570684_61570713del | NM_001009324.1:c.640_669del | NP_001009324.1:p.(A214_R223del) | 2019 | 31361350 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 817 | OMIA:000374-9031 | chicken | Feather colour, extended black | MC1R | substitution | regulatory | Naturally occurring variant | Not currently evaluated | GRCg6a | 11 | g.18840609C>T | c.-37C>T | 5 prime UTR variant | rs733919322 | 2017 | 28699279 | ENSGALT00000096195.1:c.-37C>T | |||
| 818 | OMIA:000374-9031 | chicken | Feather colour, extended black | MC1R | E | substitution | missense | Naturally occurring variant | Not currently evaluated | GRCg6a | 11 | g.18840857T>C | c.212T>C | p.(M71T) | ENSGALT00000096195.1:c.212T>C ENSGALP00000071620.1:p.Met71Thr | rs312264213 | 2017 | 28699279 | ||
| 6 | OMIA:000374-9031 | chicken | Feather colour, extended black | MC1R | E | substitution | missense | Naturally occurring variant | Not currently evaluated | GRCg6a | 11 | g.18840919G>A | c.274G>A | p.(E92K) | ENSGALT00000096195.1:c.274G>A ENSGALP00000071620.1:p.Glu92Lys | rs314881228 | 2003 | 12873211 | ||
| 1306 | OMIA:002108-9031 | chicken | Fayoumi (Chicken) | Barring, autosomal | MC1R | E*R(Fay), Pg | substitution | missense | Naturally occurring variant | Not currently evaluated | GRCg6a | 11 | g.18841043T>A | c.398T>A | p.(L133Q) | rs737523889 | 2021 | 33793042 | ||
| 7 | OMIA:000374-9031 | chicken | Feather colour, buttercup | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | GRCg6a | 11 | g.18841289A>C | c.644A>C | p.(H215P) | ENSGALT00000096195.1:c.644A>C ENSGALP00000071620.1:p.His215Pro | rs735789743 | 2003 | 12873211 | |||
| 1142 | OMIA:000374-9031 | chicken | Mie-Jidori, Japan (Chicken) | Feather colour, wheaten-like | MC1R | e^m | substitution | missense | Naturally occurring variant | Not currently evaluated | GRCg6a | 11 | g.18841289A>C | c.644A>C | p.(H215P) | ENSGALT00000096195.1:c.644A>C ENSGALP00000071620.1:p.His215Pro | rs735789743 | 2020 | 31977074 | |
| 1896 | OMIA:001199-36239 | least weasel | Coat colour, winter-brown | MC1R | delins, small (<=20) | missense | Naturally occurring variant | Not currently evaluated | mMusNiv2.hap1.1 | scaffold 337 | c.301_302delinsAA | p.(L101K) | 2026 | 41957296 | ||||||
| 1110 | OMIA:001199-9940 | sheep | Valle del Belice, Italy (Sheep) | Recessive pheomelanism | MC1R | e | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 14 | NC_040265.1:g.15487353C>T | NM_001282528.1:c.199C>T | NP_001269457.1:p.(R67C) | 2010 | Reference not in PubMed; see OMIA 001199-9940 for reference details | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 229 | OMIA:001199-9940 | sheep | Corriedale (Sheep) Dala (Sheep) Damara (Sheep) Merino (Sheep) | Dominant black | MC1R | E^D | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 14 | NC_040265.1:g.15487372T>A | NM_001282528.1:c.218T>A | NP_001269457.1:p.(M73K) | 1999 | 9892731 | c.218T>A obtained from Fontanesi et al. (2010); breeds obtained from Rochus et al. (2019); the genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 228 | OMIA:001199-9940 | sheep | Massese, Italy (Sheep) | Dominant black | MC1R | E^D | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 14 | NC_040265.1:g.15487515G>A | NM_001282528.1:c.361G>A | NP_001269457.1:p.(D121N) | 1999 | 9892731 | c.361G>A obtained from Fontanesi et al. (2010); breed obtained from Ruchus et al. (2019); the genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1108 | OMIA:001199-9940 | sheep | Gute (Sheep) Swedish Fur (Sheep) Värmlandsfår, Sweden (Sheep) | Dominant black | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 14 | NC_040265.1:g.15487606G>A | NM_001282528.1:c.452G>A | NP_001269457.1:p.(R151Q) | 2019 | 31475378 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| 170 | OMIA:001199-9823 | pig | Duroc (Pig) | Red | MC1R | e | substitution | missense | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 6 | NC_010448.4:g.181461C>T | NM_001008690.1:c.727G>A | NP_001008690.1:p.(A243T) | Variant is called p.(A240T) in original paper (Kijas et al., 1998). Two substitutions were found in recessive red (e/e) animals p.(A161V) and p.(A240T) - the p.(A240T) was considered as causative (Kijas et al., 1998). The Sscrofa11.1 reference genome is from a recessive red animal. | rs321432333 | 1998 | 9799269 | |
| 171 | OMIA:001199-9823 | pig | Duroc (Pig) | Red | MC1R | e | substitution | missense | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 6 | NC_010448.4:g.181697G>A | NM_001008690.1:c.491C>T | NP_001008690.1:p.(A164V) | Variant is called p.(A161V) in original paper (Kijas et al., 1998). Two substitutions were found in recessive red (e/e) animals p.(A161V) and p.(A240T) - the p.(A240T) was considered as causative (Kijas et al., 1998). The Sscrofa11.1 reference genome is from a recessive red animal. | rs45435032 | 1998 | 9799269 | |
| 169 | OMIA:001199-9823 | pig | Hampshire Down (Sheep) | Dominant black | MC1R | E^D2 | substitution | missense | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 6 | NC_010448.4:g.181818C>T | NM_001008690.1:c.370G>A | NP_001008690.1:p.(D124N) | Variant is called p.(D121N) in original paper (Kijas et al., 1998). cDNA and protein location in this table are based on transcript ENSSSCT00000022534.2. | rs326921593 | 1998 | 27703696 9799269 | |
| 168 | OMIA:001199-9823 | pig | Large Black (Pig) Meishan (Pig) | Dominant black | MC1R | E^D1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 6 | NC_010448.4:g.181883A>G | NM_001008690.1:c.305T>C | NP_001008690.1:p.(L102P) | Variant is called p.(L99P) in original paper (Kijas et al., 1998). Two silent (p.(A240A), p.(N118N)) and two missense substitutions p.(V92M) and p.(L99P) were found in dominant black Asian pigs (E^D1/E^D1) (Kijas et al., 1998). cDNA and protein location in this table are based on transcript ENSSSCT00000022534.2. | rs45434630 | 1998 | 9799269 | |
| 1290 | OMIA:001199-9823 | pig | Large Black (Pig) Meishan (Pig) | Dominant black | MC1R | E^D1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 6 | NC_010448.4:g.181905C>T | NM_001008690.1:c.283G>A | NP_001008690.1:p.(V95M) | Variant is called p.(V92M) in original paper (Kijas et al., 1998). Two silent (p.(A240A), p.(N118N)) and two missense substitutions p.(V92M) and p.(L99P) were found in dominant black Asian pigs (E^D1/E^D1) (Kijas et al., 1998). cDNA and protein location in this table are based on transcript ENSSSCT00000022534.2. | rs45434629 | 1998 | 9799269 | |
| 597 | OMIA:001199-9823 | pig | Bama Xiang Zhu, China (Pig) Pietrain (Pig) | Coat colour, black spotting on red or white background | MC1R | E^P, E^qy | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 6 | NC_010448.4:g.182126_182127insGG | NM_001008690.1:c.67_68insCC | NP_001008690.1:p.(R23Pfs*33) | Variant was published as nt67insCC (Kijas et al., 2001), g.462-463CC (Wu et al., 2017), c.67_68insCC (Jia et al. 2017) | rs1111798655 | 2001 | 28002929 28411032 11404341 | |
| 1741 | OMIA:000374-56313 | barn owl | Feather colour, rufous | MC1R | R | substitution | missense | Naturally occurring variant | Not currently evaluated | T.alba_DEE_v4.0 | Super-scaffold 26 | NW_024881300.1:g.22522039G>A | c.376G>A | p.(V126I) | valine allele is associated with whiter plumage colorations, whereas the isoleucine allele is associated to redder plumage (rufous) coloration | 2015 | 25857339 | Genomic coordinates as reported by Cumer et al. 2024 (PMID:38196365) | ||
| 115 | OMIA:001199-9627 | red fox | Coat colour, extension | MC1R | E^A | substitution | missense | Naturally occurring variant | Not currently evaluated | VulVul2.2 | NW_020356486.1 | g.6101019T>C | c.373T>C | p.(C125R) | XM_026005028.1; XP_025860813.1 | 1997 | 9054949 | |||
| 1344 | OMIA:002217-9823 | pig | Fatness, growth, feed intake | MC4R | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 1 | g.160773437G>A | c.892G>A | p.(D298N) | ENSSSCT00000091644.1:c.892G>A ENSSSCP00000074588.1:p.Asp298Asn | rs81219178 | 2000 | 10656927 | Variant coordinates updated based on Johnsson and Jungnickel (2021) | ||||
| 1603 | OMIA:002750-9615 | dog | reduced hair shedding | MC5R | substitution | missense | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 1 | NC_049222.1:g.24541931C>T | XM_038525579.1:c.709G>A | XP_038381507.1:p.(A237T) | XM_038525579.1; XP_038381507.1; the variant is reported to be associated with reduced hair shedding and shorter hair length and may not be causal | 2016 | 26795439 | ||||
| 1900 | OMIA:000128-9031 | chicken | Blood group H | MCAM | H2 | substitution | missense | Naturally occurring variant | Not currently evaluated | GRCg6a | 24 | NC_006111.5:g.4246215G>A | NM_001004768.1:c.144G>A | NP_001004768.1:p.(V482I) | rs739155076 | 2026 | 42074531 | |||
| 1437 | OMIA:002716-9615 | dog | German Shepherd Dog (Dog) | Congenital idiopathic megaesophagus, risk factor | MCHR2 | repeat variation | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 12 | Bell et al. (2022): "Within the first intron of MCHR2, we identified a 33 bp variable number tandem repeat (VNTR) containing a consensus binding sequence for the T-box family of transcription factors. Across dogs and wolves, the major allele includes two copies of the repeat, whereas the predominant alleles in GSDs have one or three copies. The single-copy allele is strongly associated with CIM (P-val = 1.32x10-17), with homozygosity for this allele posing the most significant risk". | 2022 | 35271580 | |||||||
| 1658 | OMIA:002814-9615 | dog | Eurasier (Dog) | Polioencephalopathy | MECR | substitution | missense | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 2 | NC_049223.1:g.70793040A>G | XM_038531348.1:c.823A>G | XP_038387276.1:p.(M275V) | XM_038531348.1; XP_038387276.1, variant reported in 3 affected dogs | 2024 | 38041431 | |||
| 558 | OMIA:002043-9913 | taurine cattle | Belgian Blue (Cattle) | Abortion (embryonic lethality), MED22-related | MED22 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | 11 | p.(L38Rfs*25) | 2016 | 27646536 | |||||||
| 819 | OMIA:001932-9615 | dog | Swedish Vallhund (Dog) | Progressive retinal atrophy, MERTK-related | MERTK | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 17 | An insertion of "a full-length [6.401 kb] LINE-1 element comprising the 15 bp target site duplication [indicated by 'ins' in the g. notation], a 5’UTR, 900 bp 5’ ORF1, a 49 bp intergenic spacer, a 3,828 bp 3’ ORF2, a 3’UTR and poly(A) tail. The LINE-1 element has been inserted in the same orientation as the MERTK gene.". 200922: g. info has been moved to here (g.36338043-36338057ins) until it can be standardised | 2017 | 28813472 | Genomic location provided by Sally Ricketts | ||||||
| 1489 | OMIA:002551-9615 | dog | Bull Mastiff (Dog) | Mitochondrial fission encephalopathy | MFF | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 25 | g.40322999_40323003delinsCGCTCT | c.471_475delinsCGCTCT | p.(E158Afs*14) | XM_038574000.1; XP_038429928.1 | 2022 | 36085405 | |||
| 374 | OMIA:001106-9913 | taurine cattle | Blanco Orejinegro, Colombia (Cattle) Tiroler Grauvieh (Cattle) | Axonopathy | MFN2 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 16 | NC_037343.1:g.41686003G>A | NM_001190270.1:c.2229C>T | "This SNP is located within a putative exonic splice enhancer (ESE) and the variant allele leads to partial retention of the entire intron 19 and a premature stop codon in the aberrant MFN2 transcript". Variant initially identified in Tiroler Grauvieh and later reported in additional breeds: PMID:34779908 | rs5334475057 | 2011 | 21526202 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 472 | OMIA:002153-9615 | dog | Schnauzer-Beagle Cross (Dog) | Neuroaxonal dystrophy | MFN2 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 2 | g.84289962_84289964del | c.1617_1619del | p.(E539del) | NM_001284441.1; NP_001271370.1; published as c.1617_1619delGGA; genomic position considers 3' rule of the HGVS | 2011 | 21643798 | Genomic position in CanFam3.1 provided by Robert Kuhn. | ||
| 1426 | OMIA:002197-9796 | domestic horse | Shetland Pony (Horse) | Coat colour, dilution (mushroom) | MFSD12 | Mu | duplication | frameshift | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 7 | NC_009150.3:g.2544518dup | XM_023646425.1:c.600dup | XP_023502193.1:p.(D201fs) | XM_023646425.1; XP_023502193.1; published as NC_009150.3: g.2544512dup (XM_023646425.1:c.600dupC, p.Asp201fs); coordinates in the table have been updated to reflect HGVS nomenclature | 2019 | 31635058 | ||
| 1081 | OMIA:002197-9615 | dog | Afghan Hound (Dog) Akita (Dog) Alaskan Malamute (Dog) Bichon Frise (Dog) Coton de Tulear (Dog) German Shepherd Dog (Dog) Huntaway (Dog) Leonberger (Dog) New Zealand Heading Dog (Dog) Poodle (Dog) Pug (Dog) Puli (Dog) Saluki (Dog) Samoyed (Dog) Schnauzer (Dog) Scottish Terrier (Dog) West Highland White Terrier (Dog) White Swiss Shepherd Dog (Dog) | Coat colour, white or cream | MFSD12 | substitution | missense | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 20 | NC_049241.1:g.56252402C>T | XM_038567816.1:c.151C>T | XP_038423744.1:p.(R51C) | Additional breeds based on PMID:40965331 | rs22915955 | 2019 | 31117290 | The cDNA coordinate kindly provided by Tosso Leeb [19/05/23] and genomic coordinates were corrected by Claire Wade [30/05/24] ; the previously linked EVA ID (rs22915955) was removed as incorrect [30/05/2024] | |
| 1637 | OMIA:002371-9940 | sheep | Kerry Hill (Sheep) | Microcephaly, MFSD2A-related | MFSD2A | duplication | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v2.0 | 1 | NC_056054.1:g.14577421dup | XM_004001833.5:c.285dup | XP_004001882.2:p.(D96Rfs*9) | XM_004001833.5; XP_004001882.2 | 2024 | 37921236 | |||
| 1694 | OMIA:001962-9986 | rabbit | Lionhead Dwarf | Neuronal ceroid lipofuscinosis, 7 | MFSD8 | duplication | frameshift | Naturally occurring variant | Not currently evaluated | 15 | NC_013683.1:g.103727963_103738667dup | XM_002717263.3:c.202_701dup | XP_002717309.2:p.(E235Lfs*23) | 2024 | 38712841 | |||||
| 551 | OMIA:001962-9615 | dog | Chihuahua (Dog) Chinese Crested (Dog) | Neuronal ceroid lipofuscinosis, 7 | MFSD8 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 19 | g.13010761del | c.846del | p.(F282Lfs*13) | XM_014121438.2;XP_013976913.1; published as c.843delT; coordinates in the table have been updated to a recent reference genome and / or transcript | 2015 | 25551667 | Breed and p. information obtained from Katz et al. (2017) Neurobiol Dis. doi: 10.1016/j.nbd.2017.08.017; genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. | ||
| 1148 | OMIA:001962-9685 | domestic cat | Domestic Shorthair (Cat) | Neuronal ceroid lipofuscinosis, 7 | MFSD8 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.96630789del | XM_045055884.1:c.780del | XP_044911819.1:p.(Q262Kfs*33) | published as c.780delT | 2020 | 31860737 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1754 | OMIA:001962-9615 | dog | Small Swiss Hound (Dog) | Neuronal ceroid lipofuscinosis, 7 | MFSD8 | duplication | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 19 | NC_049240.1:g.13811543_13830361dup | XM_038564680.1:c.202-519_1365dup | 2024 | 39434657 | ||||||
| 1374 | OMIA:002465-9615 | dog | Italian Cane Corso (Dog) | Dental-skeletal-retinal anomaly | MIA3 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 38 | g.16920529_16920530del | c.3822+3_3822+4del | p.(V1238_K1274del) | XM_005640835.3; XP_005640892.1; published as g.16920529_16920530delAT, leads to skipping of two exons: XM_005640835.3:r.3712_3822del | 2021 | 34680893 | |||
| 1085 | OMIA:001040-9615 | dog | Rhodesian Ridgeback (Dog) | Ventricular arrhythmias and sudden death | MICOS13 | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 20 | g.54343438G>A | c.325G>A | p.(G109S) | ENSCAFG00000018796: g.54343438 G>A. ENSCAFT00000029838.4:c.325G>A ENSCAFP00000027731.3:p.G109S) | rs852200012 | 2019 | 30795627 | ||||
| 644 | OMIA:001565-9913 | taurine cattle | Ayrshire (Cattle) | Abortion and stillbirth due to mutation in MIMT1 | MIMT1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 18 | a 110 kb deletion in the MIMT1 gene | 2010 | 21152099 | ||||||||
| 1287 | OMIA:002309-9646 | giant panda | Cataract | MIP | substitution | missense | Naturally occurring variant | Not currently evaluated | c.686G>A | p.(S229N) | 2021 | 33530927 | ||||||||
| 678 | OMIA:001931-9913 | taurine cattle | Holstein (black and white) (Cattle) | Depigmentation associated with microphthalmia | MITF | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 22 | a de novo deletion of a 19.1 Mb region of BTA22 from 28 835 247-47 983 179 | 2014 | 25199536 | ||||||||
| 1727 | OMIA:002679-8839 | Mallard | White Pekin (Duck (domestic)) | Feather colour, white, MITF-related | MITF | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 13 | intronic insertion of a 6634bp retrotransposon | 2018 | 30018292 | ||||||||
| 385 | OMIA:001401-10036 | golden hamster | Waardenburg syndrome, type 2A | MITF | substitution | splicing | Naturally occurring variant | Not currently evaluated | A T>A base substitution in intron 6 of MITF leads to the skipping of exon 7 and a premature termination. | 2003 | 12871913 | |||||||||
| 503 | OMIA:000915-93934 | Japanese quail | Feather colour, silver | MITF | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | "a two-base deletion resulting in premature termination of the polypeptide in the region following the zipper region" = 2 bp deletion in exon 11 | 1998 | 9576828 | |||||||||
| 505 | OMIA:000755-93934 | Japanese quail | Osteopetrosis | MITF | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | same MITF variant as for silver, as reported in 1998 | 2001 | 11169846 | ||||||||||
| 1378 | OMIA:001401-9823 | pig | Bama Xiang Zhu, China (Pig) | Waardenburg syndrome, type 2A | MITF | substitution | missense | Chemical mutagenesis (ENU) | Not currently evaluated | 13 | c.740T>C | p.(L247S) | 2017 | 29094203 | ||||||
| 837 | OMIA:001680-9913 | taurine cattle | Holstein (black and white) (Cattle) | Glass-eyed albino | MITF | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 22 | g.31628127_31628129del | p.(R211del) | UMD3.1 position g.31746506_31746508del | rs5334474965 | 2017 | 28904385 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||
| 1547 | OMIA:001401-9913 | taurine cattle | Angus (Cattle) | White coat colour | MITF | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 22 | g.31628133_31628135del | c.668_670del | p.(R224del) | ENSBTAT00000080989.1; ENSBTAP00000059022.1; published as chr22.g.31628127_31628128del and delR217 - coordinates have been changed to HGVS nomenclature in this table | 2023 | 37062854 | |||
| 782 | OMIA:000214-9913 | taurine cattle | Holstein (black and white) (Cattle) Simmental (Cattle) | Coat colour, white spotting | MITF | substitution | regulatory | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 22 | g.31650821T>A | c.33+112A>T | UMD3.1 position is g.31769189 | rs210634530 | 2012 | 22486495 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||
| 1018 | OMIA:000214-9913 | taurine cattle | Brown Swiss (Cattle) | Coat colour, white spotting | MITF | substitution | regulatory | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 22 | g.31790063G>A | c.104+53185C>T | FN 190425: The Ensembl entry for rs722765315 lists two transcripts: ENSBTAT00000067269.1:c.104+53185C>T and ENSBTAT00000076082.1:c.-53+31498C>T | rs722765315 | 2019 | 30506810 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||
| 189 | OMIA:001680-9913 | taurine cattle | Fleckvieh-Simmental, Germany (Cattle) | Dominant white with bilateral deafness | MITF | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 22 | NC_037349.1:g.31628131C>A | NM_001001150.2:c.629G>T | NP_001001150.1:p.(R210I) | UMD3.1 position is g.31746502 | rs5334474903 | 2011 | 22174915 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 1850 | OMIA:000214-9913 | taurine cattle | Belgian Blue (Cattle) Hereford (Cattle) Holstein Friesian (Cattle) Jersey (Cattle) | Coat colour, splotchy face/specled spots/black socks | MITF | substitution | regulatory | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 22 | NC_037349.1:g.31651379A>G | epistatic with KIT variants for dominant white head or white spotting | 2025 | 41237223 | |||||
| 424 | OMIA:000214-9615 | dog | Coat colour, white spotting | MITF | delins, gross (>20) | regulatory | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 20 | g.21836232_21836427delinsN[198] | This 198bp SINEC-Cf insertion is the first of three possible regulatory variants described by Karlsson et al. (2007). | 2007 | 17906626 | The genomic location was kindly provided by Professor Claire Wade in August 2018. | |||||
| 1023 | OMIA:000214-9796 | domestic horse | American Paint (Horse) | White spotting, blue eyes and deafness | MITF | SW5 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 16 | NC_009159.3:g.21503211_21566617del | "~63-kb deletion spanning exons 6-9 of the MITF gene" | 2019 | 30644113 | |||||
| 1180 | OMIA:000214-9796 | domestic horse | American Paint (Horse) | Splashed white | MITF | SW6 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 16 | NC_009159.3:g.21551060_21559770del | NC_009159.3:g.21551060-21559770del (Magdesian et al., 2020) | 2020 | 32242630 | |||||
| 1626 | OMIA:000214-9796 | domestic horse | Thoroughbred (Horse) | Splashed white | MITF | SW8 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 16 | NC_009159.3:g.21555811_21558139delinsAAAT | 2023 | 37697831 | ||||||
| 166 | OMIA:000214-9796 | domestic horse | American Trotter (Horse) | White | MITF | MITF^244Glu | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 16 | NC_009159.3:g.21556522C>T | NM_001163874.1:c.1031G>A | NP_001157346.1:p.(G344E) | Published as XM_005600318.1:c.731G>A; XP_005600375.1:p.Gly244Glu) - updated in this table to reflect recent transcript ID | rs3435075789 | 2017 | 27592871 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124 |
| 1606 | OMIA:000214-9796 | domestic horse | Purebred Spanish (Horse) | Splashed white | MITF | SW9 | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 16 | NC_009159.3:g.21559940T>A | NM_001163874.1:c.961A>T | NP_001157346.1:p.(N321Y) | NM_001163874.1; NP_001157346.1; published as c.993A>T, variant associated with increased depigmentation | 2023 | 37406837 | ||
| 1488 | OMIA:000214-9796 | domestic horse | American Paint (Horse) Quarter Horse (Horse) | Splashed white | MITF | SW7 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 16 | NC_009159.3:g.21559953_21559955del | NM_001163874.1:c.949_951del | NP_001157346.1:p.R317del | NM_001163874.1; NP_001157346.1; published as c.949_951delTCT | 2022 | 35672910 | ||
| 156 | OMIA:000214-9796 | domestic horse | Freiberger (Horse) | Macchiato | MITF | macchiato | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 16 | NC_009159.3:g.21564980T>C | NM_001163874.1:c.629A>G | NP_001157346.1:p.(N310S) | rs5334475186 | 2012 | 22511888 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 793 | OMIA:000214-9796 | domestic horse | Quarter Horse (Horse) | Splashed white | MITF | SW3 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 16 | NC_009159.3:g.21567245_21567249del | NM_001163874.1:c.837_841del | NP_001157346.1:p.(C280Sfs*20) | NM_001163874.1; NP_001157346.1; published as c.837_841delGTGTC | 2012 | 22511888 | ||
| 792 | OMIA:000214-9796 | domestic horse | American Miniature Horse (Horse) American Paint (Horse) Appaloosa (Horse) Icelandic Horse (Horse) Morgan (Horse) Quarter Horse (Horse) Shetland Pony (Horse) Tori hobune, Estonia (Horse) Trakehner (Horse) | Splashed white | MITF | SW1 | delins, small (<=20) | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 16 | NC_009159.3:g.21579201delinsATAATAACCTA | g.20117302Tdelins11 | rs5334475212 | 2012 | 22511888 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |||
| 806 | OMIA:000214-9796 | domestic horse | American Trotter (Horse) Arab (Horse) Belgian Draft (Horse) Cavall Menorquí, Spain (Horse) Clydesdale (Horse) Freiberger (Horse) Icelandic Horse (Horse) Morgan (Horse) Quarter Horse (Horse) Shetland Pony (Horse) Thoroughbred (Horse) Warmblood (Horse) Welsh Pony (Horse) | White splashing | MITF | substitution | regulatory | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 16 | NC_009159.3:g.21608936C>T | Published as g.20147039C>T (EquCab2.0); may not be causal as the variant was identified to be a common variant across multiple breeds in a later study: PMID: 38600096 | 2017 | 28084638 | Breed information updated based on PMID: 38600096 | ||||
| 1205 | OMIA:001680-452646 | American mink | Hedlund | MITF | h | substitution | splicing | Naturally occurring variant | Not currently evaluated | MusPutFur1.0.86 | c.33+1G>A | GL896899.1:18635719 G/A (MITF-M C.33 + 1 G > A (Manakhov et al., 2017) | 2019 | 30872653 | ||||||
| 849 | OMIA:001401-9823 | pig | Rongchang, China (Pig) | Waardenburg syndrome, type 2A | MITF | insertion, small (<=20) | regulatory | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 13 | NC_010455.5:g.51377987_51377988insTTTAGTTTAAAAAA | a 14 bp insertion "in the non-regulatory region of the melanocyte-specific promoter of microphthalmia-associated transcription factor (MITF) gene generated a novel silencer" | rs5334475179 | 2016 | 27349893 | ||||
| 409 | OMIA:000214-89462 | water buffalo | Swamp buffalo (Buffalo) | White spotting | MITF | substitution | splicing | Naturally occurring variant | Not currently evaluated | UOA_WB_1 | 21 | NC_037565.1:g.31613452A>T | XM_025273060.1:c.1179+2T>A | Published as c.840+2T>A, coordinates in the table have been updated to reflect a recent reference genome. | 2015 | 26417640 | ||||
| 341 | OMIA:000214-89462 | water buffalo | Swamp buffalo (Buffalo) | White spotting | MITF | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | UOA_WB_1 | 21 | NC_037565.1:g.31637770G>A | XM_025273060.1:c.649C>T | XP_025128845.1:p.(R217*) | Published as c.328C>T , p.(R110*), coordinates in the table have been updated to reflect a recent reference genome. |
2015 | 26417640 | |||
| 976 | OMIA:002146-9615 | dog | Bull Terrier (Dog) Miniature Bull Terrier (Dog) | Lethal acrodermatitis | MKLN1 | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 14 | g.5731405T>G | c.400+3A>C | p.(G105Sfs*10) | This variant is "located within the 5’-splice site of intron 4 of the MKLN1 gene" | 2018 | 29565995 | |||
| 1209 | OMIA:001654-8932 | rock pigeon | Almond | MLANA | st | repeat variation | Naturally occurring variant | Not currently evaluated | "The CNV captures a 77-kb segment of the reference genome (ScoHet5_227: 5,181,467–5,259,256), with an additional increase in coverage in a nested 25-kb segment (ScoHet5_227: 5,201,091–5,226,635). Read-depth analysis confirmed 7 copies of the outer 77-kb segment and 14 copies of the inner 25-kb segment in the genomes of female (ZStW) Almond pigeons, which have an St locus on only one chromosome. We used PCR to amplify across the outer and inner CNV breakpoints of Almond pigeons and determined that the CNV consists of tandem repeats of the 77-kb and nested 25-kb segments (Fig 3)." (Bruders et al., 2020) | 2020 | 32433666 | |||||||||
| 1014 | OMIA:002145-9544 | Rhesus monkey | Colorectal cancer, MLH1-related | MLH1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | 2 | c.1029C<G | p.(Y343*) | Dray et al. (2018): "a de novo stop codon in the coding region of MLH1. This de novo stop codon occurs in exon 11 out of 19 in the MLH1 gene, and thus would produce a dramatically truncated and possibly non-functional protein". Ozirmak Lermi et al. (2022) reported the c. and p. coordinates of this variant. | 2018 | 30108684 | ||||||
| 1013 | OMIA:002145-9544 | Rhesus monkey | Colorectal cancer, hereditary nonpolyposis, MLH1-related | MLH1 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | 2 | g.99561829_99561830del | Brammer et al. (2018): "a heterozygous deletion in the putative promoter region of the MLH1 gene (rheMac2: 2:99,561,829– 99,561,830; hg19: ∼3:37,034,780; c.−258_259)" | 2018 | 29490919 | ||||||||
| 653 | OMIA:001445-93934 | Japanese quail | Feather colour, lavender | MLPH | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | a large deletion in the region of the quail MLPH gene | 2002 | 12011184 | ||||||||||
| 672 | OMIA:000031-452646 | American mink | Coat colour, silver-blue | MLPH | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | deletion of exon 8 | 2013 | 23747352 | ||||||||||
| 1683 | OMIA:000031-9669 | domestic ferret | Coat colour, silver | MLPH | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | p.(S327Tfs*46) | an inversion of two nucleotides and a single nucleotide deletion in the 9th exon of MLPH | 2023 | 38189891 | ||||||||
| 1617 | OMIA:002758-51751 | ball python | Skin colour, Ghost | MLPH | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | c.4919_4923del | p.(Q350Ilefs*15) | OR035642 | 2023 | 37637270 | |||||||
| 807 | OMIA:001445-9031 | chicken | Five gray | MLPH | substitution | missense | Naturally occurring variant | Not currently evaluated | 7 | g.4727070A>G | c.1909A>G | 2016 | 27173258 | |||||||
| 553 | OMIA:000031-9913 | taurine cattle | Belgian Blue (Cattle) | Coat colour, cool gray | MLPH | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 3 | NC_037330.1:g.116966611_116966620del | NM_001081597.1:c.87_96del | NP_001075066.1:p.(E32Dfs*1) | rs5334474900 | 2016 | 26582259 | The genomic location on ARS-UCD1.2 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries. | ||
| 1216 | OMIA:000031-9615 | dog | Chihuahua (Dog) Italian Greyhound (Dog) Mudi (Dog) Pekingese (Dog) Pumi (Dog) Shetland Sheepdog (Dog) Shih Tzu (Dog) Tibetan Mastiff (Dog) Yorkshire Terrier (Dog) | Dilute | MLPH | d^3 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 25 | g.48150749_50insC | c.667_668insC | p.(H223Pfs*41) | "(NM_001103219.2: c.667_668insC or chr25: g.48150749_50insC" (van Buren et al. (2020) | 2020 | 32531980 | ||
| 360 | OMIA:000031-9615 | dog | American Staffordshire Terrier (Dog) Beagle (Dog) Belgian Shepherd Dog, Malinois (Dog) Doberman Pinscher (Dog) German Pinscher (Dog) Huntaway (Dog) Large Munsterlander (Dog) Miniature Pinscher (Dog) New Zealand Heading Dog (Dog) Rhodesian Ridgeback (Dog) | Dilute | MLPH | d^1 | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 25 | NC_006607.3:g.48121642G>A | NM_001103219.2:c.-22G>A | Additional breeds based on PMID:40965331 | 2007 | 17519392 | Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool | ||
| 948 | OMIA:000031-9615 | dog | Chow Chow (Dog) Sloughi (Dog) Thai Ridgeback (Dog) | Dilute | MLPH | d^2 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 25 | NC_006607.3:g.48150787G>C | NM_001103219.2:c.705G>C | NP_001096689.2:p.(Q235H) | 2018 | 29349785 | |||
| 495 | OMIA:000031-9685 | domestic cat | Coat colour, dilute | MLPH | d | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | C1 | NC_058375.1:g.218197448del | NM_001079655.1:c.83del | NP_001073123.1:p.(L28Rfs*12) | rs5334475121 | 2006 | 16860533 | The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 8 | OMIA:001445-9031 | chicken | Feather colour, lavender | MLPH | substitution | missense | Naturally occurring variant | Not currently evaluated | GRCg6a | 7 | g.4833305G>A | c.103C>T | p.(R35W) | 2008 | 18197963 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||||
| 1204 | OMIA:000031-452646 | American mink | Silverblue | MLPH | p | substitution | splicing | Naturally occurring variant | Not currently evaluated | MusPutFur1.0.86 | g.662639G>A | c.901+1G>A | GL896909.1:662639 G/A (MLPH C.901 + 1 G > A) (Manakhov et al., 2019) | 2019 | 30872653 | |||||
| 1561 | OMIA:001445-9135 | common canary | Feather colour, Opal / Mogno | MLPH | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | NW_022042652.1 | g.66493407_66493413del | p.(A237fs) | XP_009086443.1 | 2023 | 37194440 | ||||||
| 1560 | OMIA:001445-9135 | common canary | Feather colour, Onyx | MLPH | substitution | missense | Naturally occurring variant | Not currently evaluated | NW_022042652.1 | g.66497548C>T | p.(R111K) | XM_009088195.3; XP_009086443.1 | 2023 | 37194440 | ||||||
| 1217 | OMIA:000031-9940 | sheep | Jacob (Sheep) | Lilac | MLPH | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 1 | NC_040252.1:g.3580535C>A | NM_001146271.1:c.40G>T | NP_001139743.1:p.(E14*) | Oar_v4.0 position is NC_019458.2:g.3451931C>A; NP_001139743.1:p.Glu14* (Posbergh et al., 2020) | 2020 | 32512769 | |||
| 932 | OMIA:000031-9986 | rabbit | Lionhead Dwarf Loh Netherland dwarf (Rabbit) | Coat colour, dilute | MLPH | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | OryCun2.0 | NW_003159466.1 | g.549853del | c.586del | p.(E196fs) | NM_001297485.1; NP_001284414.1; published as g.549853delG, c.585delG, p.(L195Lfs*123) - information in this table has been updated to reflect HGVS nomenclature recommendations | 2013 | 24376820 | |||
| 1690 | OMIA:002849-9940 | sheep | Manech Tête Rousse, France (Sheep) | Methylmalonyl-CoA mutase deficiency | MMUT | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 20 | NC_040271.1:g.23776347G>A | XM_004018875.4:c.1225C>T | XP_004018923.1:p.(Q409*) | 2024 | 38424485 | ||||
| 1433 | OMIA:000884-9031 | chicken | Rose comb | MNR2 | R2 | complex rearrangement | Naturally occurring variant | Not currently evaluated | galGal3 | 7 | g.16499781_16499782ins[23881384_23790414inv;16499583–16499781] | predicted to be the result of a recombination event between the wild-type allele and the R1 allele: "R2 does not carry the entire inversion but instead has two duplicated segments, one 91 kb fragment (23,790,414–23,881,384 bp) that represents a remaining fragment of the inverted region together with a small duplicated fragment of 198 bp (16,499,583–16,499,781 bp)" | 2012 | 22761584 | ||||||
| 745 | OMIA:000884-9031 | chicken | Rose comb | MNR2 | R1 | inversion | Naturally occurring variant | Not currently evaluated | galGal3 | 7 | g.16499782_23881391delins23881384_16499781 | published as a 7.38 Mb inversion | 2012 | 22761584 | ||||||
| 492 | OMIA:001819-9913 | taurine cattle | Brown Swiss (Cattle) Original Swiss Brown (Cattle) Tiroler Grauvieh (Cattle) | Xanthinuria, type II | MOCOS | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 24 | NC_037351.1:g.20911933del | XM_024984177.1:c.1881del | XP_024839945.1:p.(S628Vfs9*) | Published using UMD3.1 position: g.21222030delC; cDNA and protein positions are given transcript: ENSBTAT00000048768. Positions for a second transcript (ENSBTAT00000065375) were given in the paper: c.1782del and p.(S595Vfs9*). Variant was initially described in Tyrolean Grey cattle and later reported in Brown Swiss cattle (PMID: 37675885) | rs5334474910 | 2016 | 27919260 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 446 | OMIA:001819-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Xanthinuria, type II | MOCOS | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 24 | NC_037351.1:g.20936257_20936259del | NM_174081.2:c.769_771del | NP_776506.1:p.(Y257del) | published as c.769_771delTAC | 2000 | 10801779 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||
| 1355 | OMIA:001819-9615 | dog | Manchester Terrier (Dog) | Xanthinuria, type II | MOCOS | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 7 | g.53995018C>A | c.232G>T | p.(G48_Y77del) | ENSCAFT00000028243.4; “Ensembl VEP determined the consequence of the variant to be a missense, splice region variant … the variant results in the removal of all 90 bp (30 amino acids) of exon 2 (p.Gly48_Tyr77del); the genomic position is based on supplementary table S3 (Tate et al., 2021)”; transcript ENSCAFT00000028243.4 | 2021 | 34584846 | |||
| 1356 | OMIA:001819-9615 | dog | Cavalier King Charles Spaniel (Dog) English Cocker Spaniel (Dog) | Xanthinuria, type II | MOCOS | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 7 | NC_006589.3:g.53989863del | XM_547604.6:c.383del | XP_547604.4:p.(A128Gfs*30) | c.383delC; transcript ENSCAFT00000028243.4; genomic position based on supplementary table S3 (Tate et al., 2021) | 2021 | 34584846 | |||
| 1357 | OMIA:001819-9615 | dog | Dachshund (Dog) | Xanthinuria, type II | MOCOS | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 7 | NC_006589.3:g.54001790A>G | XM_547604.6:c.137T>C | XP_547604.4:p.(L46P) | transcript ENSCAFT00000028243.4; genomic position based on supplementary table S3 (Tate et al., 2021) | 2021 | 34584846 | |||
| 483 | OMIA:001541-9913 | taurine cattle | Simmental (Cattle) | Arachnomelia, BTA23 | MOCS1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 23 | g.13837657_13837658del | c.1224_1225del | p.(H408Qfs*51) | 220110: changed g.13837654_13837655del to g.13837657_13837658del based on HGVS 3'rule. ENSBTAT00000013792.6:c.1224_1225del ENSBTAP00000013792.5:p.His408GlnfsTer51 | rs383500843 | 2011 | 21255426 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. | |
| 326 | OMIA:001366-9031 | chicken | Retinal dysplasia and degeneration | MPDZ | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | GRCg6a | Z | g.31023848G>A | c.1372C>T | p.(R458*) | 2011 | 21862650 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||||
| 342 | OMIA:002028-9615 | dog | Italian Hound (Dog) | Myeloperoxidase deficiency | MPO | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | NC_006591.3:g.32929382G>A | XM_847352.4:c.1936C>T | XP_852445.2:p.(R646*) | XM_847352.4; XP_852445.2; published as c.1987C>T (Ensembl transcript ID:ENSCAFT00000027699) | 2016 | 27296514 | |||
| 1592 | OMIA:002739-9615 | dog | Golden Retriever (Dog) | Polyneuropathy, hypomyelinating, MPZ-related | MPZ | substitution | missense | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 38 | NC_049259.1:g.22037876T>C | XM_038585926.1:c.434T>C | XP_038441854.1:p.(I145T) | XM_038585926.1; XP_038441854.1; heterozygous in a single affected dog | 2023 | 37400349 | |||
| 491 | OMIA:001452-9913 | taurine cattle | Belgian Blue (Cattle) | Tail, crooked | MRC2 | deletion, small (<=20) | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 19 | g.47095176_47095177del | c.2904_2905del | p.(G934*) | rs5334475077 | 2009 | 19779552 | Breed and some variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) 210908 the entry g.47740473delAG can't be correct because if two bases have been deleted, the g. notation must include the two relevant base positions. FN BLASTED the sequence CCAGACCTGCCGCCCACAG obtained from Fig 3 against UMD3.1.1, and determined that the entry should be g.47740474_47740475del | ||
| 208 | OMIA:001452-9913 | taurine cattle | Belgian Blue (Cattle) | Tail, crooked | MRC2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.47089627T>G | NM_001192670.1:c.1906T>G | NP_001179599.1:p.(C636G) | rs466131011 | 2012 | 22497452 | Breed and some variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1417 | OMIA:002518-9913 | taurine cattle | Brown Swiss (Cattle) Original Swiss Brown (Cattle) | Haplotype with homozygous deficiency BH14 | MRPL55 | BH14 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 7 | NC_037334.1:g.2996436C>T | NM_001303490.1:c.169C>T | NP_001290419.1:p.(R57*) | NM_001303490.1 | rs461014370 | 2021 | 34915862 | |
| 1015 | OMIA:002160-9544 | Rhesus monkey | Colorectal cancer, hereditary nonpolyposis, MSH6-related | MSH6 | substitution | missense | Naturally occurring variant | Not currently evaluated | Dray et al. (2018): "a heterozygous missense mutation in MSH6 that has a CADD score of 22.8, indicating that it would be among the <1% most deleterious mutations possible in the human genome (if that variant occurred in the human MSH6 gene" | 2018 | 30108684 | |||||||||
| 1189 | OMIA:000319-9823 | pig | Ear size | MSRB3 | repeat variation | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 5 | "the 38.7-kb CNV . . . starts at 349,577 bp and ends at 388,246 bp of the corrected contig (MK028166) . . . , covering the last two exons 6 and 7 of the MSRB3 gene" (Chen et al., 2018) | 2018 | 30587124 | ||||||||
| 443 | OMIA:001538-9796 | domestic horse | Racing distance, association with | MSTN | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 18 | A "227 bp SINE insertion positioned upstream of exon 1" | 2015 | 26503543 | |||||||||
| 618 | OMIA:000683-9913 | taurine cattle | Maine-Anjou (Cattle) | Muscular hypertrophy (double muscling) | MSTN | nt419(del7-ins10) | delins, small (<=20) | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 2 | g.6281243_6281249delinsAAGCATACAA | c.419_425delinsAAGCATACAA | p.(F140*) | cDNA and protein positions based on NM_001001525.3 and NP_001001525.1, retrospectively | rs5334475091 | 1998 | 9501304 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Variant coordinates updated based on Johnsson and Jungnickel (2021) |
| 212 | OMIA:000683-9913 | taurine cattle | Gelbvieh (Cattle) | Muscular hypertrophy (double muscling) | MSTN | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.6279187T>C | NM_001001525.3:c.191T>C | NP_001001525.1:p.(L64P) | UMD3.1 position is g.6213889T>C | rs449270213 | 2015 | 25515003 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 771 | OMIA:000683-9913 | taurine cattle | Angus (Cattle) Limousin (Cattle) | Muscular hypertrophy (double muscling) | MSTN | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.6279278C>A | NM_001001525.3:c.282C>A | NP_001001525.1:p.(F94L) | UMD3.1 position is g.6213980A>C | rs110065568 | 1998 | 9501304 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 772 | OMIA:000683-9913 | taurine cattle | Parthenais (Cattle) | Muscular hypertrophy (double muscling) | MSTN | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.6279310C>G | NP_001001525.1:c.314C>G | NP_001001525.1:p.(S105C) | UMD3.1 position is g.6214012C>G | rs5334475047 | 2002 | Reference not in PubMed; see OMIA 000683-9913 for reference details | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 773 | OMIA:000683-9913 | taurine cattle | Maine-Anjou (Cattle) | Muscular hypertrophy (double muscling) | MSTN | D182N | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.6281368G>A | NM_001001525.3:c.544G>A | NP_001001525.1:p.(D182N) | rs5334475067 | 2002 | Reference not in PubMed; see OMIA 000683-9913 for reference details | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 299 | OMIA:000683-9913 | taurine cattle | Blonde d'Aquitaine (Cattle) Charolais (Cattle) Limousin (Cattle) | Muscular hypertrophy (double muscling) | MSTN | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.6281434C>T | NM_001001525.3:c.610C>T | NP_001001525.1:p.(Q204*) | UMD3.1 position is g.6216138C>T | rs110344317 | 1998 | 9501304 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 300 | OMIA:000683-9913 | taurine cattle | Maine-Anjou (Cattle) Marchigiana (Cattle) | Muscular hypertrophy (double muscling) | MSTN | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.6281500G>T | NM_001001525.3:c.676G>T | NP_001001525.1:p.(E226*) | UMD3.1 position is g.6216204G>T | rs5334474940 | 1998 | 9501304 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 489 | OMIA:000683-9913 | taurine cattle | Angus (Cattle) Asturian Valley (Cattle) Belgian Blue (Cattle) Blonde d'Aquitaine (Cattle) Braford (Cattle) Japanese Black, Japan (Cattle) Limousin (Cattle) Murray Grey (Cattle) Parthenais (Cattle) Santa Gertrudis (Cattle) South Devon (Cattle) | Muscular hypertrophy (double muscling) | MSTN | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.6283674_6283684del | NM_001001525.3:c.818_828del | NP_001001525.1:p.(D273Rfs*14) | UMD3.1 position is g.6218379delATGAACACTCC; c. previously listed as c.821_831del - updated to recent transcript ID and incorrect EVA rs382669990 replaced [29/08/2024] | rs5384554823 | 1997 | 9288100 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Protein coordinates updated based on Johnsson and Jungnickel (2021). Additional breeds added based on recent publications: PMID: 40170586. | |
| 301 | OMIA:000683-9913 | taurine cattle | Maine-Anjou (Cattle) Marchigiana (Cattle) | Muscular hypertrophy (double muscling) | MSTN | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.6283727G>T | NM_001001525.3:c.871G>T | NP_001001525.1:p.(E291*) | UMD3.1 position is g.6218432G>T; c.1004G>T updated to c.871G>T [29/08/2024] | rs5334475075 | 2013 | 22497537 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 203 | OMIA:000683-9913 | taurine cattle | Gascon (Cattle) Parthenais (Cattle) Piedmont (Cattle) | Muscular hypertrophy (double muscling) | MSTN | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.6283794G>A | NM_001001525.3:c.938G>A | NP_001001525.1:p.(C313Y) | UMD3.1 position is g.6218499G>A | rs5334475012 | 1997 | 9314496 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 470 | OMIA:000683-9615 | dog | Whippet (Dog) | Muscular hypertrophy (double muscling) | MSTN | deletion, small (<=20) | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 37 | g.729362_729363del | c.939_940delTG | p.(C313*) | NM_001002959.1; NP_001002959.1; published as c.939_940delTG; genomic coordinates in accordance with HGVS 3'-rule | 2007 | 17530926 | Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. | ||
| 435 | OMIA:000683-9940 | sheep | Texel (Sheep) | Muscular hypertrophy (double muscling), Texel | MSTN | substitution | regulatory | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 2 | g.129065977G>A | c.*1232G>A | "G to A transition in the 3' UTR that creates a target site for mir1 and mir206, microRNAs (miRNAs)" | rs408469734 | 2006 | 16751773 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1019 | OMIA:002161-9823 | pig | Large White (Pig) | Leg weakness, MSTN-related | MSTN | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 15 | NC_010457.5:g.94623834C>A | NM_214435.2:c.820G>T | NP_999600.2:p.(E274*) | rs3473215843 | 2019 | 30699111 | |||
| 441 | OMIA:000683-9823 | pig | Pietrain (Pig) | Muscular hypertrophy (double muscling) | MSTN | substitution | regulatory | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 15 | NC_010457.5:g.94629236T>C | Stinckens et al. (2008) describe polymorphism located at position 447 of the porcine MSTN promoter, EF490986 EF490990 g.447A>G | rs332188828 | 2008 | 18822098 | ||||
| 112 | OMIA:001561-9615 | dog | Chinese Shar-Pei (Dog) | Periodic Fever Syndrome | MTBP | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 13 | NC_006595.3:g.19383758G>A | XM_846283.4:c.2623G>A | XP_851376.1:p.(E875K) | rs1152388482 | 2017 | 28472921 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||||
| 1459 | OMIA:001508-9615 | dog | Boykin Spaniel (Dog) | Myotubular myopathy 1 | MTM1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | g.118903496C>T | c.1467C>T | p.(R512*) | ENSCAFP00000028221.3 | 2020 | 32417001 | |||
| 63 | OMIA:001508-9615 | dog | Labrador Retriever (Dog) | Myotubular myopathy 1 | MTM1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | NC_006621.3:g.118885117C>A | XM_005641935.3:c.465C>A | XP_005641992.1:p.(N155K) | XM_005641935.3; XP_005641992.1 | rs1152388426 | 2010 | 20682747 | Genomic coordinates in CanFam3.1 and EVA ID provided by Robert Kuhn | |
| 91 | OMIA:001508-9615 | dog | Rottweiler (Dog) | Myotubular myopathy 1 | MTM1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | NC_006621.3:g.118901282A>C | XM_005641935.3:c.1151A>C | XP_005641992.1:p.(Q384P) | XM_005641935.3; XP_005641992.1 | 2015 | 25664165 | Genomic position in CanFam3.1 provided by Robert Kuhn and Mateo Etcheveste. | ||
| 1475 | OMIA:001508-9685 | domestic cat | Maine Coon (Cat) | Myotubular myopathy 1 | MTM1 | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | X | NC_058386.1:g.122964931C>T | XM_023249466.2:c.455C>T | XP_023105234.1:p.(A152V) | 2022 | 35962713 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 1591 | OMIA:002727-9615 | dog | Golden Retriever (Dog) | Polyneuropathy, hypomyelinating, MTMR2-related | MTMR2 | substitution | splicing | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 21 | NC_049242.1:g.5387227G>A | XM_038568229.1:c.1479+1G>A | XM_038568229.1, reported in two dogs | 2023 | 37400349 | ||||
| 1524 | OMIA:001467-9615 | dog | Golden Retriever (Dog) | Neuropathy, sensory ataxic | MTTY | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | M | m.5304del | 2009 | 19492087 | ||||||||
| 14 | OMIA:001534-9031 | chicken | Resistance to myxovirus | MX1 | substitution | missense | Naturally occurring variant | Not currently evaluated | GRCg6a | 1 | g.110260061G>A | c.1892G>A | p.(S631N) | rs313590198 | 2002 | 11932243 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 217 | OMIA:001978-9913 | taurine cattle | Holstein Friesian (Cattle) | Arthrogryposis, distal, type 1B | MYBPC1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.65446598T>G | NM_001110773.1:c.884T>G | NP_001104243.1:p.(L295R) | rs5369172067 | 2015 | 26289121 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 902 | OMIA:002951-9685 | domestic cat | American Bobtail (Cat) American Bobtail Shorthair (Cat) Highlander (Cat) Munchkin (Cat) Ragamuffin (Cat) Ragdoll (Cat) | Cardiomyopathy, hypertrophic (autosomal dominant) | MYBPC3 | substitution | missense | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | D1 | NC_058377.1:g.99269394C>T | XM_019812397.2:c.2453C>T | XP_019667956.2:p.(R818W) | published as p.(R820W); coordinates in the table have been updated to a recent reference genome and / or transcript | 2007 | 17521870 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Additional breeds reported based on PMID:35709088. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 901 | OMIA:002952-9685 | domestic cat | Maine Coon (Cat) Maine Coon Polydactyl (Cat) Munchkin (Cat) Pixiebob Longhair (Cat) Ragdoll (Cat) Scottish Fold (Cat) Siberian (Cat) | Cardiomyopathy, hypertrophic (autosomal recessive) | MYBPC3 | substitution | missense | Naturally occurring variant | P | F.catus_Fca126_mat1.0 | D1 | NC_058377.1:g.99280283C>G | XM_019812397.2:c.91G>C | XP_019667956.2:p.(A31P) | variant initially reported in Main Coon cats and in a later study (Akiyama et al., 2023) identified in other breeds. | 2005 | 16236761 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Additional breeds reported based on PMID:35709088 and 38371598. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 973 | OMIA:002141-9796 | domestic horse | Belgian Draft (Horse) Quarter Horse (Horse) Welsh Pony (Horse) | Immune-mediated myositis | MYH1 | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 11 | NC_009154.3:g.53345548T>C | NM_001081759.1:c.959A>G | NP_001075228.1:p.(E320G) | The location of this likely causal variant was given as chr11:52,993,878T>C by Finno et al. (2018) in relation to the EquCab2.0 assembly. Applying NCBI's remap gives the EquCab3.0 coordinate as chr11:53,345,548 and p.(E320G) | rs3435577028 | 2018 | 29510741 | Breed information updated based on PMID: 38600096 | |
| 1500 | OMIA:002590-9913 | taurine cattle | Limousin (Cattle) | Cleft palate | MYH3 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 19 | g.[29609605-29609615del;29609623A>G] | c.[2864T>C;2872_2882del] | c.[I955T; p.L958Tfs*5] | NM_001101835.1 | 2022 | 36309651 | |||
| 556 | OMIA:002039-9913 | taurine cattle | Belgian Blue (Cattle) | Abortion (embryonic lethality), MYH6-related | MYH6 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 10 | g.21538917_21538919del | p.(K1730del) | 2016 | 27646536 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||||
| 1810 | OMIA:002212-9823 | pig | Yucatan Miniature, United States of America (Pig) | Cardiomyopathy, hypertrophic | MYH7 | substitution | missense | Transgenesis via somatic cell nuclear transfer (SCNT) | Not currently evaluated | p.(R403Q) | 2018 | 30104387 | ||||||||
| 1121 | OMIA:002212-9685 | domestic cat | Domestic Shorthair (Cat) | Cardiomyopathy, hypertrophic, MYH7-related | MYH7 | substitution | missense | Naturally occurring variant | LP/P | F.catus_Fca126_mat1.0 | B3 | NC_058373.1:g.73871470C>T | XM_006932746.5:c.5647G>A | XP_006932808.1:p.(E1883K) | rs3166775194 | 2019 | 31164718 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1798 | OMIA:002212-9823 | pig | Cardiomyopathy, hypertrophic | MYH7 | substitution | missense | Base-editing | Not currently evaluated | Sscrofa11.1 | 7 | NC_010449.5:g.75656919C>T | NM_213855.2:c.1357C>T | NP_999020.2:p.(R453C) | 2024 | 38862020 | |||||
| 1799 | OMIA:002212-9823 | pig | Cardiomyopathy, hypertrophic | MYH7 | substitution | missense | Genome-editing (TALEN) | Not currently evaluated | Sscrofa11.1 | 7 | NC_010449.5:g.75660381C>G | NM_213855.2:c.2167C>G | NP_999020.2:p.(R723G) | 2018 | 29555974 | |||||
| 598 | OMIA:001200-9823 | pig | Tremor, high-frequency (Campus syndrome) | MYH7 | insertion, small (<=20) | insertion (in-frame) | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 7 | NC_010449.5:g.75668348_75668349insCCCGCC | NM_213855.2:c.4320_4321insCCCGCC | NP_999020.2:p.(A1440_A1441insPA) | Genomic coordinates in OMIA were previously listed as g.75668349_75668350insGGCGGG, corrected 29/01/2025 | 2012 | 23153285 | The genomic location on Sscrofa10.2 was determined by Stephanie Shields (27/05/2020) and updated to the genomic Sscrofa11.1 location by Imke Tammen | |||
| 55 | OMIA:001608-9615 | dog | Pug (Dog) | May-Hegglin anomaly | MYH9 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 10 | NC_006592.3:g.28120346G>A | NM_001110767.1:c.5521G>A | NP_001104237.1:p.(E1841L) | NM_001110767.1; NP_001104237.1; previously incorrectly listed in OMIA as p.(Q1841L) (corrected 11/2/2022) | 2011 | 21554370 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn. | ||
| 1372 | OMIA:001501-9615 | dog | Dachshund, Miniature (Dog) | Coat colour dilution and neurological defects | MYO5A | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 30 | g.18004551_18004552insT | c.4973_4974insA | p.(N1658Kfs*28). | cDNA and protein positions based on XM_022412522.1 and XP_022268230.1, respectively | 2021 | 34680875 | |||
| 510 | OMIA:001501-9796 | domestic horse | Arab (Horse) | Lavender foal syndrome | MYO5A | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 1 | NC_009144.3:g.139290592del | XM_023617258.1:c.4249del | XP_023473026.1:p.(R1417Afs*13) | XM_023617258.1; XP_023473026.1; published as g.138235715delC; coordinates in the table have been updated to a recent reference genome | 2010 | 20419149 | The genomic position in EquCab3.0 was provided by Gracie Zinsmeister, working under the guidance of Professor Ernie Bailey in April 2022 | ||
| 1079 | OMIA:002148-9615 | dog | Doberman Pinscher (Dog) | Deafness, bilateral, and vestibular dysfunction | MYO7A | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 21 | NC_006603.3:g.21563111C>T | XM_022407643.1:c.3719G>A | XP_022263351.1:p.(R1240Q) | 2019 | 31097876 | ||||
| 1316 | OMIA:002148-9823 | pig | Duroc (Pig) | Vestibular dysfunction | MYO7A | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 9 | NC_010451.4:g.11280403C>T | NM_001099928.1:c.541C>T | NP_001093398.1:p.(Q181*) | cDNA position is based on transcript NM_001099928.1 | rs5334475170 | 2021 | 33955556 | ||
| 519 | OMIA:001342-8790 | emu | Mucopolysaccharidosis IIIB | NAGLU | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | c.1098_1099delGG | 2001 | 11414757 | ||||||||||
| 202 | OMIA:001342-9913 | taurine cattle | Santa Gertrudis (Cattle) | Mucopolysaccharidosis IIIB | NAGLU | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.42624367G>A | NM_001102226.2:c.1354G>A | NP_001095696.1:p.(E452K) | rs5334475071 | 2007 | 17458708 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 956 | OMIA:001342-9615 | dog | Schipperke (Dog) | Mucopolysaccharidosis IIIB | NAGLU | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | g.20407670_20407671ins[A[(40_70)];20407660_20407670] | c.2110_2111ins[A[(40_70)];2100_2110] | XM_548088; an insertion of 40 to 70 A nucleotides and an 11bp duplication of the sequence directly upstream of the poly-A | 2020 | 32081995 | |||||
| 986 | OMIA:001788-9615 | dog | Great Dane (Dog) Rottweiler (Dog) | Leukoencephalomyelopathy | NAPEPLD | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 18 | g.16987327_16987328insC | c.345_346insC | p.(E116Rfs*186) | 2018 | 29643404 | ||||
| 985 | OMIA:001788-9615 | dog | Leonberger (Dog) | Leukoencephalomyelopathy | NAPEPLD | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 18 | NC_006600.3:g.16987520G>C | XM_022405227.1:c.538G>C | NP_033360935.2:p.(A180P) | 2018 | 29643404 | ||||
| 1469 | OMIA:002557-9913 | taurine cattle | Cikasto govedo, Slovenia (Cattle) | Leber optic neuropathy | ND4L | substitution | missense | Naturally occurring variant | Not currently evaluated | M | m.10432T>C | Novosel et al. (2022): "two “mutant” Cika cattle animals (GenBank acc. Nos. MZ901663 and MZ MZ901663)" | 2019 | Reference not in PubMed; see OMIA 002557-9913 for reference details | ||||||
| 1315 | OMIA:002348-9615 | dog | English Cocker Spaniel (Dog) | Retinal dysplasia | NDP | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | g.37950668_37950668insC | c.653_654insC | p.(M114Hfs*16) | 2021 | 33945575 | ||||
| 1064 | OMIA:002189-8932 | rock pigeon | Barless | NDP | c | not known | start-lost | Naturally occurring variant | Not currently evaluated | Cliv_1.0 | Vickrey et al. (2018): "a nonsynonymous protein-coding change at the start codon of NDP". | 2018 | 30014848 | |||||||
| 474 | OMIA:002120-9615 | dog | Greyhound (Dog) | Polyneuropathy | NDRG1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 13 | g.29691070_29691079del | c.1080_1089del | p.(R361Sfs*60) | NM_001284434.1; NP_001271363.1, | 2010 | 20582309 | Genomic position in CanFam3.1 provided by Robert Kuhn and Mateo Etcheveste. | ||
| 73 | OMIA:002120-9615 | dog | Alaskan Malamute (Dog) | Polyneuropathy | NDRG1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 13 | NC_006595.3:g.29714606C>A | NM_001284434.1:c.293G>T | NP_001271363.1:p.(G98V) | NM_001284434.1; NP_001271363.1 | 2013 | 23393557 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1679 | OMIA:002840-9615 | dog | Chihuahua (Dog) Mixed Breed (Dog) | Leigh syndrome | NDUFS7 | substitution | missense | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 20 | NC_049241.1:g.57913322C>T | XM_038568001.1:c.535G>A | XP_038423929.1:p.(V179M) | Changed from NC_049241.1:g.57913322G>A to NC_049241.1:g.57913322C>T [09/06/2025] | 2024 | 38316835 | |||
| 961 | OMIA:002137-9615 | dog | American Bulldog (Dog) | Nemaline myopathy, NEB-related | NEB | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 19 | g.52734272G>T | p.(S8042*) | NP_001258137.1 | 2016 | 27215641 | ||||
| 1083 | OMIA:002198-9615 | dog | Giant Schnauzer (Dog) | Progressive retinal atrophy, NECAP1-related | NECAP1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 27 | NC_006609.3:g.37468611G>A | XM_543832.5:c.544G>A | XP_543832.2:p.(G182R) | 2019 | 31117272 | ||||
| 316 | OMIA:000545-93934 | Japanese quail | Hypotrophic axonopathy | NEFL | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.352C>T | p.(Q114*) | 1993 | 8468353 | ||||||||
| 747 | OMIA:001771-7091 | domestic silkworm | "Ming" lethal egg | NEWENTRY | complex rearrangement | Naturally occurring variant | Not currently evaluated | an ~1.9 kb region from the 3' untranslated region of BmVMP23 to the forepart of BmEP80 was replaced by a >100 kb DNA fragment | 2013 | 23262333 | ||||||||||
| 632 | OMIA:000218-9615 | dog | Collie eye anomaly | NHEJ1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 37 | g.25698028_25705826del | c.588+462_588+8260del | XM_005640671.1; a deletion of 7799bp in the NHEJ1 gene; for limitations on the utility of testing for the published likely causal variant, see the results of Fredholm et al. (2016) and Brown et al. (2018) | 2007 | 17916641 | ||||||
| 756 | OMIA:000690-9615 | dog | Beagle (Dog) Brussels Griffon (Dog) Chihuahua (Dog) Dachshund, Miniature Wire-Haired (Dog) French Bulldog (Dog) Mixed Breed (Dog) Newfoundland (Dog) Pembroke Welsh Corgi (Dog) | Myoclonus epilepsy of Lafora | NHLRC1 | repeat variation | Naturally occurring variant | Not currently evaluated | 35 | 19 to 26 copies of a sequence of 12 nucleotides (12-mer; dodecamer) in the canine EPM2B gene (now called NHLRC1) | 2005 | 15637270 | Additional breeds based on PMID: 34357061 | |||||||
| 766 | OMIA:002103-9913 | taurine cattle | Angus (Cattle) | Developmental duplications | NHLRC2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 26 | NC_037353.1:g.34340886T>C | NM_001083723.2:c.932T>C | NP_001077192.1:p.(V311A) | rs5334474969 | 2014 | Reference not in PubMed; see OMIA 002103-9913 for reference details | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 679 | OMIA:001936-9913 | taurine cattle | Romagnola (Cattle) | Cataract, recessive, Romagnola | NID1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 28 | "an 855 bp deletion across the exon 19/intron 19 border of the bovine nidogen 1 (NID1) gene (c.3579_3604+829del)" | 2014 | 25347398 | ||||||||
| 563 | OMIA:001980-9615 | dog | American Bulldog (Dog) American Bully (Dog) | Ichthyosis, NIPAL4-related | NIPAL4 | deletion, small (<=20) | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 4 | g.52737379del | c.744delC | p.(I249*) | 2017 | 28122049 | ||||
| 622 | OMIA:000938-9615 | dog | Weimaraner (Dog) | Spinal dysraphism | NKX2-8 | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 8 | g.15149895delinsAA | c.449delinsTT | p.(A150Vfs*6) | XM_847109.4; XP_852202.1 | 2013 | 23874236 | |||
| 1370 | OMIA:002464-9823 | pig | Large White (Pig) | Cryopyrin-associated periodic syndrome | NLRP3 | haplotype | missense | Genome editing (CRISPR/Cpf1) | Not currently evaluated | 2 | p.(R259W) | 2020 | 32958688 | |||||||
| 1096 | OMIA:002206-9615 | dog | Alaskan Malamute (Dog) | Ciliary dyskinesia, primary, NME5-related | NME5 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 11 | NC_006593.3:g.25792084del | XM_003639378.4:c.43delA | XP_003639426.1:p.(T15Lfs*56) | XM_003639378.4:c.43delA; XP_003639426.1:p.(Thr15LeufsTer56) | 2019 | 31479451 | |||
| 1718 | OMIA:002874-9913 | taurine cattle | Montbéliarde (Cattle) | Haplotype with homozygous deficiency, NOA1-related | NOA1A | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 6 | NC_037333.1:g.72359797_72359798insG | NM_001038188.2:c.1086_1087insC | NP_001033277.1:(p.D363Rfs*9) | Published as ENSBTAT00000071135.1:p.D400RfsX9 | rs5411279036 | 2023 | 39343954 Reference not in PubMed; see OMIA 002874-9913 for reference details | ||
| 664 | OMIA:001101-9031 | chicken | Polymorphic Nucleolar [PNU] strain, United States of America (Chicken) | Ribosomal RNA deficiency | NOR | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | "Embryos exhibiting a nucleolar phenotype of one large and one very small nucleolus (Pp) are heterozygous for a reduced rDNA cluster (+/p1) and were shown in the present study to contain about 66% of the complement of rRNA genes in normal individuals (+/+) that show two large equal-sized nucleoli (PP)" | 1994 | 8014461 | |||||||||
| 1441 | Holstein (black and white) (Cattle) Holstein-Friesian, Switzerland (Cattle) | Abortion due to haplotype HH21 | NOTCH3 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 7 | g.7913460_7913462del | c.129_131del | p.(C44del) | XM_003586246.3; XP_003586294.1; published as c.129_131delTTG | 2022 | 35361830 | ||||||
| 1244 | OMIA:000725-9913 | taurine cattle | Angus (Cattle) | Niemann-Pick type C1 | NPC1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 24 | NC_037351.1:g.33099467C>G | NM_174758.2:c.2969C>G | NP_777183.1:p.(P990R) | NM_174758.2:c.2969C>G | rs482882512 | 2020 | 32970694 | ||
| 134 | OMIA:000725-9685 | domestic cat | Domestic Shorthair (Cat) | Niemann-Pick disease, type C1 | NPC1 | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | D3 | NC_058379.1:g.46059888C>G | NM_001009829.2:c.2864G>C | NP_001009829.2:p.(C955S) | rs5334475149 | 2003 | 12809639 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 146 | OMIA:000725-9685 | domestic cat | Domestic Shorthair (Cat) | Niemann-Pick disease, type C1 | NPC1 | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | D3 | NC_058379.1:g.46075921T>G | NM_001009829.2:c.1322A>C | NP_001009829.2:p.(H441P) | rs5334475146 | 2017 | 28233346 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1572 | OMIA:002065-9685 | domestic cat | Japanese Domestic (Cat) Siamese (Cat) | Niemann-Pick disease, type C2 | NPC2 | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B3 | NC_058373.1:g.119395559C>T | XM_003987833.6:c.376G>A | XP_003987882.1:p.(V126M) | Changed from g.121865210G>A to NC_018728.3:g.121865210C>T [09/06/2025] c. coordinates corrected from XM_003987833.6:c.367G>A to XM_003987833.6:c.376G>A based on feedback from M.C. Temizkan [12/12/2025] |
2023 | 37458497 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 420 | OMIA:002065-9685 | domestic cat | Niemann-Pick disease, type C2 | NPC2 | substitution | splicing | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B3 | NC_058373.1:g.119403305C>T | XM_003987833.6:c.82+5G>A | XP_003987882.1:p.(G28_S29ins35) | rs5334475124 | 2014 | 25396745 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 634 | OMIA:001455-9615 | dog | Dachshund, Miniature Wire-Haired (Dog) Dachshund, Standard Wire-Haired (Dog) | Cone-rod dystrophy, Standard Wire-haired Dachshund | NPHP4 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 5 | g.59912991_59913168del | c.479_526+130del | NM_001135788.1; 178-bp deletion in exon/intron 5 of NPHP4 (nephronophthisis 4, also known as nephroretinin) | 2008 | 18687878 | |||||
| 1171 | OMIA:002254-9615 | dog | Mixed Breed (Dog) | Glucocorticoid resistance | NR3C1 | insertion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | 2 | c.2032_2033insN[69] | An insertion of "69 nucleotides between nucleotides 2032 and 2033 compared with dog wild type GR [i.e. NR3C1]. These extra 69 nucleotides matched a part of the nucleotide sequence of dog genomic DNA corresponding to intron 6 . . . . Insertion of these extra 69 nucleotides between exons 6 and 7 introduced a frameshift and a premature termination codon (TGA) 15 bp downstream of the insertion. This insertion is thus predicted to result in a truncated protein of 682 amino acids, compared to the normal (wild type) 780 amino acids" (Yamanaka et al., 2019) The cause of this splice variant could not be determined in genomic DNA. | 2019 | 31651346 | ||||||
| 1264 | OMIA:002296-9615 | dog | Yorkshire Terrier (Dog) | XY difference of sexual development, NR5A1-related | NR5A1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 9 | "a large deletion consisting of four exons of the NR5A1 gene" (Nowacka-Woszuk et al., 2020) | 2020 | 33128907 | ||||||||
| 790 | OMIA:002117-9615 | dog | Labrador Retriever (Dog) | CHILD-like syndrome | NSDHL | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | g.120749179_120763577del | c.507+220_*9662del | XM_005641965.1; deletion of 14,399bp | 2017 | 28739597 | |||||
| 1268 | OMIA:002117-9615 | dog | Chihuahua (Dog) | Verrucous epidermal keratinocytic nevi | NSDHL | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | g.120752486_120752490del | c.718_722delGAACA | p.(E240Pfs*17) | NC_006621.3: g.120,752,486_120,752,490delGAACA; XM_014111859.2:c.718_722delGAACA; XP_013967334.1:p.(Glu240Profs*17) (Christen et al., 2020) | 2020 | 33143176 | |||
| 1243 | OMIA:002117-9615 | dog | Chihuahua (Dog) | Verrucous epidermal keratinocytic nevi | NSDHL | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | NC_006621.3:g.120752468G>A | XM_014111859.2:c.700G>A | XP_013967334.1:p.(G234R) | CanFam3.1 ChrX:120,752,468G>A; XM_014111859.2:c.700G>A; XP_013967334.1: p.Gly234Arg | 2019 | 31571289 | |||
| 1055 | OMIA:002117-9685 | domestic cat | Domestic Shorthair (Cat) | Inflammatory linear verrucous epidermal nevi | NSDHL | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | X | NC_058386.1:g.124922544A>G | XM_004000985.6:c.397A>G | XP_004001034.1:p.(S133G) | 2019 | 30474267 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 1686 | OMIA:002117-9615 | dog | Appenzeller Sennenhund (Dog) | Verrucous epidermal keratinocytic nevi | NSDHL | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | X | UU_Cfam_GSD_1.0; large heterozygous deletion of at least 120 kb at ChrX:121.96-122.08 Mb; a more complex structural rearrangement is possible | 2024 | 38659285 | |||||||
| 1410 | OMIA:002509-9913 | taurine cattle | Simmental (Cattle) | Haplotype with homozygous deficiency SH9 | NUBPL | SH9 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 21 | NC_037348.1:g.42154344C>A | NM_001193042.1:c.428C>A | NP_001179971.1:p.(S143Y) | NM_001193042.1 | rs5335823597 | 2021 | 34944310 | |
| 1468 | OMIA:002556-9913 | taurine cattle | Chianina (Cattle) | Double-outlet right ventricle | NUMB | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 10 | NC_037337.1:g.84751870G>A | NM_001101951.1:c.416C>T | NP_001095421.1:p.(T139M) | NM_001101951.1; NP_001095421.1 | 2022 | 35748177 | |||
| 555 | OMIA:002035-9913 | taurine cattle | Jersey (Cattle) | Abortion (embryonic lethality), OBFC1-related | OBFC1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 26 | g.24461804_24461805del | c.379_380del | p.(K127Vfs*29) | rs455647476 | 2016 | 27646536 | 220110: Changed from g.24461803_24461804del to g.24461804_24461805del to adhere to HGVS 3'rule ENSBTAT00000019995.6:c.379_380del ENSBTAP00000019995.5:p.Lys127ValfsTer29 210909: FN changed c.379_380delAA to c.379_380del. He also added the ref sequence, based on the words in the text "Sequence reads were aligned to the bosTau6 reference genome". FN also checked the g. location against Suppl Material S2, which lists the location as 24720154. However, a search of the UMD assembly confirms that the AA del is actually as given, i.e. g.24720155_24720156del | ||
| 1242 | OMIA:001595-9940 | sheep | Merino (Sheep) | Brachygnathia, cardiomegaly and renal hypoplasia syndrome | OBSL1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 2 | NC_040253.1:g.236304072del | XM_027965226.1:c.1716del | XP_027821027.1:p.(V573Wfs*119) | XM_027965226.1:c.1716delC | 2020 | 32933480 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries. 210906 To conform with HGVS notation, FN removed the nucleotide from g.236304072delG and c.1716delC | ||
| 1793 | OMIA:001595-9823 | pig | Growth disorder | OBSL1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 15 | NC_010457.5:g.121576507_121576511del | XM_021076298.1:c.2009_2013del | XP_020931957.1:p.Y670Cfs69* | 2024 | 38198533 | |||||
| 865 | OMIA:002130-94885 | corn snake | Coat colour, oculocutaneous albinism, OCA2-related | OCA2 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | LTR retrotransposon in the 11th intron | 2015 | 26597053 | ||||||||||
| 1602 | OMIA:002130-9544 | Rhesus monkey | Coat colour, oculocutaneous albinism | OCA2 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.2363C>T | p.(S788L) | 2020 | 32259106 | ||||||||
| 846 | OMIA:002130-9615 | dog | German Spitz (Dog) | Coat colour, oculocutaneous albinism, OCA2-related | OCA2 | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 3 | NC_006585.3:g.31715704A>C | "LOC100855460 (XM_005618224.1:c.377+2T>G LT844587.1:c.-45+2T>G) . . . Comparative sequence analyses revealed that LOC100855460 actually represents the 5'-end of the canine OCA2 gene. The CanFam 3.1 reference genome assembly is incorrect and separates the first two exons from the remaining exons of the OCA2 gene. We amplified a canine OCA2 cDNA fragment by RT-PCR and determined the correct full-length mRNA sequence (LT844587.1)." | 2017 | 28973042 | |||||
| 1749 | OMIA:002130-9823 | pig | Bama Xiang Zhu, China (Pig) | Albinism, oculocutaneous, type II | OCA2 | substitution | missense | Chemical mutagenesis (ENU) | Not currently evaluated | Sscrofa11.1 | 15 | NC_010457.5:g.56825733C>T | NM_214094.2:c.2228 C>T | NP_999259.2:p.(S743L) | 2019 | 31636960 | ||||
| 1776 | OMIA:002130-8084 | green swordtail | Oculocutaneous albinism, OCA2-related | oca2 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | Xiphophorus_hellerii-4.1 | 9 | approximate 480 bp insertion in the oca2 gene which introduces a premature stop codon | 2025 | 39896652 | ||||||||
| 1715 | OMIA:002871-9544 | Rhesus monkey | Optic atrophy | OPA1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Mmul_10 | 2 | NC_041755.1:g.4364931C>A | XM_015132523.2:c.22G>T | XP_014988009.1:p.(A8S) | 2024 | 38969634 | |||||
| 288 | OMIA:000162-9913 | taurine cattle | Holstein Friesian (Cattle) Red Holstein, Switzerland (Cattle) Simmental (Cattle) Swiss Fleckvieh (Cattle) | Cardiomyopathy, dilated | OPA3 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 18 | NC_037345.1:g.53152213G>A | NM_001245934.1:c.343C>T | NP_001232863.1:p.(Q115*) | UMD3.1 position is g.53546443C>T; cDNA position based on ENSBTAT00000064088.2 | rs479222100 | 2011 | 20923700 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Additional breeds based on PMID:40312951 | |
| 1141 | OMIA:002227-9940 | sheep | Istrska pramenka (Sheep) | Otocephaly | OTX2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 7 | NC_040258.1:g.71478714G>A | XM_015097088.2:c.265C>T | XP_014952574.2:p.(R89*) | Paris et al. (2020): XM_015097088.2:c.265C > T | 2020 | 31969185 | |||
| 454 | OMIA:001564-9615 | dog | Greater Swiss Mountain Dog (Dog) | Bleeding disorder, P2RY12-related | P2RY12 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 23 | g.45909987_45909989del | c.516_518del | p.(S173del) | NM_001003365.1; NP_001003365.1; c.516_518delCTC; "a 3 base-pair deletion predicted to result in elimination of a serine from the extracellular domain was identified in the gene encoding P2RY12" | 2011 | 21554368 | |||
| 103 | OMIA:002031-9615 | dog | Lundehund (Dog) New Zealand Heading Dog (Dog) | Lundehund syndrome | P3H2 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 34 | NC_006616.3:g.22046092C>G | XM_535843.6:c.1849G>C | XP_535843.2:p.(E617Q) | XM_535843.6; XP_535843.2. Additional breeds based on PMID:40965331 | 2016 | 27485430 | |||
| 428 | OMIA:001437-9913 | taurine cattle | Brown Swiss (Cattle) | Beta-lactoglobulin, aberrant low expression | PAEP | substitution | regulatory | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 11 | g.103255964C>A | c.-215C>A | "C to A transversion at position 215 bp upstream of the translation initiation site" | rs5334475105 | 2006 | 17033029 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | ||
| 1605 | OMIA:001688-9796 | domestic horse | Purebred Spanish (Horse) | Splashed white | PAX3 | SW10 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 6 | NC_009149.3:g.11196181G>A | XM_005610643.3:c.583C>T | XP_005610700.1:p.(R195*) | XM_005610643.3; XP_005610700.1; association with increased depigmentation, published as c.927C>T | 2023 | 37406837 | ||
| 791 | OMIA:001688-9796 | domestic horse | Lipizzan horse (Horse) Noric (Horse) Quarter Horse (Horse) | Splashed white | PAX3 | SW2 | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 6 | NC_009149.3:g.11199026C>T | XM_001495160.4:c.209G>A | XP_001495210.1:p.(C70Y) | rs5334475189 | 2012 | 22511888 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 978 | OMIA:001688-9796 | domestic horse | Appaloosa (Horse) | Splashed white | PAX3 | SW4 | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 6 | NC_009149.3:g.11199140G>C | XM_001495160.4:c.95C>G | XP_001495210.1:p.(P32R) | rs5334475206 | 2013 | 23659293 | ||
| 1659 | OMIA:001688-9685 | domestic cat | Maine Coon (Cat) | Blue eye colour, dominant | PAX3 | DBE^RE | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | C1 | NC_051841.1:g.205787310G>A | XM_019838731.3:c.937C>T | XP_019694290.1:p.(Q313*) | 2024 | 38869246 | |||
| 1685 | OMIA:001688-9685 | domestic cat | Celestial (Cat) Maine Coon (Cat) Siberian (Cat) | Blue eye colour, dominant | PAX3 | DBE^CEL | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | C1 | NC_058375.1:g.205833101_205833102insN[395] | 2024 | 38644700 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||||
| 1704 | OMIA:001688-9685 | domestic cat | Altai (Cat) British Longhair (Cat) British Shorthair (Cat) Persian (Cat) Ragdoll (Cat) Sphynx (Cat) | Blue eye colour, dominant | PAX3 | DBE^ALT | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | C1 | NC_058375.1:g.205834854_205834855insN[433] | 2024 | 38997957 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||||
| 1811 | OMIA:001688-9685 | domestic cat | Maine Coon (Cat) | Blue eye colour, dominant | PAX3 | DBE^AGO | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Felis_catus 9.0 | C1 | NC_018730.3:g.207001835del | XM_011285657.3:c.160del | XP_011283959.1:p.(H54Tfs*108) | 2025 | 40459211 | |||
| 1740 | OMIA:002889-481883 | Leopard gecko | Skin colour, Mack Super Snow morph | PAX7 | mss | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | MPM_Emac_v1.0 | 17 | NC_072806.1:g.1828552_1828564del | 13-nucleotide deletion spans the last six nucleotides of exon 4 and the first seven nucleotides of intron 4 | 2024 | 38976731 | ||||||
| 583 | OMIA:001575-9615 | dog | Gordon Setter (Dog) Irish Setter (Dog) Old Danish Pointing Dog (Dog) Polish Lowland Sheepdog (Dog) Polish Tatra Sheepdog (Dog) Poodle, Miniature (Dog) Poodle, Standard (Dog) Tibetan Terrier (Dog) | Rod-cone dysplasia 4 | PCARE | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 17 | g.22907394_22907395insG | c.3149_3150insC | p.(C1051Vfs*90) | NM_001284459.1; NP_001271388.1; genomic position adjusted based on HGVS 3' rule; EVA variant with equivalent alleles: rs397510935 | rs1152388416 | 2013 | 22686255 | ||
| 1443 | OMIA:002548-9913 | taurine cattle | Holstein Friesian (Cattle) | Deficiency of haplotype HH35 | PCDH15 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 26 | NC_037353.1:g.5325675C>G | XM_059881970.1:c.2599C>G | XP_059737953.1:p.(L867V) | XM_015460562.2; XP_015316048.2 | rs469553146 | 2022 | 35361830 | ||
| 1885 | OMIA:003048-9925 | goat | Bunte Deutsche Edelziege (Goat) | Vestibular disease | PCDH15 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS1 | 26 | NC_030833.1:g.46369302G>A | XM_005698150.2:c.415C>T | XP_005698207.2:p.(R139*) | 2026 | 41907450 | ||||
| 1712 | OMIA:002868-9615 | dog | Shetland Sheepdog (Dog) | Paroxysmal exercise-induced dyskinesia | PCK2 | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 8 | NC_006590.3:g.4107413G>A | XM_537379.6:c.1658G>A | XP_537379.2:p.(R553Q) | Nessler et al. (2020) concluded "... that the PCK2:p.Arg553Gln missense variant should be considered and further evaluated as potential candidate causal variant for this phenotype." | 2020 | 32660061 | |||||
| 1515 | OMIA:002606-9615 | dog | Vizsla (Dog) | skeletal dysplasia 3 | PCYT1A | substitution | missense | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 33 | NC_049254.1:g.30067814A>G | XM_038583131.1:c.673T>C | XP_038439059.1:p.Y225H | XM_038583131.1; XP_038439059.1 | 2022 | 36553621 | |||
| 1662 | OMIA:002728-9615 | dog | Saarloos Wolfhond (Dog) | PCYT2 deficiency | PCYT2 | substitution | missense | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 9 | NC_049230.1:g.1207490A>G | XM_038546296.1:c.4A>G | XP_038402224.1:p.(I2V) | XM_038546296.1; XP_038402224.1 | 2024 | 38277988 | |||
| 475 | OMIA:001314-9615 | dog | Cardigan Welsh Corgi (Dog) Chinese Crested (Dog) Pomeranian (Dog) | Rod-cone dysplasia 3 | PDE6A | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 4 | NC_006586.3:g.59145362del | NM_001003073.1:c.1847del | NP_001003073.1:p.(N616Tfs*29) | NM_001003073.1; NP_001003073.1; published as c.1940delA (based on GenBank Z68340); variant initially identified in Cardigan Welsh Corgi and later reported in additional breeds: PMID:27525650 | 1999 | 10393029 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 582 | OMIA:001669-9615 | dog | Sloughi (Dog) | Rod-cone dysplasia 1a | PDE6B | insertion, small (<=20) | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 3 | g.91747685_91747686insACTTCAGG | c.2448_2449insTGAAGTCC | p.(K817*) | NM_001002934.2; NP_001002934.2; "an 8-bp insertion after codon 816" of the PDE6B gene | 2000 | 11124530 | |||
| 528 | OMIA:001674-9615 | dog | American Staffordshire Terrier (Dog) | Cone-rod dystrophy 1 | PDE6B | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 3 | g.91747728_91747730del | c.2404_2406del | p.(802del) | NM_001002934.1; NP_001002934.1 | 2013 | 24045995 | |||
| 1230 | OMIA:002282-9615 | dog | Spanish Water Dog (Dog) | PRA, PDE6B-related | PDE6B | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 3 | g.91749865_91749870del | c.2218-2223del | p.(F740_F741del) | NM_001002934.1; NP_001002934.1 | 2020 | 32639685 | |||
| 282 | OMIA:000882-9615 | dog | Irish Setter (Dog) | Rod-cone dysplasia 1 | PDE6B | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 3 | NC_006585.3:g.91747713C>T | NM_001002934.1:c.2421G>A | NP_001002934.1:p.(W807*) | NM_001002934.1; NP_001002934.1 | 1993 | 8387203 | |||
| 1022 | OMIA:002163-9544 | Rhesus monkey | Cone dystrophy 4, PDE6C-related | PDE6C | substitution | missense | Naturally occurring variant | Not currently evaluated | Mmul_8.0.1 | 9 | p.(R565Q) | 2019 | 30667376 | |||||||
| 1841 | OMIA:003012-9913 | taurine cattle | Holstein Friesian (Cattle) | Dwarfism, primordial disproportionate and craniofacial dysmorphism | PDGFRA | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 6 | NC_037333.1:g.69749162T>C | NM_001192345.2:c.1685T>C | NP_001179274.1:p.(I562T) | 2025 | 40999323 | ||||
| 1820 | OMIA:002972-9615 | dog | Bifid nose | PDGFRA | substitution | splicing | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 13 | NC_049234.1:g.47440160A>C | XM_038556087.1:c.1122-2A>C | 2025 | 40127928 | ||||||
| 281 | OMIA:001406-9615 | dog | Clumber Spaniel (Dog) Sussex Spaniel (Dog) | Pyruvate dehydrogenase deficiency | PDP1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 29 | NC_006611.3:g.38788845C>T | XM_005638127.1:c.829C>T | XP_005638184.1:p.(Q277*) | XM_005638127.1; XP_005638184.1; published as c.754C>T, p.(Q252*); coordinates in the table have been updated to a recent reference genome and / or transcript | 2007 | 17095275 | |||
| 966 | OMIA:000913-9031 | chicken | Silkie (Chicken) | Silky/Silkie feathering | PDSS2 | PDSS2(-103C-G) | substitution | regulatory | Naturally occurring variant | Not currently evaluated | GRCg6a | 3 | g.67850419C>G | c.-103C>G | Feng et al. (2014): "a C to G transversion at 70,486,623 bp (ss666793747)" "The ss666793747 mutation is 103 bp upstream of the initiator codon ATG of PDSS2". The reported location was with respect to the galGal2 assembly. In the intervening years, ss666793747 has become rs316090093, from which the present location is taken. | rs316090093 | 2014 | 25166907 | ||
| 1461 | OMIA:002552-9940 | sheep | Pancreatic agenesis | PDX1 | deletion, gross (>20) | Genome-editing (CRISPR-Cas9) | Not currently evaluated | Oar_rambouillet_v1.0 | 10 | NC_040261.1:g.33940517_33940724del | XM_027973895.1:c.195_403del | XM_027973895.1; 208bp deletion | 2017 | 29234093 | ||||||
| 1278 | OMIA:002303-9685 | domestic cat | Cerebral dysgenesis | PEA15 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | F1 | NC_058384.1:64395109del | XM_045049170.1:c.176del | XP_044905105.1:p.(N59Tfs*29) | published as felCat9 chrF1:66768323 GT -> G; c.176delA by Graff et al. (2020) | rs5334475160 | 2020 | 33290415 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1821 | OMIA:002973-9913 | taurine cattle | Bazadais (Cattle) | Chondrodysplasia | PEX7 | Naturally occurring variant | Not currently evaluated | detailed information will be provided after publication is published | 2025 | Reference not in PubMed; see OMIA 002973-9913 for reference details | ||||||||||
| 820 | OMIA:001827-9913 | taurine cattle | Montbéliarde (Cattle) Vorderwälder, Germany (Cattle) | Abortion due to haplotype MH1 | PFAS | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.27895397C>T | NM_001256564.1:c.3613C>T | NP_001243493.1:p.(R1205C) | rs455876205 | 2017 | 28803020 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 271 | OMIA:000421-9615 | dog | American Cocker Spaniel (Dog) English Springer Spaniel (Dog) Whippet (Dog) | Glycogen storage disease VII | PFKM | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 27 | NC_006609.3:g.6620819C>T | NM_001003199.1:c.2228G>A | NP_001003199.1:p.(W473*) | NM_001003199.1; NP_001003199.1 | 1996 | 8702726 | Genomic and protein coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 45 | OMIA:000421-9615 | dog | Deutscher Wachtelhund (Dog) | Glycogen storage disease VII | PFKM | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 27 | NC_006609.3:g.6631627G>A | NM_001003199.1:c.550C>T | NP_001003199.1:p.(R184W) | NM_001003199.1; NP_001003199.1 | 2012 | 22446493 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn and Zoe Shmidt. | ||
| 1288 | OMIA:001128-9823 | pig | Duroc (Pig) | Pale soft exudative meat | PHKG1 | substitution | splicing | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 3 | NC_010445.4:g.16830320C>A | NM_001293144.1:c.919-5C>A | ENSSSCT00000008491.4:c.919-5C>A Ma et al. 2014: "a point mutation (C>A) in a splice acceptor site of intron 9, resulting in a 32-bp deletion in the open reading frame and generating a premature stop codon" | rs330928088 | 2014 | 25340394 | |||
| 406 | OMIA:001953-9913 | taurine cattle | Belgian Blue (Cattle) | Arthrogryposis, lethal syndrome | PIGH | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 10 | NC_037337.1:g.79469727G>C | NM_001038116.2:c.211-10C>G | rs451004237 | 2015 | 25895751 | Variant information gleaned from or confirmed by Table 1 of  Sharma et al. (2017) Animal Genetics 48(3):369-370 | |||
| 109 | OMIA:002084-9615 | dog | Soft Coated Wheaten Terrier (Dog) | Dyskinesia, paroxysmal, PIGN | PIGN | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 1 | NC_006583.3:g.14705240C>T | XM_022415750.1:c.398C>T | XP_022271458.1:p.(T133I) | XM_022415750.1; XP_022271458.1 | 2016 | 27891564 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1305 | OMIA:002324-9615 | dog | Parson Russell Terrier (Dog) | Epilepsy, mitochondrial dysfunction and neurodegeneration | PITRM1 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 2 | NC_006584.3:g.32188565_32188570del | XM_535200.6:c.172_177del | XP_535200.2:p.(L58_S59del) | Previously listed as ENSCAFT00000008673: c.175_180del; ENSCAFT00000008673.4:p.(L59_S60del) - updated to NCBI transcript [23_02_2026] | 2021 | 33835239 | |||
| 1212 | OMIA:002270-8932 | rock pigeon | Feathered shank | PITX1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | "a 44-kb deletion (from 6.719–6.763 Mb)" (Domyan et al., 2016) | 2016 | 26977633 | ||||||||||
| 1211 | OMIA:002270-9031 | chicken | Feathered shanks | PITX1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | GRCg6a | 13 | g.16089993_16107660del | a 17.7kb deletion upstream of PITX1. | 2020 | 32344431 32344429 | |||||||
| 232 | OMIA:000649-9940 | sheep | Texel (Sheep) | Microphthalmia | PITX3 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 22 | NC_040273.1:g.25497953C>G | NM_001178053.1:c.338G>C | NP_001171524.1:p.(R113P) | Oar_v3.1 position is g.22045744C>G | 2010 | 20084168 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1404 | OMIA:000807-9823 | pig | Polycystic kidney disease | PKD1 | PKD1^insG/+ | insertion, small (<=20) | Genome-editing (CRISPR-Cas9) | Not currently evaluated | 3 | c.152_153insG | 2022 | 34980882 | ||||||||
| 1406 | OMIA:000807-9823 | pig | Polycystic kidney disease | PKD1 | PKD1^Tins/+ | insertion, small (<=20) | Genome-editing (ZFN) | Not currently evaluated | 3 | c.642_643insT | 2015 | 25798056 | ||||||||
| 1405 | OMIA:000807-9823 | pig | Polycystic kidney disease | PKD1 | PKD1^TGCTins/+ | insertion, small (<=20) | Genome-editing (ZFN) | Not currently evaluated | 3 | c.642_643insTGCT | 2015 | 25798056 | ||||||||
| 1883 | OMIA:000807-9541 | crab-eating macaque | Polycystic kidney disease | PKD1 | substitution | missense | Naturally occurring variant | Not currently evaluated | XM_015442355.1:c.1144G>C | p.(E382Q) | 2023 | 36876010 | ||||||||
| 72 | OMIA:000807-9615 | dog | Bull Terrier (Dog) | Polycystic kidney disease | PKD1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 6 | g.38856816G>A | c.9559G>A | p.(E3187K) | rs397509460 | 2011 | 21818326 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1610 | OMIA:000807-9685 | domestic cat | Scottish Fold (Cat) | Polycystic kidney disease | PKD1 | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | E3 | NC_058383.1:g.39421688del | XM_023247051.2 c.4923del | XP_023102819.2 p.(G1641fs) | variant reported in a single cat, published as c.5250delC/p.(G1641fs) - updated to recent transcript information [11/07/2025] | 2023 | 37489504 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1611 | OMIA:000807-9685 | domestic cat | American Shorthair (Cat) | Polycystic kidney disease | PKD1 | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | E3 | NC_058383.1:g.39423246C>T | XM_023247051.2:c.6481C>T | XP_023102819.2:p.(R2161W) | variant reported in a single cat, published as c.6808C>T, p.(R2162W) - updated to recent transcript information [11/07/2025] | 2023 | 37489504 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 314 | OMIA:000807-9685 | domestic cat | American Shorthair (Cat) Exotic Shorthair (Cat) Himalayan (Cat) Maine Coon (Cat) Munchkin (Cat) Persian (Cat) Ragdoll (Cat) Scottish Fold (Cat) Scottish Straight (Cat) Siberian (Cat) Sphynx (Cat) | Polycystic kidney disease | PKD1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | E3 | NC_058383.1:g.39431089C>A | XM_023247051.2:c.9864C>A | XP_023102819.2:p.(C3288*) | This variant was published as c.10063C>A, p.(C3284*) and was previously listed here as c.9882C>A/p.(C3294*) - updated to recent transcript information [11/07/2025] | rs5334475162 | 2004 | 15466259 | The varaint has been initially identified in Persian cats but has since been reported in other breeds, e.g. PMID:31155548; PMID:37489504; PMID:35709088; PMID:39486512. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 1585 | OMIA:000807-9615 | dog | Lagotto Romagnolo (Dog) | Polycystic kidney disease | PKD1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 6 | NC_049227.1:g.39295382G>T | NM_001006650.1:c.7195G>T | NP_001006651.1:p.(E2399*) | NM_001006650.1; NP_001006651.1 | 2023 | 37372390 | |||
| 1523 | OMIA:002525-9823 | pig | PKD2 overexpression | PKD2 | insertion, gross (>20) | Genome-editing (CRISPR-Cas9) | Not currently evaluated | insertion of transgene vector pCAG-muhPKD2 (c.1532A > T/p.511D > V)-3 × FLAG-floxP-neo-pH11 into the pH11 safe harbor site | 2022 | 36452154 | ||||||||||
| 1424 | OMIA:002525-9685 | domestic cat | Siberian (Cat) | Polycystic kidney disease 2 | PKD2 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.132521077del | XM_011281830.4:c.2211del | XP_011280132.2:(p.K737Nfs*2) | published as c.2211delG | 2021 | 33785770 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 898 | OMIA:000844-9615 | dog | West Highland White Terrier (Dog) | Pyruvate kinase deficiency of erythrocyte | PKLR | duplication | duplication (in-frame) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 7 | g.42269752_42269757dup | c.1333_1338dup | p.(K445_T446dup) | NM_001256018.1; NP_001242947.1; the original publication described "a 6 base pair insertion in exon 10". In accordance with HGVS recommendations, the variant is annotated in this table as a 6 bp duplication and updated a recent reference sequences. This shifts the position of the predicted amino acid change by about 21 amino acids. | 1999 | 10490091 | |||
| 897 | OMIA:000844-9615 | dog | Basenji (Dog) | Pyruvate kinase deficiency of erythrocyte | PKLR | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 7 | NC_006589.3:g.42267825del | NM_001256262.1:c.433del | NP_001243191.1:p.(P145Rfs*23) | 1994 | 7520391 | ||||
| 896 | OMIA:000844-9615 | dog | Labrador Retriever (Dog) | Pyruvate kinase deficiency of erythrocyte | PKLR | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 7 | NC_006589.3:g.42268632C>T | NM_001256262.1:c.799C>T | NP_001243191.1:p.(Q267*) | 2012 | 22805166 | 20181218 Thanks to Maarten de Groot for advising FN of the genomic location | |||
| 894 | OMIA:000844-9615 | dog | Pug (Dog) | Pyruvate kinase deficiency of erythrocyte | PKLR | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 7 | NC_006589.3:g.42268681T>C | NM_001256262.1:c.848T>C | NP_001243191.1:p.(V283A) | 2012 | 22805166 | ||||
| 1860 | OMIA:000844-9615 | dog | Miniature Schnauzer (Dog) | Pyruvate kinase deficiency of erythrocyte | PKLR | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 7 | NC_006589.3:g.42268906G>T | NM_001256262.1:c.975G>T | NP_001243191.1:p.(F323Cfs*4) | The premature stop codon is predicted to alter pre-mRNA splicing through a mechanism known as nonsense-associated altered splicing resulting in skipping of exon 8 and a frameshift. | 2025 | 41463922 | |||
| 895 | OMIA:000844-9615 | dog | Beagle (Dog) | Pyruvate kinase deficiency of erythrocyte | PKLR | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 7 | NC_006589.3:g.42268927G>A | NM_001256262.1:c.994G>A | NP_001243191.1:p.(G332S) | 2012 | 22805166 | ||||
| 899 | OMIA:000844-9685 | domestic cat | Abyssinian (Cat) Bengal (Cat) Caracal (Cat) Chausie (Cat) Egyptian Mau (Cat) European Shorthair (Cat) Highlander (Cat) Highlander Shorthair (Cat) LaPerm (Cat) Lykoi (Cat) Maine Coon (Cat) Maine Coon Polydactyl (Cat) Minuet Longhair (Cat) Munchkin (Cat) Neva Masquerade (Cat) Norwegian Forest Cat (Cat) Pixiebob Longhair (Cat) Savannah (Cat) Siberian (Cat) Singapura (Cat) Toyger (Cat) | Pyruvate kinase deficiency of erythrocyte | PKLR | substitution | splicing | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | F1 | NC_058384.1:g.67876039G>A | XM_023247386.2:c.707-53G>A | XM_023247386.1:c.707-53G>A; published as c.693+304G>A | rs5334475134 | 2012 | 23110753 | The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770); Grahn et al. (2012) reported that the variant is present in many breeds and suggested genotyping in Bengals, Egyptian Maus, La Perms, Maine Coon cats, Norwegian Forest cats, Savannahs, Siberians, and Singapuras. Additional breeds reported based on PMID:35709088. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 417 | OMIA:001864-9615 | dog | Chesapeake Bay Retriever (Dog) Golden Retriever (Dog) | Ectodermal dysplasia/skin fragility syndrome | PKP1 | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 7 | NC_006589.3:g.1966531C>G | NM_001287161.1:c.202+1G>C | 2012 | 22384142 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||||
| 1670 | OMIA:001701-60463 | Fischer's lovebird | Feather colour, blue | PKS | substitution | missense | Naturally occurring variant | Not currently evaluated | c.1930C>T | p.(R644W) | 2024 | 38528953 | ||||||||
| 1671 | OMIA:001701-60466 | yellow-collared lovebird | Feather colour, blue | PKS | substitution | missense | Naturally occurring variant | Not currently evaluated | c.1930C>T | p.(R644W) | 2024 | 38528953 | ||||||||
| 1863 | OMIA:001701-9228 | Rose-ringed parakeet | Feather colour, blue | PKS | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.2005G>T | p.(E668*) | 2025 | 39820005 | ||||||||
| 1865 | OMIA:001701-232655 | Alexandrine parakeet | Feather colour, blue | PKS | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.2647A>T | p.(K883*) | 2025 | 39820005 | ||||||||
| 1864 | OMIA:001701-9228 | Rose-ringed parakeet | Feather colour, blue | PKS | substitution | missense | Naturally occurring variant | Not currently evaluated | c.334G>A | p.(G112R) | 2025 | 39820005 | ||||||||
| 1867 | OMIA:001701-176024 | Eclectus parrot | Feather colour, blue | PKS | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.5869C>T | p.(H1957*) | 2025 | 39820005 | ||||||||
| 1866 | OMIA:001701-232655 | Alexandrine parakeet | Feather colour, blue | PKS | substitution | missense | Naturally occurring variant | Not currently evaluated | c.727G>A | p.(R243K) | 2025 | 39820005 | ||||||||
| 1868 | OMIA:001701-176039 | galah | Feather colour, blue | PKS | haplotype | missense | Naturally occurring variant | Not currently evaluated | c.[1284T>C;2374A.G] | p.[(N428K;T792A)] | 2025 | 39820005 | ||||||||
| 113 | OMIA:002105-9615 | dog | Papillon (Dog) | Neuroaxonal dystrophy, PLA2G6-related | PLA2G6 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 10 | NC_006592.3:g.26544820G>A | XM_005625890.3:c.1579G>A | XP_005625947.1:p.(T527A) | 2017 | 28107443 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1267 | OMIA:002105-9940 | sheep | Swaledale, United Kingdom of Great Britain and Northern Ireland (Sheep) | Neuroaxonal dystrophy, PLA2G6-related | PLA2G6 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 3 | NC_040254.1:g.230750869G>A | XM_027968104.1:c.1186C>T | XP_027823905.1:p.(Q396*) | Oar_rambouillet_v1.0: g.230750869G>A; XM_027968104.1 [shorter transcript] and XM_012175630.3 [longer transcript]: c.1186C>T; XP_027823905.1: p.Gln396* in the shorter transcript; XP_012031020.2: p.Leu396Phe in the longer transcript (Letko et al., 2020). Only the former variant peptide is tabulated here. | 2021 | 33159255 | |||
| 1266 | OMIA:002105-9940 | sheep | Swaledale, United Kingdom of Great Britain and Northern Ireland (Sheep) | Neuroaxonal dystrophy, PLA2G6-related | PLA2G6 | substitution | splicing | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 3 | NC_040254.1:g.230766713T>C | XM_004006987.4:c.336-2A>G | XP_012031020.2:p.(L71Wfs*3) | 2021 | 33159255 | ||||
| 339 | OMIA:001935-9913 | taurine cattle | Simmental (Cattle) | Zinc deficiency-like syndrome | PLD4 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 21 | g.69352995G>A | c.702G>A | p.(W234*) | UMD3.1 position is g.71001232G>A | rs378824791 | 2014 | 25052073 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; rsID gleaned from or confirmed by Table 1 of  Sharma et al. (2017) Animal Genetics 48(3):369-370. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 351 | OMIA:002080-9615 | dog | Eurasier (Dog) | Epidermolysis bullosa, simplex, PLEC | PLEC | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 13 | NC_006595.3:g.37461941C>T | XM_539204.6:c.3947G>A | XP_539204.2:p.(W1316*) | CanFam3 chr13: g.37461941G>A; XM_539204.6:c.3947G>A; XP_539204.2:p.Trp1316Stop: | 2016 | 27878870 | Updated variant coordinates kindly provided by Tosso Leeb on 8 May 2020 | ||
| 412 | OMIA:002020-9615 | dog | Scottish Terrier (Dog) | Ligneous membranitis | PLG | substitution | splicing | Naturally occurring variant | Not currently evaluated | 1 | c.1256+2T>A | possibly NM_001286960.1 c.1262+2T>A; CanFam3.1 g.49514382A>T | 2015 | 26360520 | ||||||
| 1338 | OMIA:002020-9615 | dog | Maltese (Dog) | Ligneous membranitis | PLG | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 1 | g.49534880_49540865del | c.-5645_49+292del | XM_005615560.1; a deletion of 5986 bp involving exon 1 and the flanking region | 2021 | 34370320 | |||||
| 1078 | OMIA:002195-9615 | dog | Welsh Springer Spaniel (Dog) | Cardiomyopathy, dilated, PLN-related | PLN | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 1 | NC_006583.3:g.58588129G>A | NM_001003332.1:c.26G>A | NP_001003332.1:p.(R9H) | Changed from g.58588129C>T to g.58588129G>A [09/06/2025] | 2019 | 30794913 | c. coordinate kindly provided by Tosso Leeb | ||
| 165 | OMIA:001982-9796 | domestic horse | Thoroughbred (Horse) Warmblood (Horse) | Fragile Foal Syndrome | PLOD1 | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 2 | NC_009145.3:g.39927817C>T | XM_001491331.6:c.2032G>A | XP_001491381.1:p.(G678R) | rs1136065234 | 2015 | 25637337 | rsID and Variant coordinates obtained from Zhang et al. (2020): "g.39927817C>T (rs1136065234; NC_009145.3, Equ-Cab3.0)" c. and p. coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 248 | OMIA:000770-9986 | rabbit | Chinchilla (Rabbit) | Tremor, X-linked | PLP1 | pt | substitution | missense | Naturally occurring variant | Not currently evaluated | X | T>A | 1994 | 7525875 | ||||||
| 82 | OMIA:000770-9615 | dog | Springer Spaniel (Dog) | Tremor, X-linked | PLP1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | X | NC_006621.3:g.77200833A>C | NM_001013334.2:c.110A>C | NP_001013856.1:p.(H37P) | 1990 | 1723945 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1879 | OMIA:000770-9615 | dog | English Cocker Spaniel (Dog) | Tremor, X-linked | PLP1 | substitution | missense | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | X | NC_049260.1:g.77750774T>A | NM_001013834.2:c.92T>A | NP_001013856.1:p.(L31Q) | 2026 | 41701830 | ||||
| 1493 | OMIA:002578-9913 | taurine cattle | Holstein (black and white) (Cattle) | Mast cell tumour, congenital | PLP2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | X | NC_037357.1:g.87216480C>T | NM_203363.1:c.50C>T | NP_976239.1:p.(T17I) | NM_203363.1; XP_005642144.1 | 2022 | 36139188 | |||
| 1103 | OMIA:000211-9615 | dog | No Merle pattern - solid coat | PMEL | Mc | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 10 | Mc (208-230bp); phenotype = No Merle pattern – solid coat; = "cryptic" of Murphy et al. (2018) | 2018 | 30235206 | ||||||||
| 1104 | OMIA:000211-9615 | dog | No Merle pattern - solid coat | PMEL | Mc+ | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 10 | Mc+ (231-245bp); phenotype = No Merle pattern – solid coat; = "cryptic" of Murphy et al. (2018) | 2018 | 30235206 | ||||||||
| 1105 | OMIA:000211-9615 | dog | No Merle pattern - diluted - brownish hue | PMEL | Ma | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 10 | Ma (247-254bp); phenotype = No Merle pattern – diluted–brownish hue; = "cryptic" of Murphy et al. (2018) | 2018 | 30235206 | ||||||||
| 1106 | OMIA:000211-9615 | dog | Muted, undefined, diluted - brownish hue | PMEL | Ma+ | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 10 | Ma+ (255-264bp); phenotype = Muted, undefined, diluted–brownish hue = "dilute" of Murphy et al. (2018) | 2018 | 30235206 | ||||||||
| 1107 | OMIA:000211-9615 | dog | Minimal Merle, areas deleted to white, tweed | PMEL | Mh | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 10 | Mh (269-277bp); phenotype = Minimal Merle, areas deleted to white, tweed = "harlequin" of Murphy et al. (2018) | 2018 | 30235206 | ||||||||
| 697 | OMIA:000211-9615 | dog | Classic Merle | PMEL | M | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 10 | "an insertion of a tRNA-derived SINE . . . . The insertion occurs at the boundary of intron 10 and exon 11 and is flanked by a 15-bp target site duplication . . . . The SINE insertion is in reverse orientation, with the 5' end closer to exon 11." Allele M (265-269bp); phenotype = Classic Merle = "standard" of Murphy et al. (2018) | 2006 | 16407134 | ||||||||
| 540 | OMIA:001545-30521 | domestic yak | Coat colour, dilution | PMEL | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | c.50_52del | p.(L18del) | 2014 | 24989079 | ||||||||
| 1071 | OMIA:002191-93934 | Japanese quail | Yellowish plumage | PMEL | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | g.811370G>A | p.(W149*) | Ishishita et al. (2018): g.811370G>A (NC_029544.1); Trp149* | 2018 | 30425278 | |||||||
| 1166 | OMIA:001544-9913 | taurine cattle | Rat-tail syndrome | PMEL | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 5 | g.57345302_57345304del | c.50_52del | p.(L19del) | rs385468954 | 2016 | 27037038 | ||||
| 484 | OMIA:001545-9913 | taurine cattle | Charolais (Cattle) Galloway (Cattle) Hereford (Cattle) Highland (Cattle) Japanese Brown, Japan (Cattle) Simmental (Cattle) | Coat colour, dilution | PMEL | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | g.57345303_57345305del | NM_001080215.2:c.53_55del | NP_001073684.2:p.(L19del) | Published as 'three-base (CTT) deletion at nucleotide 54 in exon 1 of the PMel17 gene'; previously listed in OMIA as ARS-UCD1.2:g.57345302_57345304del, c.50_52del, p.(L19del) based on the inforamtion provided by "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170); updated to reflect HGVS recommendation (3'-rule) on [03/09/2024] | rs385468954 | 2008 | 18408794 | ||
| 774 | OMIA:001545-9913 | taurine cattle | Charolais (Cattle) | Coat colour, dilution | PMEL | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.57345315G>A | NM_001080215.2:c.64G>A | NP_001073684.2:p.(G22R) | rs718553050 | 2007 | 17705851 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 903 | OMIA:001438-9796 OMIA:000733-9796 | domestic horse | American Miniature Horse (Horse) Ardennes (Horse) Comtois (Horse) Icelandic Horse (Horse) Missouri Fox Trotter, Germany (Horse) Morgan (Horse) Rocky Mountain, United States of America (Bighorn sheep) Shetland Pony (Horse) | Coat colour, silver AND Multiple congenital ocular anomalies | PMEL | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 6 | NC_009149.3:g.74569773G>A | NM_001163889.1:c.1849C>T | NP_001157361.1:p.(R617C) | NM_001163889.1; NP_001157361.1; previously listed in OMIA as g.73665304 and published a C (wild type) to T (Silver) transition, p.Arg618Cys, as well as p.(R625C); coordinates in this table have been updated to a recent reference genome and / or transcript | rs3448111155 | 2006 | 17029645 | The genomic position in EquCab3.0 was provided by Mary Katherine Easterwood, working under the guidance of Professor Ernie Bailey in April 2022. Breed information updated based on PMID: 38600096 | |
| 600 | OMIA:000373-9031 | chicken | White Leghorn (Chicken) | Feather colour, dominant white | PMEL | I | insertion, small (<=20) | insertion (in-frame) | Naturally occurring variant | Not currently evaluated | GRCg6a | 33 | g.7095476_7095477insCTGGGCACC | c.2021_2022insCTGGGCACC | p.(L674_L675insWAP) | ENSGALT00000077972.2; ENSGALP00000051268.2; published as a 9-bp (3aa) insertion (WAP) in exon 10; AY636127 | 2004 | 15579702 | ||
| 601 | OMIA:000373-9031 | chicken | Feather colour, Dun | PMEL | D | delins, small (<=20) | delins (in-frame) | Naturally occurring variant | Not currently evaluated | GRCg6a | 33 | g.7095492_7095507delinsC | c.2037_2052delinsC | p.(L680_A684del) | ENSGALT00000077972.2; ENSGALP00000051268.2; published as "a deletion of five amino acids [LGTAA] in the transmembrane region"; AY636129 | 2004 | 15579702 | |||
| 602 | OMIA:000373-9031 | chicken | White Leghorn (Chicken) | Feather colour, Smoky | PMEL | S | haplotype | Naturally occurring variant | Not currently evaluated | GRCg6a | 33 | g.[7093782_7093793del;7095476_7095477insCTGGGCACC] | c.[839_850del;2021_2022insCTGGGCACC] | p.[(P280_T283del;L674_L675insWAP)] | ENSGALT00000077972.2; ENSGALP00000051268.2; published as a 9-bp insertion in exon 10 shared with Dominant white and a deletion of 12 nucleotides in exon 6, eliminating four amino acids (PTVT); AY636128 | 2004 | 15579702 | |||
| 1736 | OMIA:002884-94885 | corn snake | Skin colour, Terrazzo | PMEL | tz | haplotype | splicing | Naturally occurring variant | Not currently evaluated | UNIGE_PanGut_3.0 | NW_023010713:g.[13272041A>T;13272043G>C] | XM_034412587.1:c.[1594C>G;1594+2T>A] | "a multi-nucleotide polymorphism, from ACG to TCC (Super-scaffold 85; position 13,272,041) falls at the end of exon 8 (one nucleotide – A to T) and on the donor site of intron 8 of the Premelanosome Protein (PMEL) gene (two nucleotides – CG to CC)" | 2024 | 39227572 | |||||
| 1054 | OMIA:002183-9823 | pig | Landrace (Pig) | Embryonic lethality | PNKP | substitution | missense | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 6 | NC_010448.4:g.54880241T>C | XM_005664749.3:c.287A>G | XP_005664806.3:p.(Q96R) | Derks et al. (2019): "deleterious missense mutation in the PNKP gene (6:g.54880241G>T), predicted to be strongly deleterious by SIFT (0.02) and PROVEAN (-2.9). The missense mutation causes a glutamine to arginine amino acid substitution (ENSSSCP00000003467:p.Gln96Arg)" | rs5334475176 | 2019 | 30875370 | ||
| 616 | OMIA:001588-9615 | dog | Golden Retriever (Dog) | Ichthyosis, PNPLA1-related | PNPLA1 | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 12 | g.5417388_5417390delinsTACTACTA | c.1445_1447delinsTACTACTA | p.(N482Ifs*11) | NM_001290109.2; NP_001277038.2 | 2012 | 22246504 | |||
| 1775 | OMIA:001588-9615 | dog | Labrador Retriever (Dog) | Ichthyosis, PNPLA1-related | PNPLA1 | duplication | frameshift | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 12 | NC_049233.1:g.5596853_5602951dup | NM_001290109.2:c.1361_1671dup | NP_001277038.2:p.(E558Lfs*17) | 2025 | 40150930 | ||||
| 765 | OMIA:000827-9913 | taurine cattle | Brown Swiss (Cattle) Carora, Venezuela (Bolivarian Republic of) (Cattle) | Progressive degenerative myeloencephalopathy (Weaver syndrome) | PNPLA8 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 4 | NC_037331.1:g.49600585C>T | XM_005205444.4:c.1703G>A | XP_005205501.2:p.(S568N) | rs800397662 | 2016 | 26992691 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1470 | OMIA:000827-9615 | dog | Australian Shepherd (Dog) | hereditary ataxia | PNPLA8 | duplication | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 18 | g.12143242_12143243dup | c.1169_1170dup | p.(H391Ffs*4) | XM_005630935.2; XP_005630992.1 | 2022 | 35864734 | |||
| 845 | OMIA:000483-30521 | domestic yak | Polled, Mongolian allele | POLLED | P[sub]M or P[sub]219ID | complex rearrangement | Naturally occurring variant | Not currently evaluated | "a complex 219-bp duplication-insertion (P219ID) beginning at 1,976,128 bp and a 7-bp deletion and 6-bp insertion (P1ID) located 621 bp upstream of this position . . . . This rearrangement results in duplication of an 11-bp motif (5'-AAAGAAGCAAA-3') that is entirely conserved among Bovidae . . . and that is also duplicated in the 80-kb duplication responsible for Friesian polledness" | 2017 | 28135247 | |||||||||
| 1070 | OMIA:000483-9913 | taurine cattle | Nelore (Cattle) | Polled, Guarani | POLLED | P[sub]G | duplication | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 1 | g.2614828_2724315dup | "a novel duplication variant" in the region BTA1:1,893,790–2,004,553 (Utsunomiya et al., (2019) | 2019 | 30644114 | Randhawa et al. (2019): ARS-UCD1.2 g.2614828_2724315dup | ||||
| 867 | OMIA:000483-9913 | taurine cattle | Holstein (black and white) (Cattle) | Polled, Friesian | POLLED | P[sub]F OR P(sub)80kbID | duplication | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 1 | g.2629113_2709240dup | 2013 | 23717440 | In relation to assembly UMD v3.1.1, Utsunomiya et al. (2019) described this variant as "a duplication of CHR1:1,909,352–1,989,480". Randhawa et al. (2019): ARS-UCD1.2 g.2629113_2709240dup | |||||
| 866 | OMIA:000483-9913 | taurine cattle | Brahman (Cattle) | Polled, Celtic | POLLED | P[sub]C OR P[sub]202ID | complex rearrangement | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 1 | g.[2429327_2429336del;2429109_2429320dupins] | UMD3.1: g.1706051_1706060 delins170583 | 2012 | 22737241 | Coordinates in OMIA were previously shown based on Randhawa et al. (2019) as ARS-UCD1.2 g.[22429326_2429335del;2429109_2429320dupins]. After review of the original publication the coordinates have been corrected in OMIA to g.[2429327_2429336del;2429109_2429320dupins] [18/9/2022] | ||||
| 844 | OMIA:000483-9913 | taurine cattle | Kazakh (Cattle) | Polled, Mongolian | POLLED | P[sub]M OR P[sub]219ID | complex rearrangement | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 1 | g.[2695261_2695267delinsTCTGAA;2695889_2696047dupins] | "a complex 219-bp duplication-insertion (P219ID) beginning at 1,976,128 bp and a 7-bp deletion and 6-bp insertion (P1ID) located 621 bp upstream of this position . . . . This rearrangement results in duplication of an 11-bp motif (5'-AAAGAAGCAAA-3') that is entirely conserved among Bovidae . . . and that is also duplicated in the 80-kb duplication responsible for Friesian polledness" In relation to assembly UMD v3.1.1, Utsunomiya et al. (2019) described this variant as "a complex duplication starting at CHR1:1,976,128". | 2017 | 28135247 | Randhawa et al. (2019): ARS-UCD1.2 g.[2695261_2695267delinsTCTGAA;2695889_2696047dupins] | ||||
| 1052 | OMIA:002181-9823 | pig | Landrace (Pig) | Embryonic lethality | POLR1B | substitution | splicing | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 3 | NC_010445.4:g.43952776T>G | Derks et al. (2019): "Skipping of exon 14 introduces a glutamic acid and a premature stop codon in the second codon of the terminal exon, lacking the final 370 amino acids located in the conserved subunit 2, hybrid-binding domain (binding to the DNA strand)" | rs5334475168 | 2019 | 30875370 | ||||
| 809 | OMIA:001258-9615 | dog | Flat-Coated Retriever (Dog) Labrador Retriever (Dog) | Obesity | POMC | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 17 | g.19431807_19431821del | c.561_575del | p.(E188fs) | XM_844370.3; variant is associated with body weight | 2016 | 27157046 | ||||
| 1291 | OMIA:002315-9615 | dog | Karelian Bear Dog (Dog) | Pituitary dwarfism | POU1F1 | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 31 | NC_006613.3:g.784534C>A | NM_001006949.1:c.605-3C>A | Kyöstilä et al. (2021) "the NNSPLICE 0.9 splice prediction tool (Reese et al. 1997) predicted this variant to weaken the splice acceptor of POU1F1 intron 4 from a score of 0.97 to 0.67." | 2021 | 33550451 | ||||
| 173 | OMIA:001579-9823 | pig | Taihu - Erhualian, China (Pig) | Large floppy ears | PPARD | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 7 | NC_010449.5:g.31281804G>A | NM_214152.2:c.95G>A | NP_999317.2:p.(G32E) | rs80909573 | 2011 | 21573137 | The genomic location on Sscrofa11.1 was determined and the effect was confirmed with Ensembl VEP in the following transcripts: XM_005665910.3, XM_013977808.2 by Stephanie Shields (27/05/2020) | ||||
| 157 | OMIA:000327-9796 | domestic horse | Quarter Horse (Horse) | Ehlers-Danlos syndrome | PPIB | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 1 | NC_009144.3:g.129307092G>A | NM_001099761.1:c.115G>A | NP_001093231.1:p.(G39R) | rs396329681 | 2007 | 17498917 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 588 | OMIA:000161-9913 | taurine cattle | Polled Hereford (Cattle) | Cardiomyopathy and woolly haircoat syndrome | PPP1R13L | duplication | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 18 | g.53013747_53013753dup | c.956-962dupACAGGCG | p.(G335Efs*36) | 2009 | 19016676 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | |||
| 1068 | OMIA:001311-9615 | dog | Miniature Schnauzer (Dog) | Photoreceptor dysplasia | PPT1 | PPT1^dci | complex rearrangement | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 15 | g.2874661_2875048con2877563_2877607inv | 2019 | 30541930 | ||||||
| 579 | OMIA:001504-9615 | dog | Dachshund (Dog) | Neuronal ceroid lipofuscinosis, 1 | PPT1 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 15 | g.2883477_2883478insC | c.736_737insC | p.(F246Lfs*29) | NM_001010944.1; NP_001010944.1 | 2010 | 20494602 | p. information obtained from Katz et al. (2017) Neurobiol Dis. doi: 10.1016/j.nbd.2017.08.017; genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. | ||
| 423 | OMIA:001504-9615 | dog | Italian Cane Corso (Dog) | Neuronal ceroid lipofuscinosis, 1 | PPT1 | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 15 | NC_006597.3:g.2860424G>A | NM_001010944.1:c.124+1G>A | 2017 | 28008682 | |||||
| 1353 | OMIA:001504-9940 | sheep | Neuronal ceroid lipofuscinosis, 1 | PPT1 | delins, small (<=20) | nonsense (stop-gain) | Genome-editing (CRISPR-Cas9) | Not currently evaluated | Oar_rambouillet_v1.0 | 1 | NC_040252.1:g.15235231_15235231delinsTTA | XP_004001885.2:p.(R151*) | 2019 | 31289301 | ||||||
| 76 | OMIA:001298-9615 | dog | American Cocker Spaniel (Dog) Australian Cattle Dog (Dog) Australian Shepherd (Dog) Australian Stumpy Tail Cattle Dog (Dog) Chesapeake Bay Retriever (Dog) Chihuahua (Dog) Chinese Crested (Dog) English Cocker Spaniel (Dog) Entlebucher Mountain Dog (Dog) Finnish Lapphund (Dog) Golden Retriever (Dog) Karelian Bear Dog (Dog) Kuvasz (Dog) Labrador Retriever (Dog) Lapponian Herder (Dog) Norwegian Elkhound (Dog) Nova Scotia Duck Tolling Retriever (Dog) Poodle, Miniature (Dog) Poodle, Toy (Dog) Portuguese Podengo (Dog) Portuguese Water Dog (Dog) Spanish Water Dog (Dog) Swedish Lapphund (Dog) Swedish White Elkhound (Dog) Yorkshire Terrier (Dog) | Progressive rod-cone degeneration | PRCD | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | NC_006591.3:g.4188663C>T | XM_022422503.1:c.5G>A | XP_022278211.1:p.(C2Y) | ENSCAFT00845030294.1; ENSCAFP00845023755.1; ROS_Cfam_1.0:g.4864649C>T; Portuguese Podengo and Swedish White Elkhound were reported in PMID: 37582787 | rs852451717 | 2006 | 16938425 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 1840 | OMIA:003013-9913 | taurine cattle | Angus (Cattle) | Dwarfism, primordial disproportionate | PRDM10 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 29 | NC_037356.1:g.36138136G>A | NM_001191168.1:c.866C>T | NP_001178097.1:p.(P289L) | 2025 | 40999323 | ||||
| 1553 | OMIA:002693-9940 | sheep | Cheviot (Sheep) | Achondroplasia, PRICKLE1-related | PRICKLE1 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | 3 | 10 bp deletion in the open reading frame | 2016 | Reference not in PubMed; see OMIA 002693-9940 for reference details | ||||||||
| 175 | OMIA:001085-9823 | pig | Meat quality (Rendement Napole) | PRKAG3 | RN- | substitution | missense | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 15 | NC_010457.5:g.120863533C>T | NM_214077.1:c.749G>A | NP_999242.1:p.(R250Q) | The paper by Milan et al. (2000) reported this variant as c.599G>A and p.R200Q | rs1109104772 | 2000 | 10818001 | The genomic location on Sscrofa11.1 was determined and the effect was confirmed with Ensembl VEP in the following transcript: ENSSSCT00000017641.4 by Stephanie Shields (27/05/2020) | |
| 176 | OMIA:001085-9823 | pig | Meat quality (Rendement Napole) | PRKAG3 | RN- | substitution | missense | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 15 | NC_010457.5:g.120863537C>T | NM_214077.1:c.745G>A | NP_999242.1:p.(V249I) | Pigs that are homozygous for the p.I249 have less glycogen in the muscle. | rs1108399077 | 2001 | 11729159 | The genomic location on Sscrofa11.1 was determined and the effect was confirmed with Ensembl VEP in the following transcript: ENSSSCT00000017641.4 by Stephanie Shields (27/05/2020) | |
| 283 | OMIA:000220-9615 | dog | Jack Russell Terrier (Dog) | Severe combined immunodeficiency disease, autosomal | PRKDC | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 29 | NC_006611.3:g.49588C>A | NM_001006651.2:c.10849G>T | NP_001006652.2:p.(E3617*) | NM_001006651.2; NP_001006652.2 ; published as c.10879G>T; p.(E3627*); coordinates in the table have been updated to a recent reference genome and / or transcript | 2002 | 11867233 | |||
| 511 | OMIA:000220-9796 | domestic horse | Arab (Horse) | Severe combined immunodeficiency disease, autosomal | PRKDC | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 9 | NC_009152.3:g.36395752_36395756del | NM_001163858.1:c.9478_9482del | NP_001157330.1:p.(N3160fs*3) | A 5bp deletion giving rise to a frameshift in PRKDC The following details (from which the coordinate fields were populated) were provided by Meredith O’Connell, Tanya German, Isabella Pisani and Karalie Andrews, under the supervision of Professor Ernie Bailey. 20 Feb 2019 NC_009152.3 g.36395752-36395976del; NM_001163858 c.9478_9482del; NP_001157330 p.N3160fs*3. The g. coordinates were previously listed incorrectly in this table as g.36395752_36395759del [03/06/2024] |
1997 | 9103416 | |||
| 291 | OMIA:001485-9913 | taurine cattle | Angus (Cattle) | Dwarfism, Angus | PRKG2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 6 | g.95896205G>A | c.1573C>T | p.(R525*) | rs109639251 | 2009 | 19887637 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 352 | OMIA:001485-9913 | taurine cattle | Angus (Cattle) | Dwarfism, Angus | PRKG2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 6 | NC_037333.1:g.95896205G>A | NM_001144099.1:c.2032C>T | NP_001137571.1:p.(R678*) | ENSBTAT00000003877.4:c.2032C>T ENSBTAP00000003877.4:p.Arg678Ter | rs109639251 | 2009 | 19887637 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | |
| 1373 | OMIA:001485-9615 | dog | Dogo Argentino (Dog) | Dwarfism, disproportionate | PRKG2 | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 32 | NC_006614.3:g.5299068C>A | XM_022413533.1:c.1634+1G>T | cDNA position based on XM_022413533.1 | 2021 | 34680883 | ||||
| 1857 | OMIA:001485-9615 | dog | Dalmatian (Dog) | Dwarfism, disproportionate | PRKG2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 32 | NC_049253.1:g.34701558T>G | XM_038582312.1:c.1601T>G | XP_038438240.1:p.(L534*) | 2025 | 41296694 | ||||
| 216 | OMIA:000441-9913 | taurine cattle | Holstein Friesian (Cattle) Jersey (Cattle) Simmental (Cattle) | Hairy | PRL | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 23 | NC_037350.1:g.35332871A>C | NM_173953.2:c.661A>C | NP_776378.2:p.(C221G) | ENSBTAT00000020313.4:c.661T>G ENSBTAP00000020313.3:p.Cys221Gly | rs520582588 | 2014 | 25519203 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 719 | OMIA:000380-9031 | chicken | Feathering, Z-linked | PRLR | duplication | Naturally occurring variant | Not currently evaluated | Z | The tandem duplication of this region results in the partial duplication of two genes; the prolactin receptor and the gene encoding sperm flagellar protein 2. | 2008 | 18713476 | |||||||||
| 1447 | OMIA:001372-9913 | taurine cattle | Criollo Lechero Tropical, Mexico (Cattle) | Slick hair | PRLR | SLICK4 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 20 | NC_037347.1:g.39099113C>G | NM_001039726.2:c.1281C>G | NP_001034815.1:p.(Y427*) | 2021 | 33259090 | |||
| 544 | OMIA:001372-9913 | taurine cattle | Blanco Orejinegro, Colombia (Cattle) Carora, Venezuela (Bolivarian Republic of) (Cattle) Chino Santandereano, Colombia (Cattle) Costeno con Cuernos (Cattle) Criollo Caqueteño, Colombia (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) Romosinuano, Venezuela (Bolivarian Republic of) (Cattle) Senepol (Cattle) Tropicarne, Mexico (Cattle) | Slick hair | PRLR | SLICK1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 20 | NC_037347.1:g.39099214del | NM_001039726.2:c.1382del | NP_001034815.1:p.(A461Vfs*2) | rs517047387 | 2014 | 25519203 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; some variant information gleaned from or confirmed by Table 1 of Sharma et al. (2017) Animal Genetics 48(3):369-370, breed infromation updated based on PMID:39377537 | |
| 974 | OMIA:001372-9913 | taurine cattle | Criollo Lechero Tropical, Mexico (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) | Slick hair | PRLR | SLICK3 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 20 | NC_037347.1:g.39099226C>A | NM_001039726.2:c.1394C>A | NP_001034815.1:p.(S465*) | rs5334474999 | 2018 | 29527221 | Breed infromation updated based on PMID:39377537 | |
| 1448 | OMIA:001372-9913 | taurine cattle | Blanco Orejinegro, Colombia (Cattle) Carora, Venezuela (Bolivarian Republic of) (Cattle) Chino Santandereano, Colombia (Cattle) Costeno con Cuernos (Cattle) Criollo Caqueteño, Colombia (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) Romosinuano, Venezuela (Bolivarian Republic of) (Cattle) | Slick hair | PRLR | SLICK5 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 20 | NC_037347.1:g.39099228A>T | NM_001039726.2:c.1396A>T | NP_001034815.1:p.(K466*) | 2021 | 33259090 | Breed infromation updated based on PMID:39377537 | ||
| 1449 | OMIA:001372-9913 | taurine cattle | Carora, Venezuela (Bolivarian Republic of) (Cattle) Costeno con Cuernos (Cattle) Criollo Caqueteño, Colombia (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) Romosinuano, Venezuela (Bolivarian Republic of) (Cattle) Senepol (Cattle) Tropicarne, Mexico (Cattle) | Slick hair | PRLR | SLICK6 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 20 | NC_037347.1:g.39099267C>T | NM_001039726.2:c.1435C>T | NP_001034815.1:p.(Q479*) | 2021 | 33259090 | Breed infromation updated based on PMID:39377537 | ||
| 975 | OMIA:001372-9913 | taurine cattle | Baoulé (Cattle) Caracu, Brazil (Cattle) Carora, Venezuela (Bolivarian Republic of) (Cattle) Casanareño, Colombia (Cattle) Chino Santandereano, Colombia (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) Romosinuano, Venezuela (Bolivarian Republic of) (Cattle) West African Zebu (Cattle) | Slick hair | PRLR | SLICK2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 20 | NC_037347.1:g.39099321C>T | NM_001039726.2:c.1489C>T | NP_001034815.1:p.(R497*) | rs5334474702 | 2018 | 29527221 | Breed infromation updated based on PMID:39377537 and PMID:39710878 | |
| 977 | OMIA:000380-9103 | turkey | Feathering, Z-linked | PRLR | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Turkey_5.1 | Z | g.9426018_9426022delTTGGT | p.(E726Dfs*7) | 2018 | 29566646 | ||||||
| 1507 | OMIA:000944-447135 | Bank vole | Susceptibility to atypical scrapie | PRNP | not known | missense | Naturally occurring variant | Not currently evaluated | p.(M109I) | 2022 | 35731839 | |||||||||
| 1756 | OMIA:000944-9874 | white-tailed deer | Chronic wasting disease, susceptibility to | PRNP | Naturally occurring variant | Not currently evaluated | c.286G>A | p.(G96S) | 2024 | 39679175 | ||||||||||
| 834 | OMIA:000944-9913 | taurine cattle | Spongiform encephalopathy (mad cow disease) | PRNP | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 13 | g.47056730G>A | c.631G>A | p.(E211K) | 2008 | 18787697 | Genomic coordinates obtained from EBI's VEP | ||||||
| 1310 | OMIA:000944-9925 | goat | Resistance to scrapie | PRNP | Naturally occurring variant | Not currently evaluated | ARS1 | 13 | p.(H143R) | 2002 | 11842266 | |||||||||
| 1146 | OMIA:000944-9925 | goat | Norsk melkegeit, Norway (Goat) | Complete resistance to scrapie | PRNP | Ter | Naturally occurring variant | Not currently evaluated | ARS1 | 13 | g.46469788G>T | c.94G>T | p.(G32*) | ENSEMBL Variant Effect Predictor: transcript ENSCHIT00000020215.1 | 2012 | 23249298 | The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries | |||
| 827 | OMIA:000944-9925 | goat | Resistance to scrapie | PRNP | Naturally occurring variant | Not currently evaluated | ARS1 | 13 | g.46470073G>A | c.379G>A | p.(G127S) | ENSEMBL Variant Effect Predictor: transcript ENSCHIT00000020215.1 | rs268292978 | 2011 | 22040234 | The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries | ||||
| 828 | OMIA:000944-9925 | goat | Resistance to scrapie | PRNP | Naturally occurring variant | Not currently evaluated | ARS1 | 13 | g.46470120A>G | c.426A>G | p.(I142M) | ENSEMBL Variant Effect Predictor: transcript ENSCHIT00000020215.1 | rs268292980 | 1996 | 8922485 | The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries | ||||
| 830 | OMIA:000944-9925 | goat | Resistance to scrapie | PRNP | Naturally occurring variant | Not currently evaluated | ARS1 | 13 | g.46470130A>G | c.436A>G | p.(N146D) | ENSEMBL Variant Effect Predictor: transcript ENSCHIT00000020215.1 | 2007 | 16314132 | The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries | |||||
| 829 | OMIA:000944-9925 | goat | Resistance to scrapie | PRNP | Naturally occurring variant | Not currently evaluated | ARS1 | 13 | g.46470131A>G | c.437A>G | p.(N146S) | ENSEMBL Variant Effect Predictor: transcript ENSCHIT00000020215.1 | 2007 | 16314132 | The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries | |||||
| 831 | OMIA:000944-9925 | goat | Resistance to scrapie | PRNP | Naturally occurring variant | Not currently evaluated | ARS1 | 13 | g.46470155G>A | c.461G>A | p.(R154H) | ENSEMBL Variant Effect Predictor: transcript ENSCHIT00000020215.1 | rs268292981 | 2009 | 19218225 | The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries | ||||
| 832 | OMIA:000944-9925 | goat | Resistance to scrapie | PRNP | Naturally occurring variant | Not currently evaluated | ARS1 | 13 | g.46470326G>A | c.632G>A | p.(R211Q) | ENSEMBL Variant Effect Predictor: transcript ENSCHIT00000020215.1 | rs268292982 | 2009 | 19218225 | The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries | ||||
| 833 | OMIA:000944-9925 | goat | Resistance to scrapie | PRNP | Naturally occurring variant | Not currently evaluated | ARS1 | 13 | g.46470358C>A | c.664C>A | p.(Q222K) | ENSEMBL Variant Effect Predictor: transcript ENSCHIT00000020215.1 | rs268292983 | 2006 | 16603543 | The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries | ||||
| 823 | OMIA:000944-9940 | sheep | Ile-De-France (Sheep) Romanov (Sheep) | Resistance to scrapie | PRNP | V | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 13 | g.48675389C>T | c.407C>T | p.(A136V) | Oar_v3.1 position is g.46225660C>T; protein and cDNA positions are based on NP_001009481.1 and NM_001009481.1, respectively | rs591379086 | 1993 | 8094373 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 825 | OMIA:000944-9940 | sheep | Resistance to scrapie, Nor98 type | PRNP | F | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 13 | g.48675403C>T | c.421C>T | p.(L141F) | Oar_v3.1 position is g.46225674C>T; protein and cDNA positions are based on NP_001009481.1 and NM_001009481.1, respectively | rs598580733 | 2005 | 15604451 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| 824 | OMIA:000944-9940 | sheep | Ile-De-France (Sheep) Romanov (Sheep) | Resistance to scrapie | PRNP | H | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 13 | g.48675443G>A | c.461G>A | p.(R154H) | Oar_v3.1 position is g.46225714G>A; protein and cDNA positions are based on NP_001009481.1 and NM_001009481.1, respectively | rs605048948 | 1993 | 8094373 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 822 | OMIA:000944-9940 | sheep | Suffolk (Sheep) | Resistance to scrapie | PRNP | Q | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 13 | g.48675494G>A | c.512G>A | p.(R171Q) | Oar_v3.1 position is g.46225765G>A; protein and cDNA positions based on NP_001009481.1 and NM_001009481.1, respectively | rs160575103 | 1990 | 1969635 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 33 | OMIA:001454-9615 | dog | Great Dane (Dog) | Harlequin | PSMB7 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | NC_006591.3:g.58530295T>G | XM_022422504.1:c.146T>G | XP_022278212.1:p.(V49G) | XM_022422504.1; XP_022278212.1 | 2011 | 21256207 | Genomic position in CanFam3.1 provided by Mateo Etcheveste. | ||
| 698 | OMIA:001515-9615 | dog | Great Dane (Dog) | Colorectal hamartomatous polyposis and ganglioneuromatosis | PTEN | duplication | Naturally occurring variant | Not currently evaluated | 26 | "Duplication of PTEN" | 2011 | 20952721 | ||||||||
| 988 | OMIA:002196-9615 | dog | Doberman Pinscher (Dog) | Deafness, unilateral and vestibular dysfunction | PTPRQ | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 15 | g.22989897_22989898insA | c.9230_9231insA | p.(N3077Kfs*24) | XM_022428131.1; XP_022283839.1; published as an A insertion at CFA15: 22 989 894 and p.(N2032Kfs*24) based on ENSCAFT00000009346.4 - renamed due to HGVS 3'rule and RefSeq IDs | 2018 | 29460419 | |||
| 1688 | OMIA:001139-9913 | taurine cattle | Red Angus (Cattle) | Glycogen storage disease V | PYGM | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 29 | NC_037356.1:g.42989581G>A | NM_175786.2 c.1948C>T | NP_786980.1:p.(R650*) | published as c.2257C>T in ARS-UCD1.2 | 2024 | 38678201 | |||
| 193 | OMIA:001139-9913 | taurine cattle | Charolais (Cattle) | Glycogen storage disease V | PYGM | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 29 | NC_037356.1:g.42991370G>A | NM_175786.2:c.1468C>T | NP_786980.1:p.(R490W) | rs5334475023 | 1996 | 8845714 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | ||
| 388 | OMIA:001139-9940 | sheep | Merino (Sheep) | Glycogen storage disease V | PYGM | substitution | splicing | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 21 | NC_040272.1:g.44787090C>T | NM_001009192.2:c.2380-1G>A | a G>A substitution at the 3' splice site of intron 19, cDNA position based on NM_001009192.2 | rs402505013 | 1997 | 9267848 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1689 | OMIA:002848-9913 | taurine cattle | Brown Swiss (Cattle) | Spermatogenic failure, QRICH2-related | QRICH2 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.55436710del | XM_002696205.5:c.4929del | XP_002696251.3:C1644Afs*52 | Coordinates in this table consider 3' rule of HGVS recommendation | 2022 | 35255804 | |||
| 88 | OMIA:001913-9615 | dog | Gordon Setter (Dog) Old English Sheepdog (Dog) | Ataxia, cerebellar, in Old English Sheepdogs and Gordon Setters | RAB24 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 4 | NC_006586.3:g.36055678A>C | XM_005619162.3:c.113A>C | XP_005619219.1:p.(Q38P) | XM_005619162.3; XP_005619219.1 | 2014 | 24516392 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1826 | OMIA:001913-9615 | dog | Mixed Breed (Dog) | Ataxia, cereballar, RAB24-related | RAB24 | substitution | missense | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 4 | NC_049225.1:g.36943081G>T | XM_038534663.1:c.239G>T | XP_038390591.1:p.(G80V) | 2025 | 40869982 | ||||
| 1256 | OMIA:002292-452646 | American mink | Moyle coat colour | RAB38 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | NNQGG.v01 | 1 | g.16075438_16075453del | c.574-589del | "We identified a homozygous 16-bp deletion [FNWR01000007.1:16075438–16075453del (RAB38:c.574-589del)], hereinafter referred to as RAB383del, in the Moyle sample, at the third exon of RAB38 gene. We found a homozygous 2-bp duplication NWR01000007.1:16132224_16132225dupCT (RAB38:c.20-21dup)], hereinafter referred to as RAB381dup, in the Violet sample, at the first exon of the RAB38 gene. Both mutations potentially resulted in the loss of function of RAB38 protein" (Manakhov et al., 2020) | 2020 | 32985525 | ||||||
| 1257 | OMIA:002292-452646 | American mink | Moyle coat colour | RAB38 | duplication | Naturally occurring variant | Not currently evaluated | NNQGG.v01 | 1 | g.16132224_16132225dupCT | c.20-21dup | "We identified a homozygous 16-bp deletion [FNWR01000007.1:16075438–16075453del (RAB38:c.574-589del)], hereinafter referred to as RAB383del, in the Moyle sample, at the third exon of RAB38 gene. We found a homozygous 2-bp duplication NWR01000007.1:16132224_16132225dupCT (RAB38:c.20-21dup)], hereinafter referred to as RAB381dup, in the Violet sample, at the first exon of the RAB38 gene. Both mutations potentially resulted in the loss of function of RAB38 protein" (Manakhov et al., 2020) | 2020 | 32985525 | ||||||
| 730 | OMIA:001970-9615 | dog | Alaskan Husky (Dog) | Polyneuropathy, ocular abnormalities and neuronal vacuolation | RAB3GAP1 | insertion, gross (>20) | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 19 | g.37903870_37903871insN[218] | c.614_615insN[218] | XM_851254.3; published as 218 bp SINE insertion in exon 7; sequence of the mutant allele was submitted to ENA (accession LN864704); transcript analysis identified a new internal splice acceptor site within the SINE insertion resulting in a novel “exon 7” | 2015 | 26596647 | ||||
| 546 | OMIA:001970-9615 | dog | Black Russian Terrier (Dog) Rottweiler (Dog) | Polyneuropathy, ocular abnormalities and neuronal vacuolation | RAB3GAP1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 19 | g.37908634del | c.743del | p.P248Lfs*4 | XM_022406115.1; XP_022261823.1, published as c.743delC | rs851283827 | 2016 | 26607784 | Genomic coordinates in CanFam3.1 and EVA ID provided by Zoe Shmidt and Robert Kuhn. | |
| 221 | OMIA:002037-9913 | taurine cattle | Holstein Friesian (Cattle) | Abortion (embryonic lethality), RABGGTB | RABGGTB | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 3 | NC_037330.1:g.69060748T>C | NM_001015646.1:c.584A>G | NP_001015646.1:p.(Y195C) | ENSBTAT00000024551.6:c.584A>G ENSBTAP00000024551.6:p.Tyr195Cys | rs1118263722 | 2016 | 27646536 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 1123 | OMIA:001547-9031 | chicken | Wingless-2 | RAF1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | GRCg6a | 12 | g.5374854G>A | c.175C>T | p.(R59*) | NC_006099.5:g.5374854G>A ENSGALT00000033956.3:c.175C>T ENSGALP00000033314.3:p.Arg59Ter | rs314452077 | 2019 | 31075853 | |||
| 284 | OMIA:001574-9615 | dog | Frisian Water Dog (Dog) | Severe combined immunodeficiency disease, autosomal, T cell-negative, B cell-negative, NK cell-positive | RAG1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 18 | NC_006600.3:g.31631772C>A | XM_540538.2:c.2893G>T | XP_540538.1:p.(E965*) | 2011 | 21293384 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1621 | OMIA:002763-9541 | crab-eating macaque | Severe combined immunodeficiency disease | RAG1 | substitution | nonsense (stop-gain) | Base-editing | Not currently evaluated | Macaca_fascicularis_5.0 | 14 | g.30840789G>T | c.181C>T | p.(Q61*) | XM_005578172.2; XP_005578229.1 | 2023 | 37661226 | ||||
| 1613 | OMIA:002757-9615 | dog | Belgian Shepherd Dog (Dog) | Ataxia, cerebellar, RALGAPA1-related | RALGAPA1 | deletion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 8 | g.14468376_14473136del | c.6080-2893_6944+1003del | p.(V2027Qfs*7) | XM_038544497.1; XP_038400425.1; published as g.14,468,376_14,473,136del4761 | 2023 | 37628572 | |||
| 1369 | OMIA:002458-9796 | domestic horse | Thoroughbred (Horse) | Hypoparathyroidism | RAPGEF5 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 4 | NC_009147.3:g.54108297G>T | XM_023639352.1:c.2624C>A | XP_023495120.1:p.(S875*) | 2020 | 32986719 | ||||
| 1138 | OMIA:002222-9615 | dog | Miniature Bull Terrier (Dog) | Laryngeal paralysis, RAPGEF6-related | RAPGEF6 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 11 | g.19841331insN[36] | c.1793_1794insTTTTTTTTTTTTTTTTTTTTTAGCCCTTGAAATTTT | p.(I587Pfs*5) | XM_846793.5; XP_851886.2 | 2019 | 31647804 | ||||
| 209 | OMIA:002433-9913 | taurine cattle | Holstein Friesian (Cattle) Simmental (Cattle) Swiss Fleckvieh (Cattle) | Thrombopathia | RASGRP2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 29 | NC_037356.1:g.42978791A>G | NM_001099946.1:c.701T>C | NP_001093416.1:p.(L234P) | Additional breeds based on PMID:40312951 | rs385444696 | 2007 | 18039909 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | |
| 585 | OMIA:002433-9615 | dog | American Eskimo Dog (Dog) | Thrombopathia | RASGRP2 | duplication | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 18 | g.52417256dup | c.452dup | p.(D151Efs) | XM_849829.5; XP_854922.1; published as c.452-453insA | 2007 | 17656327 | |||
| 477 | OMIA:002433-9615 | dog | Basset Hound (Dog) | Thrombopathia | RASGRP2 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 18 | g.52417313_52417315del | c.509_511del | p.(F170del) | XM_849829.5; XP_854922.1 | 2007 | 17656327 | |||
| 285 | OMIA:002433-9615 | dog | Landseer (Dog) | Thrombopathia | RASGRP2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 18 | NC_006600.3:g.52419245C>T | XM_849829.5:c.982C>T | XP_854922.1:p.(R328*) | XM_849829.5; XP_854922.1 | 2007 | 17656327 | |||
| 1780 | OMIA:002055-9615 | dog | Nova Scotia Duck Tolling Retriever (Dog) | Encephalopathy, degenerative | RB1CC1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Dog10K_Boxer_Tasha | 29 | NC_006611.4:g.4891014C>T | XM_014109241.3:c.4507G>A | XP_013964716.1:p.(G1503R) | 2025 | 40149422 | ||||
| 1833 | OMIA:003010-9615 | dog | Basset Hound (Dog) | Glycogen storage disease myopathy | RBCK1 | substitution | splicing | Naturally occurring variant | Not currently evaluated | U_Cfam_GSD_1.0 | 24 | NC_049245.1:g.20935568C>A | XM_038571894.1:c.1044+1G>T | 2025 | 40939526 | |||||
| 1323 | OMIA:002365-9615 | dog | Giant Schnauzer (Dog) Schnauzer, Standard (Dog) | Cardiomyopathy, dilated | RBM20 | deletion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | 28 | 22 bp deletion and frame shift in exon 11 of RBM20 | 2014 | Reference not in PubMed; see OMIA 002365-9615 for reference details | |||||||
| 913 | OMIA:000876-9031 | chicken | Riboflavinuria | RBP | substitution | splicing | Naturally occurring variant | Not currently evaluated | 8 | A "deletion in the rd ribBP cDNA correspond[ing] precisely to an exon. The splice site following this exon contains a G-->A mutation at position 1 of the downstream 5'-splice donor sequence. | 1993 | 8226844 | ||||||||
| 993 | OMIA:002151-9615 | dog | Irish Soft Coated Wheaten Terrier (Dog) | Microphthalmia, isolated, with coloboma | RBP4 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 28 | g.7830265_7830267del | c.90_92del | p.(K31del) | XM_534969.6; XP_534969.3; published as c.282_284delGAA and p.(K30del); coordinates in the table have been updated to a recent reference genome and transcript, and are in accordance with the HGVS 3'-rule | 2018 | 29847795 | |||
| 710 | OMIA:001260-9615 | dog | Collie (Dog) | Rod-cone dysplasia 2 | RD3 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 7 | "22 bp insertion changes the last 61 amino acids of the encoded protein" | 2009 | 19130129 | ||||||||
| 1377 | OMIA:002469-9685 | domestic cat | Retinopathy | RDH5 | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B4 | NC_058374.1:g.82298824G>T | XM_019835050.2:c.542G>T | XP_019690609.1:p.(G181V) | 2021 | 34726233 | Genomic position in Felis_catus_9.0 provided by Joshua Khamis. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||||
| 1663 | OMIA:001867-9940 | sheep | Poll Dorset (Sheep) | Lissencephaly and cerebellar hypoplasia | RELN | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_Rambouillet_v1.0 | 4 | NC_040255.1:g.50288685C>T | NM_001306121.1:c.7088G>A | NP_001293050.1:p.(R2363H) | Entry has been created to generate an OMIAvariantID for a variant that is currently in the process of being published. Information will be updated once manuscript has been published. | 2024 | 39394905 | |||
| 673 | OMIA:001867-9940 | sheep | Spanish Churro (Sheep) | Lissencephaly and cerebellar hypoplasia | RELN | deletion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 4 | NC_040255.1:g.50313243_50313273del | NM_001306121.1:c.5410_5440del | A deletion of 31 bp (GATGTAAGTTCCCATTGAAATCATCTTTAAG) in predicted exon 36 of RELN would lead to a truncated protein of 1817 amino acids (1803 amino acids of normal reelin followed by 14 missense amino acids and a premature termination codon) | 2013 | 24260534 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| 1580 | OMIA:001867-9615 | dog | White Swiss Shepherd Dog (Dog) | Lissenecephaly and cerebellar hypoplasia | RELN | deletion, small (<=20) | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 18 | g.16909944del | c.2839del | p.(V947*) | XM_038562771.1; XP_038418699.1; reported as g.16909942TG>T - information in this table has been updated to reflect HGVS nomenclature. | 2023 | 37334487 | |||
| 1888 | OMIA:003051-9615 | dog | Nova Scotia Duck Tolling Retriever (Dog) | Addison’s disease and multiple autoimmune syndrome | RESF1 | substitution | missense | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 27 | NC_049248.1 g.29736795C>T | XM_038577211.1:c.3170C>T | XP_038433139.1:p.(P1057L) | 2026 | 41813921 | ||||
| 1522 | OMIA:002609-9615 | dog | Huntaway (Dog) Labrador Retriever (Dog) | Modifier of copper toxicosis | RETN | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 20 | NC_006602.3:g.52434480C>T | XM_849220.5:c.19C>T | XP_854313.1:p.(L7F) | Additional breeds based on PMID:40965331 | rs852470997 | 2020 | 33142854 | ||
| 1717 | OMIA:002873-9913 | taurine cattle | Normande (Cattle) | Haplotype with homozygous deficiency, RFC5-related | RFC5 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 17 | NC_037344.1:g.57188407_57188409del | NM_001075358.1:c.573_575del | NP_001068826.1:p.(E192del) | Published as ENSBTAT00000085991.1:p.E369del | rs5366807285 | 2023 | Reference not in PubMed; see OMIA 002873-9913 for reference details | ||
| 1099 | OMIA:002209-7950 | Atlantic herring | Adaptation to a red-shifted light environment | rho | substitution | missense | Naturally occurring variant | Not currently evaluated | p.(F261Y) | 2019 | 31451650 | |||||||||
| 29 | OMIA:001346-9615 | dog | English Mastiff (Dog) | Autosomal dominant PRA | RHO | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 20 | NC_006602.3:g.5637394G>C | XM_005632035.3:c.11C>G | XP_005632092.1:p.(T4R) | 2002 | 11972042 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1709 | OMIA:002865-9986 | rabbit | New Zealand White (Rabbit) | Cerebral palsy, RHOB-related | RHOB | delins, small (<=20) | missense | Genome-editing (CRISPR-Cas9) | Not currently evaluated | OryCun2.0 | 2 | NC_013670.1:g.169569191_169569192delinsTT | XM_008254781.2:c.218_219delinsTT | XP_008253003.1:p.(S73F) | 2024 | 39080495 | ||||
| 1442 | OMIA:002547-9913 | taurine cattle | Holstein-Friesian, Switzerland (Cattle) | Haplotype HH25 deficiency | RIOX1 | deletion, gross (>20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 10 | g.84938408_84938437del | c.396_425del | p.(A133_E142del) | NM_001099702.1; NP_001093172.1; published as c.396_425delGGCGCAGACCCCGGCGGCACGCTTGGTGGA | 2022 | 35361830 | |||
| 1796 | OMIA:002945-8128 | Nile tilapia | Hypogonadism | rln3b | deletion, gross (>20) | Genome-editing (CRISPR-Cas9) | Not currently evaluated | >500 bp deletion | 2024 | 38729472 | ||||||||||
| 676 | OMIA:001901-9913 | taurine cattle | Nordic Red (Cattle) | Abortion due to deletion of RNASEH2B | RNASEH2B | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 12 | g.20007546_20691454del | A 662kb deletion encompases the gene RNASEH2B, lack of which creates embryonic lethality. | 2014 | 24391517 | Genomic position gained from Mesbah-Uddin et al. (2021) - structural variant id esv4015629 (Database of Genomic Variants archive extracted from Ensembl release 94 - http://ftp.ensembl.org/pub/release-94/). | |||||
| 376 | OMIA:001686-9913 | taurine cattle | Belgian Blue (Cattle) | Dwarfism, proportionate, with inflammatory lesions | RNF11 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 3 | NC_037330.1:g.95015373T>C | NM_001077953.1:c.124-2A>G | NM_001077953.1 | rs3423159409 | 2012 | 22438830 | Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1726 | OMIA:002876-9615 | dog | Miniature American Shepherd (Dog) | Neuroaxonal dystrophy, RNF170-related | RNF170 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 16 | NC_049237.1:g.23653872del | XM_038559916.1:c.367del | XP_038415844.1:p.(A123Qfs*11) | 2024 | 39177409 | ||||
| 344 | OMIA:002038-9913 | taurine cattle | Holstein Friesian (Cattle) | Abortion (embryonic lethality), RNF20 | RNF20 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 8 | NC_037335.1:g.91297797A>T | NM_001081587.1:c.2077A>T | NP_001075056.1:p.(K693*) | rs5334474936 | 2016 | 27646536 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1139 | OMIA:002223-9913 | taurine cattle | Holstein (black and white) (Cattle) | Interdigital hyperplasia | ROR2 | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 8 | g.85905534T>A | c.25T>A | p.(W9R) | ENSBTAT00000061589.3:c.25T>A ENSBTAP00000053765.2:p.Trp9Arg | rs377953295 | 2019 | 31798639 | ||||
| 1349 | OMIA:001308-8932 | rock pigeon | Short beak | ROR2 | Ku2 | Naturally occurring variant | Not currently evaluated | Cliv_2.1 | c.1087C>T | Genomic position on scaffold ScoHet5_445.1:6568443; non-reference allele causes an arginine-to-cysteine substitution in the seventh exon of ROR2 (Boer et al., 2021) | 2021 | 34551284 | ||||||||
| 1297 | OMIA:002317-9986 | rabbit | Sauteur d'Alfort | Sauteur | RORB | s^am | substitution | splicing | Naturally occurring variant | Not currently evaluated | OryCun2.0 | 1 | g.61103503G>A | This variant corresponds to a change from GT to AT in the 5’ donor site of intron 9 (Carneiro et al., 2021) | rs3166922596 | 2021 | 33764968 | |||
| 611 | OMIA:002029-9913 | taurine cattle | Angus (Cattle) Belgian Blue (Cattle) Charolais (Cattle) Gelbvieh (Cattle) Holstein Friesian (Cattle) Maine-Anjou (Cattle) Normande (Cattle) Red Angus (Cattle) Simmental (Cattle) Swiss Fleckvieh (Cattle) | Retinitis pigmentosa 1 | RP1 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 14 | g.22340665_22340666insA | p.(R791Kfs*13) | 2016 | 27510606 | Additional breeds based on PMID:40312951 | ||||
| 858 | OMIA:002134-9913 | taurine cattle | Ayrshire (Cattle) | Abortion due to haplotype AH2 | RPAP2 | substitution | splicing | Naturally occurring variant | Not currently evaluated | 3 | a splice acceptor variant at 51,267,548 bp [reference sequence not specified] in RPAP2 | 2017 | Reference not in PubMed; see OMIA 002134-9913 for reference details | |||||||
| 468 | OMIA:001222-9615 | dog | Briard (Dog) | Leber congenital amaurosis (congenital stationary night blindness) | RPE65 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 6 | g.76893207_76893210del | c.460_463del | p.(K154Lfs*53) | NM_001003176.1; NP_001003176.1; 4 bp AAGA deletion in RPE65 | 1998 | 9808841 | |||
| 688 | OMIA:000831-9615 | dog | Weimaraner (Dog) | Progressive retinal atrophy, X-linked, type 1 | RPGR | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | X | "a large deletion [maximum size 5,006 bp] comprising the first four exons of the X-linked retinitis pigmentosa GTPase regulator (RPGR) gene" | 2016 | 27398221 | ||||||||
| 481 | OMIA:001518-9615 | dog | Mixed Breed (Dog) | Progressive retinal atrophy, X-linked, type 2 | RPGR | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ROS_Cfam_1.0 | X | g.33126437_33126438del | c.3472_3473del | p.(E1158Gfs*212) | published as "a two-nucleotide deletion (delGA) in c.1084-1085" [GenBank accession no. AF385629] in the exon ORF15 of the canine RPGR gene; updated c.DNA and protein positions kindly provided by Leonardo Murgiano [15/2/20022] | 2002 | 11978759 | |||
| 480 | OMIA:000831-9615 | dog | Samoyed (Dog) Siberian Husky (Dog) | Progressive retinal atrophy, X-linked, type 1 | RPGR | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ROS_Cfam_1.0 | X | g.33126490_33126494del | c.3416_3420del | p.(R1139Ifs*2) | published as a "five-nucleotide deletion (delGAGAA) between 1028 and 1032" in exon ORF15 of the canine RPGR gene [GenBank accession no. AF385629]; updated c.DNA and protein positions kindly provided by Leonardo Murgiano [15/2/20022] | 2002 | 11978759 | |||
| 699 | OMIA:001432-9615 | dog | Dachshund, Miniature Long-Haired (Dog) | Cone-rod dystrophy 4 | RPGRIP1 | insertion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 15 | g.18332036_18332037ins[A[29];GGAAGCAACAGGATG] | c.142_143ins[A[29];GGAAGCAACAGGATG] | p.(I49Kfs*26) | NM_001313773.1; NP_001300702.1; published as a 44-bp insertion in exon 2 of the RPGRIP1 gene; comprising a poly(A) stretch flanked by a perfect 15-bp duplication: g.8228_8229insA29GGAAGCAACAGGATG; see PMID:38752391 for additional breed information | 2006 | 16806805 | |||
| 416 | OMIA:002041-9913 | taurine cattle | Belgian Blue (Cattle) | Abortion (embryonic lethality), RPIA-related | RPIA | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 11 | NC_037338.1:g.47355110C>T | NM_001035433.2:c.826+1G>A | rs5334475111 | 2016 | 27646536 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 703 | OMIA:001498-9615 OMIA:001531-9615 | dog | Dachshund (Dog) Portuguese Water Dog (Dog) | Furnishings (moustache and eyebrows) | RSPO2 | insertion, gross (>20) | regulatory | Naturally occurring variant | Not currently evaluated | 13 | a 167bp insertion "within the 3'UTR at position 11,634,766", which leads to a threefold increase in transcription of RSPO2 in muzzle skin of dogs with furnishings; absence of this variant causes 'improper coat' in some breeds | 2009 | 19713490 | |||||||
| 1269 | OMIA:002297-9913 | taurine cattle | Holstein Friesian (Cattle) | Tetradysmelia | RSPO2 | delins, gross (>20) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 14 | g.56451029_56501201delinsTGACAA | a 50-kb deletion spanning three exons of the R-spondin 2 (RSPO2) gene | 2020 | 33176673 | ||||||
| 926 | OMIA:000483-9940 | sheep | Polled | RXFP2 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 10 | "1833-bp genomic insertion located in the 30-UTR region of RXFP2 present in polled animals only" | 2015 | 26103004 | ||||||||
| 54 | OMIA:000621-9615 | dog | Collie (Dog) Doberman Pinscher (Dog) German Shepherd Dog (Dog) Labrador Retriever (Dog) | Malignant hyperthermia | RYR1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 1 | NC_006583.3:g.114562165A>G | XM_022425933.1:c.1643T>C | XP_022281641.1:p.(V548A) | XM_022425933.1 c.1643C>T; XP_022281641.1; published as c.1640T>C ; p.(V547A) "The nucleotide sequences of canine regions I and II have been submitted to GenBank (accession No. A302128 and AF302129, respectively)" (Roberts et al., 2001) | 2001 | 11575546 | |||
| 1759 | OMIA:000621-9615 | dog | Mixed Breed (Dog) | Malignant hyperthermia | RYR1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Dog10K_Boxer_Tasha | 1 | NC_006583.4:g.113934594C>T | XM_003638834.5:c.7123G>A | XP_003638882.1:p.(G2375R) | Changed from NC_006583.4:g.113934594G>A to NC_006583.4:g.113934594C>T [09/06/2025] | 2024 | 39516111 | |||
| 1760 | OMIA:000621-9615 | dog | Golden Retriever (Dog) | Malignant hyperthermia | RYR1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Dog10K_Boxer_Tasha | 1 | NC_006583.4:g.113974548G>A | XM_003638834.5:c.455C>T | XP_003638882.1:p.(P152L) | reported as de novo germline mutation; changed from NC_006583.4:g.113974548C>T tp NC_006583.4:g.113974548G>A [09/06/2025] | 2024 | 39516111 | |||
| 159 | OMIA:000621-9796 | domestic horse | American Paint (Horse) Appaloosa (Horse) Quarter Horse (Horse) | Malignant hyperthermia | RYR1 | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 10 | NC_009153.3:g.9678680C>G | XM_023649662.1:c.7363C>G | XP_023505430.1:p.(R2455G) | XM_023649662.1; XP_023505430.1; published as c.7360C>G and p.(R2454G); coordinates in the table have been updated to a recent reference genome and / or transcript | 2004 | 15318347 | The genomic position in EquCab3.0 was provided by Hailey Anderson, working under the guidance of Professor Ernie Bailey in April 2022. Additional breed inforamtion based on PMID:40298507 | ||
| 174 | OMIA:000621-9823 | pig | Malignant hyperthermia | RYR1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 6 | NC_010448.4:g.47357966T>C | NM_001001534.1:c.1843C>T | NP_001001534.1:p.(R615C) | NM_001001534.1: c.1843C>T; p.(R615C) Interestingly, the reference allele in the Sscrofa11.1 assembly is T rather than C, meaning that the Duroc animal that is the basis of this reference genome assembly has the causal variant for malignant hyperthermia! | rs344435545 | 1991 | 1862346 | Effect was confirmed with Ensembl VEP in the following transcript: NM_001001534.1 by Stephanie Shields (27/05/2020) | ||
| 1627 | OMIA:002780-9615 | dog | Great Pyrenees (Dog) | Ataxia, spastic, SACS-related | SACS | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ENSCAFT00030020331.1 | 25 | c.12731_12734del | p.(V4244Afs*32) | Published as ENSCAFT00030020331.1:c.12731_12734delTTAG - CanFam3.1 and CanFam4 are annotated incorrectly for this gene | 2023 | 37758910 | ||||
| 359 | OMIA:001876-9615 | dog | Basenji (Dog) | Progressive retinal atrophy, Basenji | SAG | substitution | extension (stop-lost) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 25 | NC_006607.3:g.44843440T>C | XM_022409547.1:c.1216T>C | XP_022265255.1:p.(*405Rext*25) | 2013 | 24019744 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1233 | OMIA:002284-9615 | dog | Miniature Schnauzer (Dog) | Polyneuropathy, SBF2-related | SBF2 | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 21 | g.33080022C>A | c.2363+1G>T | p.(G775Vfs*5) | 2019 | 31772832 | ||||
| 1558 | OMIA:001252-9135 | common canary | Feather colour, recessive white | SCARB1 | substitution | splicing | Naturally occurring variant | Not currently evaluated | NW_022042652.1 | g.27474120A>C | Variant in located in the splice-donor site immediately downstream of exon 4 and results in transcript isoforms. Genomic coordinates as listed by Bovo et al., 2023, PMID:37194440. | 2017 | 28465440 | |||||||
| 552 | OMIA:002016-9615 | dog | Wire Fox Terrier (Dog) | Van den Ende-Gupta syndrome | SCARF2 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 26 | g.30237714_30237715del | c.1873_1874del | p.(S625Gfs*15) | XM_022410347.1; XP_022266055.1; published as c.865_866delTC, p.(S289Gfs*15); coordinates in the table have been updated to a recent reference genome and / or transcript | 2016 | 27187611 | |||
| 162 | OMIA:000785-9796 | domestic horse | Quarter Horse (Horse) | HYPP | SCN4A | H | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 11 | NC_009154.3:g.15474228C>G | NM_001081761.1:c.4248C>G | NP_001075230.1:p.(F1416L) | NM_001081761.1; NP_001075230.1; ECA11 (NC_009154.3) g.15474228C>G; NM_001081761.1: c.4248C>G; NP_001075230.1: F1416L; Sift Score 0.01. The above information (from which the coordinate fields were populated) was provided by Tatyana German and Meredith O’Connell, working under the supervision of Professor Ernie Bailey. | rs1148998534 | 1992 | 1338908 | |
| 1077 | OMIA:002194-9615 | dog | Alpine Dachsbracke (Dog) | Ataxia, spinocerebellar, SCN8A-related | SCN8A | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 27 | NC_006609.3:g.3179029C>A | XM_022411523.1:c.4898G>T | XP_022267231.1:p.(G1633V) | 2019 | 31083464 | ||||
| 1526 | OMIA:002616-9615 | dog | Mixed Breed (Dog) | Congenital insensitivity to pain | SCN9A | substitution | missense | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 36 | NC_049257.1:g.11652662G>A | XM_038584713.1:c.2761C>T | XP_038440641.1:p.(R921C) | XM_038584713.1; XP_038440641.1 | 2023 | 36630088 | |||
| 990 | OMIA:002149-9913 | taurine cattle | Holstein (black and white) (Cattle) | Abortion due to haplotype HH6 | SDE2 | substitution | start-lost | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 16 | NC_037343.1:g.29020700A>G | NM_001099065.2:c.2T>C | NP_001092535.1:p.(M1?) | ENSBTAT00000016992.6:c.2T>C ENSBTAP00000016992.5:p.Met1? "This A-to-G transition changes the initiator ATG (methionine) codon to ACG because the gene is transcribed on the reverse strand. . . . Initiation of translation at the closest in-frame Met codon would truncate SDE2 by 83 amino acids, including an 8-amino acid motif conserved among eukaryotes" | rs434666183 | 2018 | 29680649 | ||
| 1540 | OMIA:002659-9615 | dog | Chihuahua (Dog) | Ichthyosis, non-epidermolytic | SDR9C7 | substitution | missense | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 10 | NC_049231.1:g.1471341G>A | XM_038549505.1:c.454C>T | XP_038405433.1:p.(R152W) | XM_038549505.1; XP_038405433.1 | 2023 | 36967672 | |||
| 1427 | OMIA:002531-74940 | Chinook salmon | XY female | sdY | substitution | missense | Naturally occurring variant | Not currently evaluated | p.(I183N) | 2022 | 35100376 | |||||||||
| 28 | OMIA:001692-9615 | dog | Finnish Hound (Dog) | Ataxia, cerebellar, progressive early-onset | SEL1L | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 8 | NC_006590.3:g.53778458A>G | XM_022422296.1:c.1972T>C | XP_022278004.1:p.(S658P) | 2012 | 22719266 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1819 | OMIA:002272-9796 | domestic horse | Thoroughbred (Horse) | Thrombasthenia, atypical | SEL1L | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 24 | NC_009167.3:g.26081856T>C | NM_001317264.1:c.1810A>G | NP_001304193.1:p.Ile604Val | 2025 | 40654876 | ||||
| 1334 | OMIA:002367-9615 | dog | Belgian Shepherd Dog (Dog) | CNS atrophy with cerebellar ataxia | SEPP1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 4 | g.66946539_66963863del | c.-6582_*516del | NM_001115118.1; ; 17325bp deletion includes the entire protein coding sequence of SELENOP (also called SEPP1) | 2021 | 34339417 | |||||
| 1581 | OMIA:001468-9615 | dog | Kerry Blue Terrier (Dog) | Multiple system degeneration | SERAC1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | 1 | c.1536G>A | p.(W512*) | XM_038654522.1; initially published in a conference proceeding by Guo et al. (2013) , coordinates in this table as reported by Stee et al. 2023 (PMID:37341581) | 2024 | 39596578 | |||||
| 1582 | OMIA:001468-9615 | dog | Chinese Crested (Dog) | Multiple system degeneration | SERAC1 | deletion, small (<=20) | splicing | Naturally occurring variant | Not currently evaluated | 1 | c.182+1_182+4del | XM_038654522.1; initially published in a conference proceeding by Guo et al. (2013) , coordinates in this table as reported by Stee et al. 2023 (PMID:37341581). Variant results in skipping of exon 4. | 2024 | 39596578 | ||||||
| 965 | OMIA:001897-9796 | domestic horse | Connemara Pony (Horse) | Hoof wall separation syndrome | SERPINB11 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 8 | NC_009151.3:g.83600643_83600644insC | XM_001491598.3:c.504_505insC | XP_001491648.1:p.(T169Hfs*3) | rs3447216148 | 2015 | 25875171 | FN thanks Daniel J. Schmidt, working under the supervision of Professor Ernie Bailey, for updating the coordinates to EquCab3.0. | ||
| 1812 | OMIA:002967-9615 | dog | English Springer Spaniel (Dog) Welsh Springer Spaniel (Dog) | Hyperfibrinolysis | SERPINE1 | duplication | frameshift | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 6 | NC_049227.1:g.8640592dup | NM_001197095.1:c.101dup | NP_001184024.1:p.(A35Gfs*56) | 2025 | 40470612 | ||||
| 25 | OMIA:001483-9615 | dog | Dachshund (Dog) | Osteogenesis imperfecta_Dachshund | SERPINH1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 21 | NC_006603.3:g.23033735A>G | XM_005633296.3:c.977T>C | XP_005633353.1:p.(L326P) | 2009 | 19629171 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1902 | OMIA:003058-9615 | dog | Jack Russell Terrier (Dog) | Ataxia, SETX-related | SETX | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 9 | NC_049230.1:g.52007169_52007170dup | XM_038548937.1:c.1160_1161dup | XP_038404865.1:p.(N388Lfs*9) | published as chr9:52007168C > CCT, updated in this table to HGVS nomenclature | 2026 | 42105303 | |||
| 1280 | OMIA:002305-9615 | dog | Dachshund, Miniature (Dog) | Muscular dystrophy, limb-girdle, type R3 | SGCA | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | NC_006591.3:g.26166312G>A | XM_005624636.3:c.224G>A | XP_005624693.1:p.(W75*) | 2021 | 33407862 | ||||
| 651 | OMIA:000162-10036 | golden hamster | Cardiomyopathy, dilated | SGCD | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | genomic deletion was found to be located at 6.1 kb 5' upstream of the second exon of δ-SG gene, and its 5' upstream region of more than 27.4 kb, including the authentic first exon of δ-SG gene, was deleted | 1997 | 9391120 | ||||||||||
| 652 | OMIA:002211-10036 | golden hamster | Cardiomyopathy, hypertrophic | SGCD | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | a large deletion in the delta-SG gene | 1997 | 9097966 | ||||||||||
| 802 | OMIA:002122-9615 | dog | Boston Terrier (Dog) | Muscular dystrophy, limb-girdle, type 2F | SGCD | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 4 | g.53353932_53353933del | c.534_535del | p.(E178Dfs*3) | XM_005619257.3; XP_005619314.1, published as c.534_535delGA | 2017 | 28702169 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 928 | OMIA:002122-9615 | dog | Boston Terrier (Dog) | Muscular dystrophy, limb-girdle, type 2F | SGCD | delins, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 4 | g.[53262018_53262020delinsCC;53262030_53281432del] | g.[53262018_53262020delinsCC;53262030_53281432del] | 2017 | 28702169 | ||||||
| 1612 | OMIA:002122-9615 | dog | Lagotto Romagnolo (Dog) | Limb-girdle muscular dystrophy, recessive | SGCD | substitution | missense | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 4 | NC_049225.1:g.54154870A>G | XM_038534930.1:c.725T>C | XP_038390858.1:p.(L242P) | XM_038534930.1; XP_038390858.1, variant detected in a single dog | 2023 | 37628692 | |||
| 1063 | OMIA:001279-9615 | dog | Scottish Deerhound (Dog) | Hypotrichosis, recessive | SGK3 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 29 | g.16351976_16351977insT | c.137_138insT | p.(E47Gfs*3) | NM_001190428.1; NP_001177357.1 | 2019 | 30927068 | Genomic position in CanFam3.1 provided by Mateo Etcheveste and Robert Kuhn. | ||
| 564 | OMIA:001279-9615 | dog | American Hairless Terrier (Dog) | Hypotrichosis, recessive | SGK3 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 29 | g.16366702_16366705del | c.287_290delTTAG | p.(V96Gfs*50) | 2017 | 27994129 | ||||
| 1482 | OMIA:002565-9913 | taurine cattle | Original Swiss Brown (Cattle) | Amastia, congenital | SGSH | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 19 | g.52427490C>T | c.425C>T | p.(T142M) | NM_001102189.2; NP_001095659.2 | 2022 | 35535008 | |||||
| 577 | OMIA:001309-9615 | dog | Huntaway (Dog) | Mucopolysaccharidosis IIIA | SGSH | insertion, small (<=20) | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | g.1544321_1544322insA | c.685_686insA | p.(Y229*) | NM_001003114.1; NP_001003114.1; published as c.708-709insA (which are mRNA and not cDNA coordinates) | 2002 | 11829484 | |||
| 954 | OMIA:001309-9615 | dog | Dachshund (Dog) | Mucopolysaccharidosis IIIA | SGSH | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | g.1544376_1544378delCCA | c.740_742delCCA | p.(T247del) | NM_001003114.1; NP_001003114.1; published as c.737_739delCCA; coordinates in the table have been updated in accordance with the HGVS 3' rule | 2000 | 10950929 | Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. | ||
| 1593 | OMIA:002740-9615 | dog | Golden Retriever (Dog) | Polyneuropathy, hypomyelinating, SH | SH3TC2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 4 | NC_049225.1:g.60798310C>T | XM_038535081.1:c.1924C>T | XP_038391009.1:p.(R642*) | XM_038535081.1; XP_038391009.1; reported in one affected dog with coordinates relating to a different transcript as XM_038568229.1:c.1479G>A | 2023 | 37400349 | |||
| 1444 | OMIA:000810-9615 | dog | Beagle (Dog) Belgian Shepherd Dog, Malinois (Dog) Cocker Spaniel (Dog) Huntaway (Dog) Lundehund (Dog) New Zealand Heading Dog (Dog) Poodle, Standard (Dog) Rottweiler (Dog) Schnauzer, Standard (Dog) Shetland Sheepdog (Dog) Shih Tzu (Dog) Yorkshire Terrier (Dog) | Dew claws | SHH | DC-2 | substitution | regulatory | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 16 | g.19380592C>T | Additional breeds based on PMID:40965331 | 2008 | 18689889 | Thank you to Heidi Anderson for suggesting to add this variant [8/4/2022] | |||
| 1445 | OMIA:000810-9615 | dog | Sapsari (Dog) Tosa (Dog) | Dew claws | SHH | DC-1 | substitution | regulatory | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 16 | g.19380829C>T | 2008 | 18689889 | Thank you to Heidi Anderson for suggesting to add this variant [8/4/2022] | ||||
| 836 | OMIA:000810-9031 | chicken | Polydactyly | SHH | substitution | regulatory | Naturally occurring variant | Not currently evaluated | GRCg6a | 2 | g.8553470G>T | published as "single SNP in a highly conserved cis-regulatory region of Sonic Hedgehog was significantly associated with polydactyly" | rs80659072 | 2010 | 20064842 | |||||
| 1455 | OMIA:002013-9796 | domestic horse | Shetland Pony (Horse) | Skeletal atavism | SHOX | Del-2 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | PAR | 60−80 kb deletion in the pseudoautosomal region (PAR) of chromosome X/Y; removing parts of the cytokine receptor-like factor 2 (CRLF2) gene located downstream of SHOX | 2016 | 27207956 | |||||||
| 686 | OMIA:002013-9796 | domestic horse | Shetland Pony (Horse) | Skeletal atavism | SHOX | Del-1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | PAR | 160−180 kb deletion in the pseudoautosomal region (PAR) of chromosome X/Y; removing the entire coding region of the short stature homeobox (SHOX) gene and parts of the cytokine receptor-like factor 2 (CRLF2) gene located downstream of SHOX | 2016 | 27207956 | |||||||
| 1098 | OMIA:002208-9615 | dog | Golden Retriever (Dog) | Eye malformation, congenital | SIX6 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 8 | NC_006590.3:g.35566504C>T | XM_547840.6:c.487C>T | XP_547840.3:p.(Q163*) | XM_547840.6:c.487C>T; XP_547840.3:p.(Gln163*) | 2019 | 31207931 | |||
| 222 | OMIA:002444-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Hydrallantois | SLC12A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 10 | g.62157819G>A | p.(P372L) | rs5334475056 | 2016 | 27613513 | ||||
| 1218 | OMIA:002279-9615 | dog | Belgian Shepherd Dog, Malinois (Dog) | Ataxia, spinocerebellar, SLC12A6-related | SLC12A6 | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 30 | g.774122_774125delinsCATCTCACTCAT | c.178_181delinsCATCTCACTCAT | p.(M60Hfs*14) | XM_014109414.2; XP_013964889.1; 12-bp insertion (CATCTCACTCAT) and a 4-bp deletion (ATGA) | 2019 | 31160700 | |||
| 642 | OMIA:001400-9615 | dog | Poodle, Miniature (Dog) | Osteochondrodysplasia | SLC13A1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 14 | g.60628774_60758561del | c.99+3353_*56671del | XM_005628770.1; a 129788bp deletion which "ablated all but the first exon of SLC13A1" | 2012 | 23300579 | |||||
| 506 | OMIA:001400-9940 | sheep | Texel (Sheep) | Chondrodysplasia, Texel | SLC13A1 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 4 | NC_040255.1:g.95624809del | XM_004008022.4:c.334del | Published as JN108880: g.25513delT / c.107delT. Position c.334delT based on ENSOARG00020003399 | 2012 | 22742499 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries: g.95624809delA; c.334delT. 210906 After confirming the g location with NCBI BLAST, FN deleted the A and T, to conform with HGVS notation. | ||||
| 578 | OMIA:001097-9615 | dog | Alaskan Husky (Dog) | Necrotising encephalopathy, subacute, of Leigh | SLC19A3 | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 25 | g.40417443delinsTTGCA | c.624delinsTGCAA | p.(Q208Hfs*13) | XM_022409850.1; XP_022265558.1; published as c.624 insTTGC, c.625 C>A; coordinates in the table have been updated to reflect HGVS nomenclature | 2013 | 23469184 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn. | ||
| 1250 | OMIA:001097-9615 | dog | Yorkshire Terrier (Dog) | Juvenile-onset necrotizing encephalopathy | SLC19A3 | delins, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 25 | g.40417857_40417862delinsN[35] | c.205_210delinsN[35] | p.(P69Ifs*45) | XM_022409850.1; XP_022265558.1; "a 35 bp insertion replacing 6 bp and thereby disturbing the correct reading frame" (Drögemüller et al., 2020) | 2020 | 33081289 | |||
| 811 | OMIA:002124-9796 | domestic horse | Paso Fino (Horse) | Tiger eye | SLC24A5 | Tiger-eye 2 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 1 | NC_009144.3:g.143129074_143129702del | published as a 628bp deletion: chr1:141660611–141661239; ENSECAT00000019866.1:c.875-340_1081 + 82del | 2017 | 28655738 | |||||
| 810 | OMIA:002124-9796 | domestic horse | Paso Fino (Horse) | Tiger eye | SLC24A5 | Tiger-eye 1 | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 1 | NC_009144.3:g.143145865A>T | XM_023618043.1:c.272A>T | XP_023473811.1:p.(F91Y) | rs5334475205 | 2017 | 28655738 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 1853 | OMIA:003026-9913 | taurine cattle | Porencephaly | SLC25A12 | Not currently evaluated | Unpublished | 2025 | Reference not in PubMed; see OMIA 003026-9913 for reference details | ||||||||||||
| 1262 | OMIA:002294-9615 | dog | Dutch Shepherd (Dog) | Inflammatory myopathy, SLC25A12-related | SLC25A12 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 36 | NC_006618.3:g.16219219A>G | XM_535962.5:c.1046T>C | XP_535962.2:p.(L349P) | chr36:g.16,219,219A>G; c.1046T>C; p.L349P (Shelton et al., 2019) | 2019 | 31594244 | |||
| 1471 | OMIA:002294-9615 | dog | Nova Scotia Duck Tolling Retriever (Dog) | Cerebellar Degeneration-Myositis Complex | SLC25A12 | substitution | missense | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 36 | NC_049257.1:g.16504064G>A | XM_038584842.1:c.1337C>T | XP_038440770.1:p.(P446L) | XM_038584842.1:c.1337C>T; XP_038440770.1:p.(P446L) | 2022 | 35886006 | |||
| 992 | OMIA:002150-9913 | taurine cattle | Rouge des prés, France (Cattle) | Syndrome des veaux tourneurs (Turning calves syndrome) | SLC25A46 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 7 | g.109742796C>T | c.376C>T | p.(R126C) | rs5334475040 | 2017 | 28376083 | |||
| 937 | OMIA:001973-9615 | dog | Great Dane (Dog) | Ichthyosis, SLC27A4-related | SLC27A4 | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | g.55168916C>T | c.1250G>A | XM_548438.6; XP_548438.3; cDNA sequencing confirmed that a "new acceptor site is created by the A-allele ... that results in a shorter RNA product. ... affected dogs show aberrantly spliced transcript with an in-frame loss of the first 54 bp of exon 8" (Metzger et al., 2015) | 2015 | 26506231 | Genomic position in CanFam3.1 provided by Robert Kuhn and Mateo Etcheveste. | |||
| 1298 | OMIA:002416-8932 | rock pigeon | Pearl-eye | SLC2A11B | tr | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | AKCR02000030.1 | g.1895934G>A | p.(W49X) | Andrade et al. (2021): "This mutation creates a premature STOP codon in exon 3 of the likely canonical SLC2A11B transcript." | 2021 | 33621224 | |||||
| 626 | OMIA:000366-9913 | taurine cattle | Brown Swiss (Cattle) Holstein Friesian (Cattle) Original Swiss Brown (Cattle) Simmental (Cattle) Swiss Fleckvieh (Cattle) | Fanconi syndrome | SLC2A2 | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 1 | NC_037328.1:g.96472797_96472804delinsCATC | NM_001103222.1:c.772_779delinsCATC | NP_001096692.1:p.(L258fs*16) | Previously listed as c.771_778delinsCATC, updated to NCBI transcript [29/08/2024] | 2016 | 27169150 | Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 210909: FN changed c.771_778delTTGAAAAGinsCATC to c.771_778delinsCATC. Also, since the del is of 8 bp, the g. designation has been changed from g.97239973_97239976delTTGAAAAG (which encompasses a deletion of only 4bp) to g.97239973_97239980delinsCATC. Additional breed inforamtion based on PMID: 40312951 | ||
| 83 | OMIA:001033-9615 | dog | Dalmatian (Dog) German Hunting Terrier (Dog) Majorca Mastiff (Dog) | Urolithiasis | SLC2A9 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 3 | NC_006585.3:g.69456869G>T | NM_001130835.2:c.563G>T | NP_001124307.2:p.(C188F) | NM_001130835.2; NP_001124307.2; variant initially identified in Dalmatians and later reported in Majorca Mastiffs (PMID: 37582787) and German Hunting Terriers (PMID:39173651). | rs1152388406 | 2008 | 18989453 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 1707 | OMIA:002862-9940 | sheep | Manech Tête Rousse, France (Sheep) | Haplotype with homozygous deficiency, SLC33A1-related | SLC33A1 | MTRDHH2 | duplication | frameshift | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 1 | NC_040252.1:g.252649023dupG | XM_012100950.3:c.735dupG | XP_011956340.1:p.(R246Afs*3) | 2024 | 38922751 | |||
| 187 | OMIA:001340-9913 | taurine cattle | Holstein Friesian (Cattle) | Complex vertebral malformation | SLC35A3 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 3 | NC_037330.1:g.43261945C>A | NM_001105386.1:c.538G>T | NP_001098856.1:p.(V180F) | rs438228855 | 2006 | 16344554 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1181 | OMIA:001340-9913 | taurine cattle | Montbéliarde (Cattle) | de novo mutation in an AI sire | SLC35A3 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 3 | NC_037330.1:g.43268369G>T | NM_001105386.1:c.73C>A | NP_001098856.1:p.(R25S) | This variant was detected by Bourneuf et al. (2017) as a de novo mutation from an analysis of whole-genome-sequence of an AI Montbéliarde bull. No information was provided on the descendants of this bull. | rs5334475074 | 2017 | 28904385 | ||
| 152 | OMIA:001263-9796 | domestic horse | American Cream Draft (Horse) American Miniature Horse (Horse) American Paint (Horse) American Saddle Horse (Horse) Appaloosa (Horse) Kentucky Mountain Saddle, United States of America (Horse) Missouri Fox Trotting Horse (Horse) Quarter Horse (Horse) Tennessee Walking Horse (Horse) | Coat colour, champagne | SLC36A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 14 | NC_009157.3:g.26012449G>C | XM_023617382.1:c.188C>G | XP_023473150.1:p.(T63R) | rs5334475190 | 2008 | 18802473 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 263 | OMIA:001828-9913 | taurine cattle | Montbéliarde (Cattle) Vorderwälder, Germany (Cattle) | Abortion due to haplotype MH2 | SLC37A2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 29 | NC_037356.1:g.28510651C>T | NM_001024486.1:c.34C>T | NP_001019657.1:p.(R12*) | rs5358558602 | 2013 | 23762392 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 411 | OMIA:002244-9615 | dog | Cairn Terrier (Dog) Scottish Terrier (Dog) West Highland White Terrier (Dog) | Craniomandibular osteopathy | SLC37A2 | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 5 | g.9387327G>A | c.1332C>T | XM_005619600.3:c.1332C>T (Letko et al., 2020) | 2016 | 27187611 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1158 | OMIA:002244-9615 | dog | Basset Hound (Dog) | Craniomandibular osteopathy | SLC37A2 | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 5 | NC_006587.3:g.9387071C>T | XM_005619600.3:c.1446+1G>A | NC_006587.3:g.9387071C>T; XM_005619600.3:c.1446+1G>A (Letko et al., 2020) | 2020 | 32033218 | ||||
| 372 | OMIA:000593-9913 | taurine cattle | Holstein Friesian (Cattle) | Acrodermatitis enteropathica | SLC39A4 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD2 | 14 | NC_037341.1:g.537517G>A | NM_001046067.1:c.1645+1G>A | "a single nucleotide mutation of the splice donor site in intron 10" | rs5334475080 | 2006 | 16714095 | |||
| 1354 | OMIA:000593-9685 | domestic cat | Turkish Van (Cat) | Acrodermatitis enteropathica | SLC39A4 | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | F2 | NC_058385.1:g.83034002C>G | XM_004000173.4:c.1057G>C | XP_004000222.2:p.(G353R) | rs5334475163 | 2021 | 34573291 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 526 | OMIA:000256-9615 | dog | Labrador Retriever (Dog) | Cystinuria, type I - A | SLC3A1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 10 | g.46700948del | c.350del | p.(G117Afs*41) | NM_001003109.1; NP_001003109.1; published as c.350delG | 2013 | 24001348 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 527 | OMIA:001879-9615 | dog | Australian Cattle Dog (Dog) | Cystinuria, type II - A | SLC3A1 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 10 | g.46725151_46725156del | c.1098_1103del | p.(T367_T368del) | NM_001003109.1; NP_001003109.1; published as c.1095_1100delCACCAC; p.(T366_T367del); coordinates in the table have been updated to a recent reference genome and / or transcript | 2013 | 24001348 | Genomic position in CanFam3.1 provided by Robert Kuhn and Mateo Etcheveste. | ||
| 268 | OMIA:000256-9615 | dog | Newfoundland (Dog) | Cystinuria, type I - A | SLC3A1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 10 | NC_006592.3:g.46706001C>T | NM_001003109.1:c.586C>T | NP_001003109.1:p.(R196*) | 2000 | 11129328 | Genomic coordinates obtained from EBI's Variant Effect Predictor | |||
| 1542 | OMIA:000256-9615 | dog | English Bulldog (Dog) French Bulldog (Dog) | Cystinuria, type I - A | SLC3A1 | haplotype | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 10 | NC_006592.3:g.[46705989A>G;46735617A>G] | NM_001003109.1:c.[574A>G;2092A>G] | NP_001003109.1:p.[(I192V);(S696G)] | Several studies report an association between the two variants and cystinuria. | 2006 | 16845473 | ||||
| 141 | OMIA:000256-9685 | domestic cat | Domestic Shorthair (Cat) | Cystinuria, type I - A | SLC3A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A3 | NC_058370.1:g.64071673C>T | XM_003983937.6:c.1342C>T | XP_003983986.3:p.(R448W) | rs5334475150 | 2015 | 25417848 | The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1839 | OMIA:003020-9913 | taurine cattle | Holstein Friesian (Cattle) | Caudal and thoracic vertebral and viscerocranial malformation | SLC40A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.6785954T>A | NM_001077970.1:c.323T>A | NP_001071438.1:p.(I108N) | 2025 | 40999323 | ||||
| 746 | OMIA:001821-8090 | Japanese medaka | Coat colour, albinism, oculocutaneous type IV | slc45a2 | complex rearrangement | Naturally occurring variant | Not currently evaluated | an inversion of 167 bp, an insertion of 48 bp, and a deletion of 172 bp | 2008 | 18245373 | ||||||||||
| 386 | OMIA:000370-93934 | Japanese quail | Feather colour, albinism, sex-linked, imperfect | SLC45A2 | substitution | splicing | Naturally occurring variant | Not currently evaluated | a splice-site mutation in the SLC45A2 gene: "a G>T transversion at the splice acceptor site just preceding exon 4" | 2007 | 17151254 | |||||||||
| 1641 | OMIA:000370-232655 | Alexandrine parakeet | Feather colour, yellow | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.1195G>A | p.(G399R) | 2024 | 37943814 | ||||||||
| 1643 | OMIA:000370-9228 | Rose-ringed parakeet | Feather colour, yellow or white | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.1195G>A | p.(G399R) | 2024 | 37943814 | ||||||||
| 1644 | OMIA:000370-9228 | Rose-ringed parakeet | Feather colour, yellow or white | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.1400G>T | p.(G467V) | 2024 | 37943814 | ||||||||
| 1642 | OMIA:000370-9228 | Rose-ringed parakeet | Feather colour, yellow | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.158C>T | p.(P53L) | 2024 | 37943814 | ||||||||
| 259 | OMIA:000370-93934 | Japanese quail | Feather colour, cinnamon | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.287C>A | p.(A72D) | 2007 | 17151254 | ||||||||
| 1530 | OMIA:002628-215402 | northern snakehead | Skin colour, yellow | SLC45A2 | YM | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | 19 | c.383G>A | p.(W128*) | 2023 | 36789536 | ||||||
| 1640 | OMIA:000370-232655 | Alexandrine parakeet | Feather colour, yellow | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.539T>C | p.(L180P) | 2024 | 37943814 | ||||||||
| 1639 | OMIA:000370-232645 | Plum-headed parakeet | Feather colour, yellow | SLC45A2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.73G>T | p.(R25*) | 2024 | 37943814 | ||||||||
| 254 | OMIA:000213-74535 | Bengal tiger | Coat colour, white | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | C>T | p.(A477V) | 2013 | 23707431 | ||||||||
| 847 | OMIA:001821-9913 | taurine cattle | Brown Swiss (Cattle) | Coat colour, albinism, oculocutaneous type IV | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 20 | g.39790069G>A | c.134G>A | p.(R45Q) | Important note by Rothammer et al. (2017): "To determine which of the two mutations or even if the combination of both is causal for oculocutaneous albinism in Braunvieh, it would be necessary to produce additional cases and investigate them more precisely" | rs5334474931 | 2017 | 28982372 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 848 | OMIA:001821-9913 | taurine cattle | Brown Swiss (Cattle) | Coat colour, albinism, oculocutaneous type IV | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 20 | g.39824417C>T | c.1331C>T | p.(T444I) | Important note by Rothammer et al. 92017): "To determine which of the two mutations or even if the combination of both is causal for oculocutaneous albinism in Braunvieh, it would be necessary to produce additional cases and investigate them more precisely" | rs5334474883 | 2017 | 28982372 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 1846 | OMIA:001821-9913 | taurine cattle | Dexter (Cattle) | Coat colour, dilution (chocolate / cream) | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 20 | NC_037347.1: g.39790189A>C | XM_002696386.6: c.398A>C | XP_002696432.2: p.(Q133P) | 2025 | 41101985 | ||||
| 1761 | OMIA:001821-9940 | sheep | Suffolk (Sheep) | Suffolk white fleece | SLC45A2 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v3.0 | 16 | NC_056069.1:g39966131_39966133del | XM_004017064.5:c.661_663del | XP_004017113.5:p.(F221del) | 2025 | 39608806 | ||||
| 675 | OMIA:001821-9615 | dog | Doberman Pinscher (Dog) | Coat colour, albinism, oculocutaneous type IV | SLC45A2 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 4 | g.73867275_73871357del | c.1442_*3934del | NM_001037947.1; "a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4[ratio]77,062,968-77,067,051)" (g.27141_31223del; CanFam2.0) | 2014 | 24647637 | |||||
| 795 | OMIA:001821-9615 | dog | Bull Mastiff (Dog) | Coat colour, albinism, oculocutaneous type IV | SLC45A2 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 4 | NC_006586.3:g.73864860del | NM_001037947.1:c.1287del | NP_001033036.1:p.(M430Cfs*4) | NM_001037947.1; NP_001033036.1; deletion C | 2017 | 28737247 | |||
| 92 | OMIA:001821-9615 | dog | Lhasa Apso (Dog) Mixed Breed (Dog) Pekingese (Dog) Pomeranian (Dog) | Coat colour, albinism, oculocutaneous type IV | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 4 | NC_006586.3:g.73867311G>A | NM_001037947.1:c.1478G>A | NP_001033036.1:p.(G493D) | NM_001037947.1 | 2015 | 25790827 | Genomic position in CanFam3.1 provided by Robert Kuhn | ||
| 1855 | OMIA:001821-9793 | ass (donkey) | Coat colour, cream dilution | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | EquAss-T2T_v2 | 10 | NC_091799.1:g.81796057C>T | XM_014831209.3:c.1601C>T | XP_014686695.1:p.(A534V) | published as c.1457C>T, p.A486V | 2025 | 41314234 | ||||
| 1140 | OMIA:001344-9796 | domestic horse | Traditional Gypsy Cob, United Kingdom of Great Britain and Northern Ireland (Horse) | Coat colour, snowdrop | SLC45A2 | C^sno | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 21 | NC_009164.3:g.31688649G>A | XM_001498110.4:c.449G>A | XP_001498160.2:p.(R150Q) | Bisbee et al. (2020): transcript ENSECAT00000026240.1 in the Ensembl EquCab2.0 assembly, previously listed as c.305G>A and p.(R102Q). Coordinates in this table are based on a recent reference genome and in accordance with HGVS recommendations. | rs5334475197 | 2020 | 31961951 | EquCab3.0 c. and p. coordinates kindly provided by Robin Everts. |
| 153 | OMIA:001344-9796 | domestic horse | Morgan (Horse) Quarter Horse (Horse) Welsh Pony (Horse) | Coat colour, cream dilution | SLC45A2 | C^Cr | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 21 | NC_009164.3:g.31690653G>A | XM_001498110.4:c.601G>A | XP_001498160.2:p.(D201N) | Variant published as equCab3 chr21:g. 31,690,653G>A exon 2 c.457G>A p.Asp153Asn; coordinates in this table are based on a recent reference genome and in accordance with HGVS recommendations. | rs1140980396 | 2003 | 12605854 | EquCab3.0 g. coordinates obtained from Table S2 of Holl et al. (2019); c. and p. coordinates kindly provided by Robin Everts. Breed information updated based on PMID: 38600096 |
| 1074 | OMIA:001344-9796 | domestic horse | Standardbred x Tennessee Walking Horse cross (Horse) | Coat colour, sunshine | SLC45A2 | C^sun | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 21 | NC_009164.3:g.31705404G>A | XM_001498110.4:c.712G>A | XP_001498160.2:p.(G238R) | Variant published as equCab3 chr21:g. 31,705,368G>A exon 3 c.568G>A p.Gly190Arg; genomic coordinates in OMIA were previously incorrectly listed as EquCab3.0 chr21 g.31705726G>A and corrected based on feedback from Robin Everts [12/04/2024]. Coordinates in this table are based on a recent reference genome and in accordance with HGVS recommendations. | rs394940514 | 2019 | 31006892 | EquCab3.0 g., c. and p. kindly provided by Robin Everts. |
| 1069 | OMIA:001344-9796 | domestic horse | American Paint (Horse) Lusitanian (Horse) Purebred Spanish (Horse) Quarter Horse (Horse) | Coat colour, pearl | SLC45A2 | C^prl | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 21 | NC_009164.3:g.31709690G>A | XM_001498110.4:c.1129G>A | XP_001498160.2:p.(A377T) | Variant published as equCab3 chr21:g. 31,709,654G>A exon 4 c.985G>A p.Ala329Thr; coordinates in this table are based on a recent reference genome and in accordance with HGVS recommendations. | rs3101690631 | 2019 | 30968968 | EquCab3 g. coordinate kindly provided by Natalia Sevane; c. and p. coordinates kindly provided by Robin Everts. |
| 861 | OMIA:001821-9593 | western gorilla | Coat colour, albinism, oculocutaneous type IV | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | gorGor3.1 | 17 | g.59753498G>C | c.1552G>C | p.(G518R) | 2013 | 23721540 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||||
| 9 | OMIA:000370-9031 | chicken | Feather colour, silver | SLC45A2 | S*S | substitution | missense | Naturally occurring variant | Not currently evaluated | GRCg6a | Z | NC_006127.5:g.10336596G>T | NM_001083364.2:c.1039C>A | NP_001076833.2:p.(L347M) | rs314509501 | 2007 | 17151254 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 10 | OMIA:000370-9031 | chicken | White Leghorn (Chicken) | Feather colour, silver | SLC45A2 | S*S | substitution | missense | Naturally occurring variant | Not currently evaluated | GRCg6a | Z | NC_006127.5:g.10340909T>C | NM_001083364.2:c.830A>G | NP_001076833.2:p.(Y277C) | rs315357427 | 2007 | 17151254 | Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool | |
| 1894 | OMIA:000370-9031 | chicken | Iris depigmentation, sex linked | SLC45A2 | deletion, gross (>20) | frameshift | Genome-editing (MAD7) | Not currently evaluated | GRCg6a | z | NC_006127.5:g.10344223_10344293del | NM_001083364.2:c.545_615del | NP_001076833.2:p.(K182fs) | 2026 | 41993716 | |||||
| 514 | OMIA:000370-9031 | chicken | Sex-linked imperfect albinism | SLC45A2 | S*AL | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | GRCg6a | Z | NC_006127.5:g.10345841del | NM_001083364.2:c.106del | NP_001076833.2:p.(S36fs) | 2007 | 17151254 | |||||
| 303 | OMIA:001228-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Spherocytosis | SLC4A1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.44069903G>A | NM_181036.2:c.1990C>T | NP_851379.1:p.(R664*) | rs5334475039 | 1996 | 8621763 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | ||
| 647 | OMIA:002443-9913 | taurine cattle | Angus (Cattle) Hereford (Cattle) Holstein (black and white) (Cattle) Simmental (Cattle) | Osteopetrosis | SLC4A2 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 4 | g.113638011_113640784del | "approximately 2.8-kb deletion mutation in affected calves that encompasses exon 2 and nearly half of exon 3" | 2010 | 20507629 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | |||||
| 575 | OMIA:001572-9615 | dog | Golden Retriever (Dog) | Golden Retriever PRA 1 | SLC4A3 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 37 | g.26145752_26145753insC | c.2601_2602insC | p.(E859Rfs*104) | Genomic coordinates in CanFam3.1 and EVA ID provided by Robert Kuhn | rs1152388421 | 2011 | 21738669 | NM_001289433.1; NP_001276362.1; one of 3 transcripts; second EVA ID for this variant rs852038699 is inconsistent with HGVS 3' rule | |
| 158 | OMIA:001578-9796 | domestic horse | Dales (Horse) Fell Pony (Horse) | Foal immunodeficiency syndrome in the Fell and Dales Pony | SLC5A3 | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 26 | NC_009169.3:g.31894278C>T | NM_001247992.1:c.1352C>T | NP_001234921.1:p.(P451L) | NM_001247992.1; NP_001234921.1; previously listed in OMIA as g.30660224G>T in EquCab2.0, c.1337G>T and published as p.(P446L); coordinates in the table have been updated to a recent reference genome and / or transcript | 2011 | 21750681 | Briana Moreno, working under the guidance of Professor Ernie Bailey, provided genomic coordinates in EquCab3.0 in April 2022 | ||
| 1037 | OMIA:002174-9615 | dog | Pekingese (Dog) Shih Tzu (Dog) | Congenital dyshormonogenic hypothyroidism with goiter | SLC5A5 | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 20 | NC_006602.3:g.45024672C>T | XM_541946.6:c.1172-1G>A | XM_541946.4; published as g.45024672G>A, predicted to be a splice site mutation leading to loss of exon 10 and a frameshift. | 2018 | 29777899 | Additonal breed information based on PMID:36848397. | |||
| 904 | OMIA:001451-9913 | taurine cattle | Belgian Blue (Cattle) | Congenital muscular dystonia 2 | SLC6A5 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 29 | g.24366560A>G | c.809T>C | p.(L270P) | rs3423560860 | 2008 | 18344998 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 638 | OMIA:001594-9615 | dog | Irish Wolfhound (Dog) | Hyperekplexia (Startle disease) | SLC6A5 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 21 | g.42583699_42587925del | c.-52_562+504del | XM_005633757.1; "a homozygous 4.2kb [4227bp] microdeletion encompassing exons 2 and 3" | 2011 | 21420493 | |||||
| 1080 | OMIA:001594-9615 | dog | Spanish Greyhound (Dog) | Hyperekplexia (Startle disease) | SLC6A5 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 21 | g.42612546_42612547del | c.1379_1380delCT | p.(S460Ffs*47) | XM_022407940.1; XP_022263648.1 | 2019 | 30847549 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn. | ||
| 1785 | OMIA:001594-9615 | dog | Old English Sheepdog (Dog) | Hyperekplexia (Startle disease) | SLC6A5 | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ROS_Cfam_1.0 | 21 | NC_051825.1:g.43733137del | XM_038429613.1:c.1300del | XP_038285541.1:p.(Q434Rfs13)* | Coordinates in the table are in accordance with Human Genome Variation Society recommendations (3'rule) and differ therefore from published coordinates. | 2025 | 40012122 | |||
| 1534 | OMIA:002645-9615 | dog | English Cocker Spaniel (Dog) English Springer Spaniel (Dog) | Paradoxical pseudomyotonia | SLC7A10 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ROS_Cfam_1.0 | 1 | NC_051805.1:g.119506784C>A | XM_038657580.1:c.126C>A | XP_038513508.1:p.(C42*) | 2023 | 36869603 | ||||
| 85 | OMIA:001880-9615 | dog | Miniature Pinscher (Dog) | Cystinuria, type II - B | SLC7A9 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 1 | NC_006583.3:g.119211938G>A | NM_001048109.1:c.964G>A | NP_001041574.1:p.(G322R) | NM_001048109.1; NP_001041574.1 | 2013 | 24001348 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn and Zoe Shmidt. | ||
| 142 | OMIA:002023-9685 | domestic cat | Cystinuria, type B | SLC7A9 | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | E2 | NC_058382.1:g.20068434G>A | XM_045046541.1:c.706G>A | XP_044902476.1:p.(D236N) | 2016 | 27404572 | Thank you to Heidi Anderson for feedback on a previous incorrect breed association for this variant. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||||
| 143 | OMIA:002023-9685 | domestic cat | Maine Coon (Cat) Maine Coon Polydactyl (Cat) Siamese (Cat) Siberian (Cat) Sphynx (Cat) | Cystinuria, type B | SLC7A9 | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | E2 | NC_058382.1:g.20069793T>A | XM_045046541.1:c.881T>A | XP_044902476.1:p.(V294E) | 2016 | 27404572 | Thank you to Heidi Anderson for feedback on a previous incorrect breed association for this variant. Additional breeds reported based on PMID:35709088. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 144 | OMIA:002023-9685 | domestic cat | Cystinuria, type B | SLC7A9 | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | E2 | NC_058382.1:g.20078992C>T | XM_045046541.1:c.1175C>T | XP_044902476.1:p.(T392M) | 2016 | 27404572 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||||
| 864 | OMIA:000142-9031 | chicken | Dong, an chicken, China (Chicken) Lushi, China (Chicken) | Blue eggshell | SLCO1B3 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 1 | "a ~4.2 kb [retroviral] EAV-HP insertion in the 5' flanking region of SLCO1B3" | 2013 | 23359636 | ||||||||
| 717 | OMIA:000142-9031 | chicken | Araucana (Chicken) | Blue eggshell | SLCO1B3 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 1 | A different location for the same insertion: "a ~4.2 kb [retroviral] EAV-HP insertion in the 5' flanking region of SLCO1B3" but 23bp upstream of where the insertion occurs in Chinese breeds Dongxiang and Lushi | 2013 | 23359636 | ||||||||
| 1608 | OMIA:002755-9940 | sheep | South Down (Sheep) | Congenital photosensitivity and hyperbilirubinaemia | SLCO1B3 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_v3.1 | 3 | NC_019460.1:g.193691915C>T | XM_012175224.1:c.1318G>A | XP_012030614.1:p.(G440R) | XM_012175224.1; XP_012030614.1 | 2018 | 29688779 | |||
| 1537 | OMIA:002651-499056 | Asian vine snakes | Skin colour, yellow | SMARCE1 | substitution | missense | Naturally occurring variant | Not currently evaluated | 4 | g.43233281C>T | c.58C>T | p.(P20S) | 2023 | 36895044 | ||||||
| 211 | OMIA:001824-9913 | taurine cattle | Holstein (black and white) (Cattle) | Abortion due to haplotype HH3 | SMC2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 8 | NC_037335.1:g.93753358T>C | XM_015472668.2:c.3404T>C | XP_015328154.1:p.(F1135S) | XM_015472668.2; XP_015328154.1 | rs456206907 | 2014 | 24667746 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | |
| 733 | OMIA:001551-9615 | dog | Brachycephaly | SMOC2 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 1 | "a long interspersed nuclear element (LINE-1) within the SPARC-related modular calcium binding (SMOC2) gene" | 2017 | 28552356 | |||||||||
| 1193 | OMIA:001795-9685 | domestic cat | Niemann-Pick disease, type A | SMPD1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | D1 | NC_058377.1:g.63262260G>A | XM_045038859.1:c.1017G>A | XP_044894794.1:p.(W339*) | 2020 | 32347185 | Genomic position in Felis_catus_9.0 provided by Joshua Khamis. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||||
| 557 | OMIA:002040-9913 | taurine cattle | Belgian Blue (Cattle) | Abortion (embryonic lethality), SNAPC4-related | SNAPC4 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | 11 | p.(L1227Afs*134) | 2016 | 27646536 | |||||||
| 415 | OMIA:002034-9615 | dog | Vizsla (Dog) | Cerebellar cortical degeneration, Hungarian Vizsla | SNX14 | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 12 | g.45530566C>T | c.26531G>A | 2016 | 27566131 | |||||
| 1546 | OMIA:002669-9685 | domestic cat | Domestic Shorthair (Cat) | Sebaceous gland dysplasia | SOAT1 | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | F1 | NC_058384.1:g.20914140G>A | XM_011291017.4:c.1531G>A | XP_011289319.1:p.(G511R) | 2023 | 37060467 | ||||
| 1420 | OMIA:001744-9940 | sheep | Elevated milk leukocytes count | SOCS2 | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 3 | g.139302270C>T | c.286C>T | p.(R96C) | Oar_v3.1 position g.129722200C>T, transcripts XM_027967202.1, ENSOART00020018904.1:c.286C>T ENSOARP00020015648.1:p.Arg96Cys | rs868996547 | 2015 | 26658352 | |||||
| 36 | OMIA:000263-9615 | dog | American Pit Bull Terrier (Dog) American Water Spaniel (Dog) Anatolian Shepherd Dog (Dog) Australian Shepherd (Dog) Bernese Mountain Dog (Dog) Border Collie (Dog) Borzoi (Dog) Boxer (Dog) Cavalier King Charles Spaniel (Dog) Chesapeake Bay Retriever (Dog) Collie (Dog) Collie Rough (Dog) Czechoslovakian Wolfdog (Dog) English Springer Spaniel (Dog) French Bulldog (Dog) German Shepherd Dog (Dog) Great Pyrenees (Dog) Hovawart (Dog) Huntaway (Dog) Irish Setter (Dog) Irish Wolfhound (Dog) New Zealand Heading Dog (Dog) Pembroke Welsh Corgi (Dog) Poodle (Dog) Poodle, Toy (Dog) Rhodesian Ridgeback (Dog) Romanian Mioritic Shepherd Dog (Dog) Rottweiler (Dog) Saint Bernard (Dog) Shetland Sheepdog (Dog) Shiloh Shepherd (Dog) Soft Coated Wheaten Terrier (Dog) Tibetan Terrier (Dog) White Swiss Shepherd Dog (Dog) Wire Fox Terrier (Dog) | Degenerative myelopathy | SOD1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 31 | NC_006613.3:g.26540342G>A | NM_001003035.1:c.118G>A | NP_001003035.1:p.(E40K) | NM_001003035.1; NP_001003035.1, additional breeds added based on PMID:38081509, PMID:39335301 and PMID: 37106965. PMID: 24524809: The A allele was detected in at least 1 representative from 124 breeds (not all listed in this table). Additional breeds based on PMID:40965331 and PMID:41830531 | rs853026434 | 2009 | 19188595 | ||
| 1302 | OMIA:002322-9615 | dog | Dutch Tulip Hound (Dog) | Paroxysmal dyskinesia, juvenile | SOD1 | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ROS_Cfam_1.0 | 31 | g.26654939delinsCAC | c.12delinsCAC | p.(K4Nfs*7) | NM001003035.1; NP_001003035.1; published p.(K4Dfs*6) updated to HGVS recommendation, genomic coordinates not available for CanFam3.1 | 2021 | 33677640 | |||
| 87 | OMIA:000263-9615 | dog | Bernese Mountain Dog (Dog) | Degenerative myelopathy | SOD1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ROS_Cfam_1.0 | 31 | NC_051835.1:g.26654979A>T | NM_001003035.1:c.52A>T | NP_001003035.1:p.(T18S) | NM_001003035.1; NP_001003035.1 | 2011 | 21848967 | |||
| 1182 | OMIA:002258-9913 | taurine cattle | Charolais (Cattle) | Lethality, SOWAHB-related | SOWAHB | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 6 | g.91735816G>T | p.(Q379K) | This variant was detected by Bourneuf et al. (2017) as a de novo mutation from an analysis of whole-genome-sequence of a Charolais AI bull. No information was provided on the descendants of this bull. | rs5334475088 | 2017 | 28904385 | |||
| 1065 | OMIA:002190-8932 | rock pigeon | Recessive red | SOX10 | e^1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | Domyan et al. (2014) reported a 7.5kb deletion that spans "a conserved enhancer element that drives Sox10 expression in melanocytes" | 2014 | 24508169 | |||||||||
| 1066 | OMIA:002190-8932 | rock pigeon | Recessive red | SOX10 | e^2 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | Domyan et al. (2014) reported a 2.5kb deletion that spans "a conserved enhancer element that drives Sox10 expression in melanocytes" | 2014 | 24508169 | |||||||||
| 661 | OMIA:001569-9031 | chicken | Dark brown/yellow plumage | SOX10 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | GRCg6a | 1 | g.51035106_51042744delinsGGTGCGGTGA | Gunnarsson et al. (2011): "an 8.3-kb deletion upstream of SOX10" Zhu et al. (2022): "the genome region from 51,035,106 bp to 51,042,744 bp is missing in LY [yellow] chickens, with this region showing a novel 10 bp insertion (GGTGCGGTGA)" | 2011 | 21210960 | |||||||
| 1367 | OMIA:002453-9823 | pig | Waardenburg syndrome | SOX10 | duplication | frameshift | Genome-editing (CRISPR-Cas9) | Not currently evaluated | Sscrofa11.1 | 5 | NC_010447.5:g.9892647dup | NM_001099933.1:c.321dup | NP_001093403.1:p.(K108Qfs*45) | 2016 | 26442986 | |||||
| 1366 | OMIA:002453-9823 | pig | Bama Xiang Zhu, China (Pig) | Waardenburg syndrome | SOX10 | substitution | missense | Chemical mutagenesis (ENU) | Not currently evaluated | Sscrofa11.1 | 5 | NC_010447.5:g.9892651A>T | NM_001099933.1:c.325A>T | NP_001093403.1:p.(R109W) | 2017 | 28639938 | ||||
| 758 | OMIA:000782-9031 | chicken | Japanese Game Bantam (Chicken) | Pea comb | SOX5 | repeat variation | Naturally occurring variant | Not currently evaluated | 1 | "Pea-comb is caused by a massive amplification of a duplicated sequence located near evolutionary conserved non-coding sequences in intron 1 of the gene encoding the SOX5 transcription factor." The pea-comb mutant phenotype results from large-scale amplification of this duplication: pea comb alleles typically have 20-40 copies of the duplicated sequence, which must be sufficient to interfere with transcription. | 2009 | 19521496 | ||||||||
| 1040 | OMIA:002175-9796 | domestic horse | Bashkir Curly (Horse) Missouri Fox Trotter, Germany (Horse) | Curly coat with/without hypotrichosis | SP6 | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 11 | NC_009154.3:g.24096309C>T | XM_023652659.1:c.1090G>A | XP_023508427.1:p.(G364S) | Thomer et al. (2018): "SP6; NC_009154.2:g.24022045C>T, ss3021042887" with respect to EquCab2. Updated coordinates in this entry obtained from EVA rs1095048852; 14 Mar 2019. Protein coordinates in this table previously inocrrectly shown as p.(D346N); corrected 13/06/2024. | rs1095048852 | 2018 | 29686323 | ||
| 206 | OMIA:001247-9913 | taurine cattle | Brown Swiss (Cattle) Original Swiss Brown (Cattle) | Spinal dysmyelination | SPAST | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 11 | g.14742184G>A | c.1964G>A | p.(R560Q) | rs445770480 | 2010 | 19714378 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1856 | OMIA:003028-9615 | dog | Poodle, Standard (Dog) | Retinal atrophy, cone-rod dystrophy | SPATA7 | deletion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 8 | NC_049229.1:g.60022583_60040453del | XM_038545497.1:r.1,314_1,629delins[g.60018954–60018990] | XP_038401425.1:p.(D361Efs*2) | 2025 | 41325489 | ||||
| 392 | OMIA:002435-9823 | pig | Sperm, short tail | SPEF2 | insertion, gross (>20) | splicing | Naturally occurring variant | Not currently evaluated | 16 | an inserted retrotransposon within an intron | 2006 | 16549801 | ||||||||
| 37 | OMIA:001318-9615 | dog | Mixed Breed (Dog) | Elliptocytosis | SPTB | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 8 | g.39170437G>A | c.6119C>T | p.(T2020M) | NM_001220481.1; NP_001207410.1; published as c.6384C>T and p.(T2110M); coordinates in the table have been updated to a recent reference genome and / or transcript | 2009 | 19228356 | |||
| 457 | OMIA:002092-9615 | dog | Beagle (Dog) | Ataxia, spinocerebellar, SPTBN2-related | SPTBN2 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 18 | g.50666027_50666034del | c.5855_5862del | p.(I1952Rfs*28) | XM_005631422.3; XP_005631479.1; published as chr18:53,691,704_53,691,711del (CanFam2); p.(G1952insRDRGQGRPLLLMHRHGAGAA); coordinates in the table have been updated to a recent reference genome and / or transcript and are updated to HGVS nomenclature | 2012 | 22781464 | |||
| 1149 | OMIA:002232-9823 | pig | Large White (Pig) | Myopathy, congenital, SPTBN4-related | SPTBN4 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 6 | NC_010448.4:g.48801281_48801296del | XM_021094394.1:c.5706_5721del | XP_020950053.1:p.(T1903fs) | Derks et al. (2019): ENSSSCP00000031537:p.Arg1902fs | 2019 | 31850074 | |||
| 659 | OMIA:001230-9796 | domestic horse | American Trotter (Horse) | XY sex reversal | SRY | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | Y | "at least the DNA-binding domain of the SRY gene was deleted from the Y chromosome of the XY mare" | 1995 | 7558880 | ||||||||
| 920 | OMIA:001230-9913 | taurine cattle | Holstein Friesian (Cattle) Japanese Black, Japan (Cattle) Jersey (Cattle) | Ovotesticular DSD (Disorder of Sexual Development) | SRY | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | Y | A deletion of the SRY gene | 1996 | 8978769 | ||||||||
| 354 | OMIA:002096-9796 | domestic horse | Akhal-Teke (Horse) | Naked foal syndrome | ST14 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 7 | NC_009150.3:g.39710628G>T | XM_005611718.2:c.388G>T | XP_005611775.1:p.(E130*) | rs5334475187 | 2017 | 28235824 | (FN thanks Emily Rogers for providing the genomic location (determined using BLAT with the XM_005611718.2 sequence against Equcab 3.0) and the sequence refs for the cDNA and protein variants, working under the supervision of Professor Ernie Bailey; 24 April 2020) | ||
| 1425 | OMIA:002526-9685 | domestic cat | Alimentary lymphoma, inducer of | STAT5B | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | E1 | NC_058381.1:g.40866763T>G | XM_045044630.1:c.1924A>C | XP_044900565.1:p.(N642H) | SOMATIC MUTATION | 2021 | 34680385 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 1527 | OMIA:002623-9615 | dog | Australian Shepherd (Dog) | Primary ciliary dyskinesia, STK-related | STK36 | substitution | splicing | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 37 | NC_049258.1:g.25167072G>A | XM_038585732.1:c.2868-1G>A | XP_038441660.1:p.(M957Pfs*11) | XM_038585732.1; XP_038441660.1 | 2023 | 36786090 | |||
| 700 | OMIA:001297-9615 | dog | Norwegian Elkhound (Dog) | Early retinal degeneration | STK38L | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 27 | "a SINE insertion in exon 4 of the canine STK38L/NDR2 gene. The mutation removes exon 4 from STK38L transcripts" | 2010 | 20887780 | ||||||||
| 438 | OMIA:001356-9796 | domestic horse | Coat colour, grey/gray (slow greying) | STX17 | G2 | repeat variation | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 25 | NC_009168.3:g.6625295_6629872dup | two tandom copies of a 4.6kb intronic region in STX17, which increase the expression of both STX17 and a neighbouring gene NR4A3 | 2008 | 18641652 | ||||||
| 1732 | OMIA:001356-9796 | domestic horse | Coat colour, grey/gray (fast greying) | STX17 | G3 | repeat variation | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 25 | NC_009168.3:g.6625295_6629872[3] | three tandom copies of a 4.6kb intronic region in STX17 which increase the expression of both syntaxin-17 and a neighbouring gene NR4A3 | 2024 | 39209879 | ||||||
| 1438 | OMIA:002537-9541 | crab-eating macaque | Encephalopathy, STXBP1-related | STXBP1 | substitution | missense | Base-editing | Not currently evaluated | Macaca_fascicularis5.0 | 15 | g.101106196C>T | c.875G>A | p.(R292H) | XM_005582167.2; XP_005582224.1 | 2022 | 35283272 | ||||
| 214 | OMIA:001960-9913 | taurine cattle | Simmental (Cattle) | Abortion due to haplotype FH4 | SUGT1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 12 | NC_037339.1:g.11102143A>G | NM_001046203.2:c.949T>C | NP_001039668.1:p.(W317R) | rs110793536 | 2015 | 25927203 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 587 | OMIA:000059-9913 | taurine cattle | Brown Swiss (Cattle) | Arachnomelia, BTA5 | SUOX | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 5 | g.57316723_57316724insG | c.363_364insG | p.(A124Gfs*42) | rs5334475086 | 2010 | 20865119 | Variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 970 | OMIA:001373-9615 | dog | Greyhound (Dog) | Nasal parakeratosis | SUV39H2 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 2 | g.21731812_21731815del | c.996+3_996+6del | XM_005617114.3; deletion AAGT | 2018 | 29423952 | |||||
| 86 | OMIA:001373-9615 | dog | Labrador Retriever (Dog) | Nasal parakeratosis | SUV39H2 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 2 | NC_006584.3:g.21731842A>C | XM_005617114.3:c.972T>G | XP_005617171.1:p.(N324K) | XM_005617114.3; XP_005617171.1 | rs851549203 | 2013 | 24098150 | ||
| 1668 | OMIA:002829-9823 | pig | Porcine circovirus type 2, association with reduced viral load | SYNGR2 | Naturally occurring variant | Not currently evaluated | Sscrofa 11.1 | 12 | g.3797515A>G | c.186T>C | p.(R63C) | XM_021066554.1; XP_020922213.1 | rs3473454700 | 2018 | 30379811 | |||||
| 1132 | OMIA:002219-9685 | domestic cat | Domestic Shorthair (Cat) | Hypogonadotropic hypogonadism, TAC3-related | TAC3 | substitution | missense | Naturally occurring variant | VUS | F.catus_Fca126_mat1.0 | B4 | NC_058374.1:g.83380534C>T | XM_003988924.6:c.220G>A | XP_003988973.1:p.(V74M) | 2019 | 31615056 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 1051 | OMIA:002180-9823 | pig | Duroc (Pig) | Embryonic lethality | TADA2A | substitution | splicing | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 12 | NC_010454.4:g.38922102G>A | splice-donor mutation causing retention of intron 13 or exon skipping of exon 13 (Derks et al., 2019) | rs5334475174 | 2019 | 30875370 | ||||
| 668 | OMIA:001617-32536 | cheetah | Sweet taste, lack | TAS1R2 | reference sequence allele | Naturally occurring variant | Not currently evaluated | "a 247-base pair microdeletion in exon 3 and stop codons in exons 4 and 6" | 2005 | 16103917 | ||||||||||
| 670 | OMIA:001617-9694 | tiger | Sweet taste, lack | TAS1R2 | reference sequence allele | Naturally occurring variant | Not currently evaluated | "a 247-base pair microdeletion in exon 3 and stop codons in exons 4 and 6" | 2005 | 16103917 | ||||||||||
| 650 | OMIA:001617-9685 | domestic cat | Sweet taste, lack of | TAS1R2 | reference sequence allele | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | C1 | F.catus_Fca126_mat1.0 | the TAS1R2 gene in cats, tigers and cheetahs has "a 247-base pair microdeletion in exon 3 and stop codons in exons 4 and 6 ... cat Tas1r2 is an unexpressed pseudogene" | 2005 | 16103917 | |||||||
| 1122 | OMIA:002213-9447 | Ring-tailed lemur | Bitter taste | TAS2R16 | substitution | missense | Naturally occurring variant | Not currently evaluated | p.(S282L) | 2019 | 31161904 | |||||||||
| 1620 | OMIA:000240-8839 | Mallard | Crest cushion | TAS2R40 | substitution | regulatory | Naturally occurring variant | Not currently evaluated | 1 | published as variant in the 5′UTR of TAS2R40 (123272114_c. G78A) | 2023 | 37652165 | ||||||||
| 1277 | OMIA:001972-9793 | ass (donkey) | Coat colour, dun | TBX3 | D | insertion, small (<=20) | Naturally occurring variant | Not currently evaluated | ASM1607732v2 | 8 | NC_052184.1:42737976_42737977insT | Wang et al. (2020) report 'non-dun' as a "1 bp deletion (chr8:g.42742556 CT>C−) located ~18.6 kb downstream of the transcription start site of the TBX3 gene." The reference genome ASM1607732v2 represents the non-dun allele and information has been changed in the table to report the coordinates for the dun allele [05/06/2024] |
2020 | 33293529 | ||||||
| 1029 | OMIA:001972-9796 | domestic horse | Non-dun without primitive markings | TBX3 | nd2 | reference sequence allele | regulatory | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 8 | allele is represented by the reference genome EquCab3.0 | 2016 | 26691985 | [IT thanks Haley Rutstein, working under the guidance of Professor Ernie Bailey, for contributions to this entry in April 2024] | |||||
| 1701 | OMIA:001972-9796 | domestic horse | Curly Horse (Horse) Fjord (Horse) Icelandic Horse (Horse) Polish Konik (Horse) Quarter Horse (Horse) Vyatka (Horse) | Dun | TBX3 | D | haplotype | regulatory | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 8 | NC_009151.3:g.[20665796_20665797insCCTTCTGGC;20665807_20665808ins[1609]] | 2016 | 26691985 | [IT thanks Haley Rutstein, working under the guidance of Professor Ernie Bailey, for contributions to this entry in April 2024]. Additional breed information based on Stefaniuk-Szmukier et al. (2017) and Belousova et al. (2023). | ||||
| 1028 | OMIA:001972-9796 | domestic horse | American Trotter (Horse) Arab (Horse) Curly Horse (Horse) Faeroes Pony (Horse) Gotland Pony (Horse) Mongolian (Horse) Quarter Horse (Horse) Shetland Pony (Horse) Swedish Warmblood (Horse) Vyatka (Horse) | Non-dun with primitive markings | TBX3 | nd1 | haplotype | regulatory | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 8 | NC_009151.3:g.[20665796_20665797insCCTTCTGGC;20665807_20665808ins[1610]] | 2016 | 26691985 | [IT thanks Haley Rutstein, working under the guidance of Professor Ernie Bailey, for contributions to this entry in April 2024]. Additional breed information based on Belousova et al. (2023). | ||||
| 1210 | OMIA:000839-9031 | chicken | Feathered shanks | TBX5 | substitution | regulatory | Naturally occurring variant | Not currently evaluated | GRCg6a | 15 | g.12573054T>C | This SNP is 25kb upstream of the gene TBX5 (Bortoluzzi et al., 2020; Li et al. 2020) | rs3386894056 | 2020 | 32344431 32344429 | |||||
| 213 | OMIA:001951-9913 | taurine cattle | Holstein (black and white) (Cattle) | Vertebral and spinal dysplasia | TBXT | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 9 | NC_037336.1:g.101160274T>C | NM_001192985.1:c.196A>G | NP_001179914.1:p.(K66E) | rs5334475020 | 2015 | 25614605 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 79 | OMIA:000975-9615 | dog | Pembroke Welsh Corgi (Dog) | Bob tail | TBXT | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 1 | NC_006583.3:g.54192143G>C | NM_001003092.1:c.189C>G | NP_001003332.1:p.(I63M) | rs1152388402 | 2001 | 11252170 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 525 | OMIA:000975-9685 | domestic cat | American Bobtail (Cat) Manx (Cat) Pixiebob (Cat) | Tail, short | TBXT | MX^4 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B2 | NC_058372.1:g.148707058del | XM_003986708.4:c.1196del | XP_003986757.2:p.(P399Rfs*26) | published as c.1199delC and p.(P400Rfs*26); coordinates in the table have been updated to a recent reference genome and / or transcript and in accordance with HGVS 3'-rule | 2013 | 23949773 | Genomic position in Felis_catus_9.0 is based on information provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 524 | OMIA:000975-9685 | domestic cat | Manx (Cat) Pixiebob (Cat) | Tail, short | TBXT | MX^3 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B2 | NC_058372.1:g.148707087del | XM_003986708.4:c.1166del | XP_003986757.2:p.(P389Rfs*36) | published as c.1169delC and p.(P390Rfs*36); coordinates in the table have been updated to a recent reference genome and / or transcript and in accordance with HGVS 3'-rule | 2013 | 23949773 | Genomic position in Felis_catus_9.0 is based on information provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 523 | OMIA:000975-9685 | domestic cat | American Bobtail (Cat) Manx (Cat) Pixiebob (Cat) | Tail, short | TBXT | MX^1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B2 | NC_058372.1:g.148709037del | XM_003986708.4:c.995del | XP_003986757.2:p.(L332Pfs*22) | published as c.998delT and p.(L333Pfs*22); coordinates in the table have been updated to a recent reference genome and / or transcript | 2013 | 23949773 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 623 | OMIA:000975-9685 | domestic cat | Manx (Cat) Pixiebob (Cat) | Tail, short | TBXT | MX^2 | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B2 | NC_058372.1:g.[148709018_148709020del;148709021_148709037dup] | XM_003986708.4:c.[995_1011dup;1011_1014del] | XP_003986757.2:p.(A338Sfs*21) | published as c.998_1014dup17delGCC and p.(A339Sfs*21); coordinates in the table have been updated to a recent reference genome and / or transcript | 2013 | 23949773 | Genomic position in Felis_catus_9.0 is based on information provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 1578 | OMIA:000975-9940 | sheep | Tail, short | TBXT | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 8 | NC_040259.1:g.95879358C>A | XM_027972732.1:c.334G>T | XP_027828533.1:p.G112W | The gene is also called TBXT | 2018 | 35948368 29208649 | ||||
| 95 | OMIA:001975-9615 | dog | Spanish Water Dog (Dog) | Neuroaxonal dystrophy, juvenile | TECPR2 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 8 | NC_006590.3:g.70433320C>T | XM_022422394.1:c.4009C>T | XP_547986.3:p.(R1337W) | 2015 | 26555167 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 912 | OMIA:001673-9823 | pig | Large White, Finland (Pig) | Spermatogenic arrest | TEX14 | insertion, gross (>20) | splicing | Naturally occurring variant | Not currently evaluated | 12 | "a 51 bp insertion within exon 27, which caused differential splicing of the exon and created a premature translation stop codon" | 2011 | 22136159 | |||||||
| 963 | OMIA:001941-9913 | taurine cattle | Holstein (black and white) (Cattle) | Abortion due to haplotype HH5 | TFB1M | complex rearrangement | Naturally occurring variant | Not currently evaluated | 9 | "a deletion of 138kbp, spanning position 93,233kb to 93,371kb on chromosome 9 (BTA9), harboring only dimethyl-adenosine transferase 1 (TFB1M). The deletion breakpoints are flanked by bovine long interspersed nuclear elements Bov-B (upstream) and L1ME3 (downstream), suggesting a homologous recombination/deletion event." | 2016 | 27128314 | ||||||||
| 1619 | OMIA:002761-51751 | ball python | Skin colour, piebald | TFEC | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.493C>T | p.(R165*) | Coordinates based on a Python bivittatus assembly | 2023 | 36702128 | |||||||
| 295 | OMIA:000424-9913 | taurine cattle | Africander (Cattle) | Goitre, familial | TG | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 14 | NC_037341.1:g.8432343G>A | XM_025001401.1:c.1963C>T | XP_024857169.1:p.(R655*) | rs480120030 | 1987 | 3472203 | Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool | ||
| 264 | OMIA:000424-9925 | goat | Nederlandse Landgeit, Netherlands (Goat) | Goitre, familial | TG | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS1.2 | 14 | NC_030821.1:g.73537317C>G | XM_018058585.1:c.945C>G | XP_017914074.1:p.(Y315*) | Previously listed as p.(Y296*), coordinated updated to recent transcript | rs5334475116 | 1993 | 8380383 | The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries | |
| 1903 | OMIA:003059-9615 | dog | Rottweiler (Dog) | Hypothyroidism and dwarfism | TG | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 13 | NC_049234.1:g.29881970C>T | NM_001048104.1:c.3694C>T | NP_001041569.1:p.(R1232*) | 2026 | 42173671 | ||||
| 706 | OMIA:000546-9615 | dog | Jack Russell Terrier (Dog) | Ichthyosis | TGM1 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 8 | a LINE-1 insertion in the TGM1 gene | 2009 | 19438474 | ||||||||
| 1595 | OMIA:002370-9940 | sheep | North Country Cheviot (Sheep) | Motor neuron disease, TMCO6-related | TMCO6 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v2.0 | 5 | NC_056058.1:g.49438388_49438391del | XM_012178620.3:c.645_648del | XP_012034010.1:p.(L215Ffs*34) | XP_012034010.1 | 2023 | 37488055 | |||
| 1047 | OMIA:000303-9031 | chicken | White Leghorn (Chicken) | Dwarfism, autosomal | TMEM263 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | GRCg6a | 1 | g.53638233C>T | c.433G>A | p.(W59*) | Wu et al. (2018): "NM_001006244.1:c.433G > A . . . NP_001006244.1:p.(Trp59∗)" | 2018 | 29930570 | |||
| 1042 | OMIA:002176-9940 | sheep | Coopworth (Sheep) Perendale (Sheep) | Meckel-like hepatorenal fibrocystic dysplasia syndrome | TMEM67 | haplotype | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 9 | NC_040260.1:g.[91651651A>C;91651669A>T] | XM_012184130.2:c.[2042T>A;2060T>G] | XP_012039520.2:p.[(I681N);(I687S)] | Published as c.[2050T>A; 2068T>G] | rs1086155906; rs1088172192 | 2017 | 28487520 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 779 | OMIA:001902-9913 | taurine cattle | Simmental (Cattle) | Male subfertility | TMEM95 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 19 | g.27056843C>A | c.483C>A | p.(C161*) | rs378652941 | 2014 | 24391514 | Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | ||
| 13 | OMIA:001302-9031 | chicken | Resistance to avian sarcoma and leukosis viruses, subgroup B | TNFRSF10B | substitution | missense | Naturally occurring variant | Not currently evaluated | 22 | c.G>C | p.(C125S) | 2008 | 18094190 | |||||||
| 324 | OMIA:001302-9031 | chicken | Resistance to avian sarcoma and leukosis viruses, subgroup B | TNFRSF10B | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | GRCg6a | 22 | g.1418711C>T | c.172C>T | p.(Q58*) | rs736008824 | 2002 | 12097608 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1238 | OMIA:002285-9940 | sheep | Merino (Sheep) | Ovine congenital progressive muscular dystrophy | TNNT1 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 14 | NC_040265.1:g.66970247del | XM_027978800.1:c.746+1del | Published as "KT218690 c.614 + 1delG" (Clayton et al., 2020); Oar3.1 chr14: g.59556001delG and Oar4.0 chr14: g.59437065delG (Josh Clayton, pers comm., 7 Sep 2020) | 2020 | 32819427 | |||||
| 397 | OMIA:000162-9103 | turkey | Cardiomyopathy, dilated | TNNT2 | deletion, small (<=20) | splicing | Naturally occurring variant | Not currently evaluated | delGGGCTCCTC | 2002 | 11886865 | |||||||||
| 1279 | OMIA:002304-9685 | domestic cat | British Longhair (Cat) British Shorthair (Cat) Devon Rex (Cat) Maine Coon (Cat) Ragdoll (Cat) Sphynx (Cat) | Unknown significance | TNNT2 | substitution | Naturally occurring variant | VUS | Felis_catus_9.0 | F1 | g.42204052C>T | c.95-108G>A | This particular variant was a single base pair substitution (G to A) within intron 3, corresponding to c.95-108G > A of ENSFCAG00000004613 (McNamara et al., 2020). Based on the evidence provided by Schipper et al. (2022), this variant is now classified as having "unknown significance". For archival reasons, the variant remains in the OMIA variant table, but its "unknown significance" classification clearly indicates that, on the basis of current knowledge (2 June 2022), it "should not be used for breeding decisions regarding HCM" (Schipper et al., 2022). Additional breeds in which variant has been detected are based on PMID:38371598. | 2020 | 33304277 | |||||
| 1543 | OMIA:002663-9615 | dog | Weimaraner (Dog) | Dystonia–ataxia syndrome, paroxysmal | TNR | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 7 | g.23940980dup | c.831dup | p.(N278Qfs*38) | XM_038542431.1; XP_038398359.1; published as g.23940980dupC; c.831dupC | 2023 | 37023257 | |||
| 437 | OMIA:000175-9796 | domestic horse | Arab (Horse) Bashkir Curly (Horse) Quarter Horse (Horse) Trakehner (Horse) Welsh Pony (Horse) | Cerebellar abiotrophy | TOE1 | substitution | missense | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 2 | NC_009145.3:g.13122415C>T | XM_001496197.5:c.284G>A | XP_001496247.1:p:R95H | ENSECAT00000009202.3:c.541-13539C>T ENSECAT00000024892.2:c.284G>A ENSECAP00000020698.1:p.Arg95His A SNP "located in exon 4 of TOE1 and approximately 1200 base pairs upstream of MUTYH, adjacent to a possible binding site for the transcription factor GATA2" (Brault et al., 2011). EquCab3.1 coordinate provided by Meredith O’Connell, working under the supervision of Professor E. Bailey. Additional breeds added based on supplementary table 6 of Durward-Akhurst et al. (2024, PMID: 38600096). | rs397160943 | 2011 | 21126570 | ||
| 425 | OMIA:000536-9615 | dog | Spanish Water Dog (Dog) | Hypothyroidism | TPO | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 17 | g.773950_773951insG | c.39_40insG | p.(R14Efs*184) | NM_001003009.2; NP_001003009.2; the variant expands a stretch of 8 consecutive guanine residues to 9 guanine residues and introduces an early frameshift | 2013 | 23223904 | |||
| 273 | OMIA:000536-9615 | dog | Rat Terrier (Dog) Toy Fox Terrier (Dog) | Hypothyroidism | TPO | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 17 | NC_006599.3:g.784624C>T | NM_001003009.2:c.331C>T | NP_001003009.2:p.(Q111*) | 2003 | 12564727 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 50 | OMIA:000536-9615 | dog | Tenterfield Terrier (Dog) | Hypothyroidism | TPO | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 17 | NC_006599.3:g.799099C>T | NM_001003009.2:c.1777C>T | NP_001003009.2:p.(R593W) | NM_001003009.2 | 2012 | 23113744 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 407 | OMIA:000536-9615 | dog | French Bulldog (Dog) | Hypothyroidism | TPO | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 17 | NC_006599.3:g.801598T>C | NM_001003009.2:c.2242+2T>C | 2015 | 26478542 | |||||
| 138 | OMIA:000536-9685 | domestic cat | Domestic Shorthair (Cat) | Hypothyroidism | TPO | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A3 | NC_058370.1:g.139582244C>T | XM_045055112.1:c.1418G>A | XP_044911047.1:p.(A473T) | c. and p. previously listed as XM_006930524.4:c.1333G>A, XP_006930586.2:p.(A445T) - updated to recent NCBI transcript [09/07/2025] | 2015 | Reference not in PubMed; see OMIA 000536-9685 for reference details | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1485 | OMIA:000536-9685 | domestic cat | British Shorthair (Cat) Domestic Longhair (Cat) Domestic Medium Hair (Cat) Domestic Shorthair (Cat) Russian Blue (Cat) | Hypothyroidism | TPO | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A3 | NC_058370.1:g.139592392C>T | XM_045055112.1:c.514G>A | XP_044911047.1:p.(G172R) | c. and p. previously listed as XM_006930524.4:c.430G>A, XP_006930586.2:p.(G144R) - updated to recent NCBI transcript [09/07/2025] | 2022 | 36054182 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1519 | OMIA:001472-9823 | pig | Yucatan Miniature, United States of America (Pig) | Neuronal ceroid lipfuscinosis, 2 (CLN2) | TPP1 | not known | nonsense (stop-gain) | Transgenesis via viral vectors | Not currently evaluated | p.(R208*) | 2022 | 36100791 | ||||||||
| 1538 | OMIA:001472-9541 | crab-eating macaque | Neuronal ceroid lipofuscinosis, 2 | TPP1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | c.42delC | p.(L15Sfs*33) | 2023 | 36918063 | ||||||||
| 473 | OMIA:001472-9615 | dog | Dachshund (Dog) | Neuronal ceroid lipofuscinosis, 2 | TPP1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 21 | g.29925076del | c.325delC | p.(R108Gfs*6) | NP_001013869.1; NM_001013847.1, genomic coordinates in accordance with HGVS 3' rule | 2006 | 16621647 | |||
| 725 | OMIA:001341-9796 OMIA:002139-9796 | domestic horse | American Miniature Horse (Horse) Appaloosa (Horse) British Spotted Pony, Spotted Pony, United Kingdom of Great Britain and Northern Ireland (Horse) English Spotted Pony, Australia (Horse) Knabstrupper (Horse) Malopolski (Horse) Noric (Horse) Pony Of the Americas, Germany (Horse) Shetland Pony (Horse) Thoroughbred (Horse) | Stationary congenital night blindness & Leopard Complex/Appaloosa spotting | TRPM1 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | EquCab3.0 | 1 | NC_009144.3:g.109211964_109211965insN[1378] | "a 1378 bp retroviral LTR insertion in intron 1 of TRPM1", EquCab2.0: g.108297929_108297930insN[1378] | 2013 | 24167615 | Coordinates in EquCab3.0 kindly provided by Haley Rutstein, working under the guidance of Professor Ernie Bailey. | |||||
| 1682 | OMIA:002841-30538 | alpaca | Suri (Alpaca) | Fleece variation, Suri type | TRPV3 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | VicPac3.2 | 16 | NW_021964189.1:g.4265902G>T | XM_031685167.1:c.1423G>T | XP_031541027.1:p.(E475*) | 2024 | 38365607 | ||||
| 140 | OMIA:000319-9685 | domestic cat | American Curl (Cat) Minuet (Cat) Munchkin (Cat) Norwegian Forest Cat (Cat) Scottish Fold (Cat) Scottish Fold Longhair (Cat) | Ears, folded | TRPV4 | Fd | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | D3 | NC_058379.1:g.18723951C>A | XM_023241517.2:c.1024G>T | XP_023097285.2:p.(V342F) | 2016 | 27063440 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. Additional breeds added based on PMID:42108233 | ||
| 1130 | OMIA:002215-9615 | dog | Schnauzer, Standard (Dog) | Leukodystrophy, TSEN54-related | TSEN54 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 9 | NC_006591.3:g.5015506C>T | XM_540434.6:c.371G>A | XP_540434.3:p.(G124D) | XM_540434.6; XP_540434.3 | 2019 | 31584937 | |||
| 1339 | OMIA:002385-7950 | Atlantic herring | Spring spawning | tshr | Naturally occurring variant | Not currently evaluated | Ch_v2.0.2 | 15 | g.8906859C>A | c.1411C>A | p.(L471M) | cDNA position based on transcript ENSCHAT00000005367.1 | 2021 | 34172814 | ||||||
| 410 | OMIA:000542-9913 | taurine cattle | Pezzata Rossa Italiana, Italy (Cattle) | Hypotrichosis, streaked | TSR2 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | X | g.91964644A>G | c.441+226A>G | rs5334475030 | 2015 | 26203908 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | |||
| 949 | OMIA:001984-9615 | dog | Golden Retriever (Dog) | Golden Retriever PRA 2 | TTC8 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 8 | g.60090186del | c.669delA | p.(K223Rfs*15) | 2014 | 26401321 | ||||
| 345 | OMIA:002036-9913 | taurine cattle | Holstein Friesian (Cattle) | Abortion (embryonic lethality), TTF1 | TTF1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 11 | NC_037338.1:g.102463944G>A | NM_001102083.1:c.1579G>A | NP_001095553.1:p.(R527*) | rs715966442 | 2016 | 27646536 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1772 | OMIA:002922-9615 | dog | English Cocker Spaniel (Dog) | Retinopathy with vitamin E deficiency | TTPA | deletion, gross (>20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 29 | NC_049250.1:13696669_13696770del | XM_038579384.1:c.23_124del | XP_038435312.1:p.(P8_P41del) | 2025 | 39874248 | ||||
| 98 | OMIA:002434-9615 | dog | Cairn Terrier (Dog) Norfolk Terrier (Dog) | Thrombocytopaenia | TUBB1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 24 | NC_006606.3:g.43761303G>A | XM_022408906.1:c.5G>A | XP_022264614.1:p.(R2H) | XM_022408906.1; XP_022264614.1 | 2014 | 25060661 | Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. | ||
| 81 | OMIA:002434-9615 | dog | King Charles Spaniel (Dog) | Thrombocytopaenia | TUBB1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 24 | NC_006606.3:g.43766144G>A | XM_022408906.1:c.745G>A | XP_022264614.1:p.(D249N) | XM_022408906.1; XP_022264614.1 | rs1152388419 | 2008 | 18466252 | Sequence information used to identify the genomic location was kindly provided by Mary K Boudreaux. | |
| 776 | OMIA:001939-9913 | taurine cattle | Brown Swiss (Cattle) Original Swiss Brown (Cattle) Simmental (Cattle) | Haplotype with homozygous deficiency BH2 | TUBD1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 19 | g.10833921T>C | c.757T>C | p.(H210R) | rs383232842 | 2016 | 27225349 | Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | ||
| 1414 | OMIA:002515-9913 | taurine cattle | Brown Swiss (Cattle) | Haplotype with homozygous deficiency OH2 | TUBGCP5 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.1268426G>T | NM_001102495.1:c.311C>A | NP_001095965.1:p.(T104K) | NM_001102495.1 | rs720533878 | 2021 | 34915862 | ||
| 594 | OMIA:001593-9913 | taurine cattle | Charolais (Cattle) | Scurs, type 2 | TWIST1 | duplication | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 4 | NC_037331.1:g.27819577_27819586dup | NM_001191145.1:c.148_157dup | NP_001178074.1:p.(A56Rfs*87) | c.DNA position based on NM_001191145.1 | 2011 | 21814570 | Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. | ||
| 761 | OMIA:001469-9913 | taurine cattle | Belted Galloway (Cattle) Brown Swiss (Cattle) Dutch Belted (Cattle) Lakenvelder (Cattle) Yakutskii Skot, Russian Federation (Cattle) | Coat colour, white belt | TWIST2 | repeat variation | Naturally occurring variant | Not currently evaluated | 3 | "The belt-associated variant was a copy number variant (CNV) involving the quadruplication of a 6 kb non-coding sequence located approximately 16 kb upstream of the TWIST2 gene" (Awasthi Mishra et al., 2017) 200922: g. info moved to here (g.118,607,715-118,614,131) until it can be standardised "a quadruplication on bovine chromosome 3 between positions 118,608,362 and 118,614,132 bp" (UMD3.1) (Rothammer et al., 2018) | 2017 | 28658273 | ||||||||
| 666 | OMIA:000202-9669 | domestic ferret | Coat colour, albinism | TYR | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | "deletion of exon 4" | 2007 | 17655555 | ||||||||||
| 718 | OMIA:000369-9031 | chicken | Feather colour, recessive white | TYR | C*C | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 1 | a retroviral insertion in the tyrosinase gene | 2006 | 16457736 | ||||||||
| 723 | OMIA:000202-8090 | Japanese medaka | Skin colour, albinism | tyr | i1 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | a 1.9 kb fragment, corresponding to a novel transposable element (Tol1), has been inserted in exon 1 of the gene for tyrosinase | 1995 | 8552044 | |||||||||
| 1746 | OMIA:000202-8296 | axolotl | Skin colour, albino | TYR | deletion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | Linkage group 7 | "a 142 bp deletion of tyr a coding sequence at the end of exon 1 (extending ~3 kb in to intron 1) that results in a frame-shift and premature stop codon" (Woodcock et al., 2017) | 2017 | 28127056 | ||||||||
| 1829 | OMIA:000202-1960652 | red-necked wallaby | Albinism, oculocutaneous | TYR | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 2022 | 35030050 | |||||||||||
| 1027 | OMIA:000202-9773 | humpback whale | Migaloo, the white whale | TYR | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | "(264 del C) at codon 88" | 2012 | 22140253 | ||||||||||
| 1554 | OMIA:000202-8090 | Japanese medaka | Skin colour, albino (quasi-albino) | tyr | i4 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | a 4.7-kb insertion in exon 5 (Tol2-tyr) | 1996 | 8779712 | |||||||||
| 1555 | OMIA:000202-8090 | Japanese medaka | Skin colour, albino (weak) | tyr | i(b) | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | a 4.7-kb insertion in the 5' untranslated region (Tol2) | 2004 | 15016305 | |||||||||
| 1304 | OMIA:000202-3370412 | Japanese raccoon dog | Albinism | TYR | complex rearrangement | Naturally occurring variant | Not currently evaluated | Mae et al. (2020): "the third exon was removed due to a deletion ... :two separate regions of 3.8 kb and 7.3 kb had been removed, but a segment of 0.3 kb between these two regions was retained, though was present in the reverse orientation." | 2020 | 32783776 | ||||||||||
| 1162 | OMIA:000202-9557 | hamadryas baboon | Siamese coat colour pattern | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | p.(A365T) | ENSPANT00000015629.2:c.1093G>A; A0A096MRE4:p.(Ala365Thr) [Koga et al., 2020] | 2020 | 32053406 | ||||||||
| 813 | OMIA:000202-8410 | Japanese wrinkled frog | Albinism | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | c.1127G>A | p.(G376D) | 2018 | 28674275 | ||||||||
| 814 | OMIA:000202-8409 | dark-spotted frog | Albinism | TYR | insertion, small (<=20) | Naturally occurring variant | Not currently evaluated | c.1244_1245insT | 2018 | 28674275 | ||||||||||
| 332 | OMIA:000202-452646 | American mink | Albinism | TYR | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.138T>A | p.(C46*) | 2008 | 18822100 | ||||||||
| 812 | OMIA:000202-1772025 | Rice frog | Albinism | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | c.169G>A | p.(G57R) | 2018 | 28674275 | ||||||||
| 260 | OMIA:000202-452646 | American mink | Himalayan | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | c.1835C>G | p.(H420Q) | 2009 | 19308642 | ||||||||
| 1011 | OMIA:000202-9689 | lion | White lion | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | c.260G>A | p.(R87Q) | 2013 | 24045858 | ||||||||
| 1600 | OMIA:000202-9544 | Rhesus monkey | Coat colour, oculocutaneous albinism | TYR | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | 14 | c.552C>A | p.(S184*) | 2000 | 10751629 | |||||||
| 355 | OMIA:000202-9515 | Tufted capuchin | Coat colour, albinism | TYR | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.64C>T | p.(R22*) | 2017 | 28476152 | ||||||||
| 816 | OMIA:000202-8409 | dark-spotted frog | Albinism | TYR | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | c.682_684del | p.(L228del) | 2018 | 28674275 | ||||||||
| 1004 | OMIA:000202-10141 | domestic guinea pig | Coat colour, albinism | Tyr | substitution | missense | Naturally occurring variant | Not currently evaluated | c.710A>G | p.(D237G) | PRJEB26285 | 2018 | 29947431 | |||||||
| 1599 | OMIA:000202-9544 | Rhesus monkey | Coat colour, golden | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | 14 | c.768C>G | p.(H256Q) | 2023 | 37522525 | |||||||
| 815 | OMIA:000202-8409 | dark-spotted frog | Albinism | TYR | insertion, small (<=20) | Naturally occurring variant | Not currently evaluated | c.768_769insT | 2018 | 28674275 | ||||||||||
| 513 | OMIA:000369-9031 | chicken | Feather colour, albinism | TYR | C*A | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | 1 | c.817_822del6 | p.(D237_W238del) | 2000 | 10685888 | ||||||
| 1303 | OMIA:000202-31143 | Japanese ratsnake | Coat colour, oculocutaneous albinism | TYR | albino - pet trade | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | c.895C>T | p.(R299X) | 2018 | 30158334 | |||||||
| 1601 | OMIA:000202-9544 | Rhesus monkey | Coat colour, oculocutaneous albinism | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | 14 | c.934C>A | p.(L312I) | 2020 | 32259106 | |||||||
| 1594 | OMIA:000202-9901 | American bison | Oculocutaneous albinism type I (OCA1), TYR-related | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | 29 | g.7995584C>T | c.1114C>T | p.(G372R) | 2023 | 37481261 | ||||||
| 1851 | OMIA:000202-9913 | taurine cattle | Angus (Cattle) | Coat colour, albinism, oculocutaneous | TYR | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 29 | NC_037356.1:g.6389480C>G | NM_181001.3:c.1184+1G>C | 2026 | 42101288 | |||||
| 1830 | OMIA:000202-9913 | taurine cattle | Simmental (Cattle) | Coat colour, albinism, oculocutaneous | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD2.0 | 29 | NC_037356.1:g.6343738G>A | NM_181001.3:c.1283C>T | NP_851344.1:p.(P428L) | 2025 | 40913728 | ||||
| 589 | OMIA:000202-9913 | taurine cattle | Brown Swiss (Cattle) | Coat colour, albinism, oculocutaneous | TYR | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD2.0 | 29 | NC_037356.1:g.6424971_6424972insG | NM_181001.3:c.925_926insC | Insertion causes a frameshift that resulted in a premature stop codon at residue 316, whereas normal sequence contains 517 amino acids. | 2004 | 14727143 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |||
| 1789 | OMIA:000369-311895 | green‐cheeked parakeet | Feather colour, non-sex-linked lutino | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | ASM1176335v2 (GCA_011763355.2) | c.1111C>T | p.(H371Y) | 2025 | 40195888 | |||||||
| 151 | OMIA:000202-9793 | ass (donkey) | Coat colour, albinism | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | ASM1607732v2 | 20 | NC_052196.1:58132615G>C | XM_014827959.2:c.616C>G | XP_014683445.2:p.(H206D) | Published as c.604C>G, p.(H202D) - coordinates in the table were updated to reflect the recent reference genome |
2016 | 26763160 | ||||
| 1788 | OMIA:000369-60463 | Fischer's lovebird | Feather colour, non-sex-linked lutino | TYR | delins, small (<=20) | missense | Naturally occurring variant | Not currently evaluated | ASM3478289v1 (GCA_034782895.1) | c.736‐737TG>CT | p.(W246L) | 2025 | 40195888 | |||||||
| 1758 | OMIA:000202-9615 | dog | Mixed Breed (Dog) | Himalayan coat colour | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 21 | NC_006603.3:10893930G>A | NM_001002941.1:c.229C>T | NP_001002941.1:p.(R77W) | 2025 | 39709984 | ||||
| 1247 | OMIA:000202-9615 | dog | Dachshund (Dog) | Himalayan coat colour | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 21 | NC_006603.3:g.10893929C>T | NM_001002941.1:c.230G>A | NP_001002941.1:p.(R77Q) | NM_001002941.1; NP_001002941.1 | 2020 | 33039541 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 1159 | OMIA:000202-9860 | red deer | White | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | CerEla 1.0 | 2 | c.871G>A | p.(G291R) | 2020 | 32041521 | ||||||
| 349 | OMIA:000202-9685 | domestic cat | Albinism | TYR | c^2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | D1 | NC_058377.1:43927287G>A | XM_045038634.1:c.1204C>T | XP_044894569.1:p.(R402*) | |
rs5334475126 | 2017 | 27634063 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 1024 | OMIA:000202-9685 | domestic cat | Burmese (Cat) | Mocha | TYR | c^m | duplication | delins (in-frame) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | D1 | NC_058377.1:44012836_44012998dup | XM_045038634.1:c.820_936delinsAATCTC | XP_044894569.1:p.(I274_L312delinsNL) | published as NC_018732.3:chromosome D1:45898609_45898771dup, c.820_936delinsAATCTC (p.I274_L312delinsNL) | 2019 | 30716167 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 122 | OMIA:000202-9685 | domestic cat | Siamese (Cat) | Siamese coat colour pattern | TYR | c^s | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | D1 | NC_058377.1:44013031C>T | XM_045038634.1:c.904G>A | XP_044894569.1:p.(G302R) | published as c. 940G>A and p.(G302R) by Lyons et al. (2005) and p.(G301R) by Schmidt-Küntzel et al. (2005) | 2005 | 15771720 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |
| 494 | OMIA:000202-9685 | domestic cat | Coat colour, complete albinism | TYR | c | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | D1 | NC_058377.1:g.44012999del | XM_045038634.1:c.939del | XP_044894569.1:p.(S314Pfs*9) | published as "a cytosine deletion in TYR at position 975 in exon 2", HGVS 3' rule applied to g. coordinates | 2006 | 16573534 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 121 | OMIA:000202-9685 | domestic cat | Burmese (Cat) | Burmese coat colour pattern | TYR | c^b | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | D1 | NC_058377.1:g.44022819C>A | XM_045038634.1:c.679G>T | XP_044894569.1:p.(G227W) | Felis_catus_6.2: g.46406472C>A, Felis_catus 9.0: g.45907839C>A | rs5334475127 | 2005 | 15771720 | The genomic location on Felis_catus_9.0 and transcript information was based on Rodney et al. 2021 (PMID: 33785770). Updated to F.catus_Fca126_mat1.0 by Bella Bartner. |
| 247 | OMIA:000202-9986 | rabbit | New Zealand White (Rabbit) Zika, Hungary (Rabbit) | Coat colour, albinism | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | OryCun2.0 | 1 | NC_013669.1:g.127636997G>T | NM_001082077.1:c.1118C>A | NP_001075546.1:p.(T373K) | The OryCun2.0 reference genome is from a white rabbit and reflects the albino coat colour g.127636997T; NM_001082077.1 and NP_001075546.1 reflect the wildtype allele. | 2000 | 10920244 | |||
| 1520 | OMIA:000202-9986 | rabbit | Oculocutaneous albinism | TYR | substitution | missense | Base-editing | Not currently evaluated | OryCun2.0 | 1 | NC_013669.1:g.127650868T>C | NM_001082077.1:c.973A>G | NP_001075546.1:p.(T325A) | 2022 | 35282412 | |||||
| 1748 | OMIA:000369-9135 | common canary | Feather colour, pearl | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | serCan2020 | 1 | NC_066313.1:g.34568603C>A | XM_009102738.4:c.134C>A | XP_009100986.1:p.(P45H) | 2024 | 39377483 | |||||
| 329 | OMIA:000202-89462 | water buffalo | Murrah (Buffalo) | Albinism | TYR | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | UOA_WB_1 | 5 | NC_037549.1:g.82063942C>T | XM_006075179.2:c.1431G>A | XP_006075241.1:p.(W477*) | 2012 | 22817390 | ||||
| 1118 | OMIA:000202-9627 | red fox | Albinism | TYR | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | VulVul2.2 | NW_020356544.1 | g.7130732dup | c.365dup | p.(N122Kfs4*) | XM_026015193.1; XP_025870978.1; published as c.365dupA | 2019 | 31246286 | ||||
| 1255 | OMIA:001249-452646 | American mink | American Palomino coat colour | TYRP1 | b^p | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | "a large insertion of approximately eight kb. The insertion most likely disrupts different elements necessary for the splicing of intron 2 of the TYRP1 gene" (Cicera et al., 2016) | 2016 | 26886941 | |||||||||
| 1597 | OMIA:001249-9544 | Rhesus monkey | Coat colour, golden | TYRP1 | substitution | missense | Naturally occurring variant | Not currently evaluated | 15 | c.1028A>G | p.(N343G) | 2023 | 37522525 | |||||||
| 1598 | OMIA:001249-9544 | Rhesus monkey | Coat colour, golden | TYRP1 | substitution | missense | Naturally occurring variant | Not currently evaluated | 15 | c.1244T>C | p.(L415P) | 2023 | 37522525 | |||||||
| 753 | OMIA:002061-345164 | Saker falcon | Feather colour, light brown | TYRP1 | haplotype | splicing | Naturally occurring variant | Not currently evaluated | c.79C>T and c.79_80insT | in exon 1, resulting in "a frameshift change and a premature stop codon at position 81 of the deduced protein sequence, which in the wild-type form contains 536 amino acids. | 2017 | 27611661 | ||||||||
| 258 | OMIA:001322-93934 | Japanese quail | Feather colour, roux | TYRP1 | substitution | missense | Naturally occurring variant | Not currently evaluated | c.845T>C | p.(F282S) | 2007 | 18028514 | ||||||||
| 1713 | OMIA:001249-9691 | leopard | Coat colour, red | TYRP1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | XM_019415513:c.369del | XP_019271058:p.(G63Afs*6) | 2022 | 35782007 | ||||||||
| 1745 | OMIA:002817-8296 | axolotl | Skin colour, copper | TYRP1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | 6p | g.1225541490del | c.1156del | p.(G388Efs*28) | 2024 | 39333770 | ||||||
| 1518 | OMIA:001249-9643 | American black bear | Cinnamon coat colour | TYRP1 | substitution | missense | Naturally occurring variant | Not currently evaluated | HiC_scaffold_24 | g.6724152G>A | p.(R153C) | 2023 | 36528024 | |||||||
| 184 | OMIA:001249-9913 | taurine cattle | Dexter (Cattle) | Dun brown | TYRP1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 8 | NC_037335.1:g.31633328G>A | NM_174480.3:c.1300C>T | NP_776905.2:p.(H434Y) | rs3423268465 | 2003 | 12755816 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1059 | OMIA:001249-9925 | goat | Toggenburg (Goat) Valais Copperneck | Brown | TYRP1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS1.2 | 8 | NC_030815.1:g.31503165C>T | NM_001285727.1:c.1487G>A | NP_001272656.1:p.(G496D) | rs5334475101 | 2015 | 25392961 | The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries | ||
| 796 | OMIA:001249-9615 | dog | Brown | TYRP1 | b^d | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 11 | g.33326727_33326729del | c.1033_1035del | p.(P345del) | rs851422848 | 2002 | 12140685 | |||
| 31 | OMIA:001249-9615 | dog | Huntaway (Dog) | Brown | TYRP1 | b^c | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 11 | NC_006593.3:g.33317810T>A | XM_005626363.2:c.121T>A | XP_005626420.1:p.(C41S) | muptiple breeds, additional breeds based on PMID:40965331 | rs851939320 | 2002 | 12140685 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. Correction to genomic details provided by professor Claire Wade August 2018. Correction to g and c. details provided by Professor Tosso Leeb 11 Feb 2020. |
| 1282 | OMIA:001249-9615 | dog | Siberian Husky (Dog) | Brown | TYRP1 | b^h | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 11 | NC_006593.3:g.33317814G>A | NM_001194966.1:c.125G>A | XP_00562420.1:p.(C42Y) | NM_001194966.1, c.125G>A, p.Cys42Tyr (Van Buren et al., 2021) | 2021 | 33421162 | ||
| 797 | OMIA:001249-9615 | dog | Australian Shepherd (Dog) Huntaway (Dog) | Brown | TYRP1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 11 | NC_006593.3:g.33319349T>G | NM_005626363.2:c.555T>G | XP_00562420.1:p.(Y185*) | ROS_Cfam_1.0 g.34224397T>G ENSCAFT00845015439.1:c.555T>G ENSCAFP00845011991.1:p.Tyr185Ter, additional breeds based on PMID:40965331 | rs1152388483 | 2017 | 28497851 | ||
| 267 | OMIA:001249-9615 | dog | Huntaway (Dog) New Zealand Heading Dog (Dog) | Brown | TYRP1 | b^s | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 11 | NC_006593.3:g.33326685C>T | XM_005626363.2:c.991C>T | XP_005626420.1:p.(Gln331*) | multiple breeds, additional breeds based on PMID:40965331 | rs850566878 | 2002 | 12140685 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool |
| 1113 | OMIA:001249-9615 | dog | Lancashire Heeler (Dog) | Liver | TYRP1 | b^e | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 11 | NC_006593.3:g.33326719T>G | XM_005626363.2:c.1025T>G | XP_005626420.1:p.(F342C) | 2019 | 31468558 | |||
| 379 | OMIA:001249-9685 | domestic cat | Chocolate | TYRP1 | b | substitution | splicing | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | D4 | NC_058380.1:38142265G>A | NM_001042560.2:c.1261+5G>A | based on Lyons et al. (2005): c.1261+5G>A; based on Schmidt-Küntzel et al. (2005) this splice variant results in c.1261_1262insN[51^54]; p.(A420_D421insX[17^18]) and is inherited together with g.40068871C>G / c.8C>G / p.(A3G); F.catus_Fca126_mat1.0 and NM_001042560.2 represent the A allele | 2005 | 16104383 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 306 | OMIA:001249-9685 | domestic cat | Cinnamon (light brown) | TYRP1 | b^l | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | D4 | NC_058380.1:g.38130163C>T | NM_001042560.2:c.298C>T | NP_001036025.2:p.(R100*) | Felis_catus_9.0 reference sequence represents the T allele | 2005 | 16104383 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1057 | OMIA:001259-9031 | chicken | Orpington (Chicken) Wyandotte (Chicken) | Chocolate feathered | TYRP1 | substitution | missense | Naturally occurring variant | Not currently evaluated | GRCg6a | Z | g.30830300G>T | c.640C>A | p.(H214N) | 2019 | 30457703 | ||||
| 227 | OMIA:001249-9940 | sheep | Brown | TYRP1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 2 | c.2240C>G | p.(A???V) | 2013 | 23451726 | ||||||
| 1127 | OMIA:001249-9940 | sheep | Valais Red (Sheep) | Brown | TYRP1 | b^VS1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 2 | NC_040253.1:g.87540706_87540707del | NM_001130023.1:c.86_87del | NP_001123495.1:p.(E29Vfs*5) | NM_001130023.1: c.86_87delGA; NP_001123495.1: p.(Glu29ValfsTer5) | 2019 | 31571241 | 210906 to conform to HGVS notation, FN removed GA from g.87540706_87540707delGA and c.86_87delGA | |
| 226 | OMIA:001249-9940 | sheep | Soay (Sheep) | Tawny (light brown) | TYRP1 | b^Soay | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 2 | NC_040253.1:g.87545636G>T | NM_001130023.1:c.869G>T | NP_001123495.1:p.(C290F) | rs402624085 | 2007 | 17254985 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 1128 | OMIA:001249-9940 | sheep | Valais Red (Sheep) | Brown | TYRP1 | b^VS2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 2 | NC_040253.1:g.87549195C>T | NM_001130023.1:c.1066C>T | NP_001123495.1:p.(R356*) | NM_001130023.1: c.1066C>T; NP_001123495.1: p.(Arg356*) | rs1085637427 | 2019 | 31571241 | |
| 1058 | OMIA:001249-9986 | rabbit | Havanna (Rabbit) | Brown | TYRP1 | b | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | OryCun2.0 | 1 | g.41359827C>T | c.570G>A | p.(W190*) | NM_001297495.1; NP_001284424.1; published as g.41360196G>A, c.570G>A, p.Trp190ter but review of the genomic position suggests that the genomic location is OryCun2.0: chr1:41359827C>T | 2014 | 24814776 | ||
| 1791 | OMIA:001259-9228 | Rose-ringed parakeet | Feather colour, cinnamon | TYRP1 | substitution | missense | Naturally occurring variant | Not currently evaluated | P.krameri1.0 | c.691G>A | p.(E231K) | 2025 | 40195888 | |||||||
| 1790 | OMIA:001259-9228 | Rose-ringed parakeet | Feather colour, cinnamon | TYRP1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | P.krameri1.0 | c.86_95del | p.(C29fs*64) | 2025 | 40195888 | |||||||
| 508 | OMIA:001249-9823 | pig | Dahe, China (Pig) Tibetan, China (Pig) Wujin - Kele, China (Pig) Wujin - Liangshan, China (Pig) | Brown | TYRP1 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 1 | NC_010443.5:g.209726926_209726931del | NM_001025226.1:c.1484_1489del | NP_001020397.1:p.(M495_G496del) | Previously listed in OMIA as g.209726927_209726932del, corrected 29/01/2025 | rs5334475178 | 2011 | 20978532 | ||
| 404 | OMIA:001934-9913 | taurine cattle | Ayrshire, Finland (Cattle) | Ptosis, intellectual disability, retarded growth and mortality (PIRM) syndrome | UBE3B | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 17 | NC_037344.1:g.63668380C>T | NM_001206232.2:c.2076G>A | NP_001193161.1:p.(E692E) | ENSBTAT00000003493.5:c.2076G>A ENSBTAP00000003493.4:p.Glu692= | rs475678587 | 2014 | 25306138 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Variant rsID kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | |
| 1409 | OMIA:002298-9913 | taurine cattle | Jersey (Cattle) | Neuropathy with splayed forelimbs | UCHL1 | JNS | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 6 | g.60158901G>A | c.979G>A | p.(E327K) | Several transcripts are reported: ENSBTAT00000046823.2:c.718G>A ENSBTAP00000044075.1:p.Glu240Lys ENSBTAT00000066434.1:c.931G>A ENSBTAP00000063885.1:p.Glu311Lys ENSBTAT00000072800.1:c.979G>A ENSBTAP00000059848.1:p.Glu327Lys ENSBTAT00000074165.1:c.706G>A ENSBTAP00000057432.1:p.Glu236Lys | rs1116058914 | 2022 | 34955244 | |
| 931 | OMIA:001436-9823 | pig | Non-shivering thermiogenesis, absence of | UCP1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 8 | "exons 3 to 5 were eliminated by a deletion in the pig sequence" | 2006 | 16933999 | |||||||||
| 1228 | OMIA:002541-9685 | domestic cat | Munchkin (Cat) | Munchkin standard | UGDH | delins, gross (>20) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B1 | NC_058371.1:g.172171181_172174505delinsN[108] | Felis catus 9.0:NC_018726.3:g.174882895_174886198delins108 (Struck et al., 2020) | 2020 | 32605545 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||||
| 740 | OMIA:001586-9685 | domestic cat | Deficient acetaminophen glucuronidation | UGT1A6 | reference sequence allele | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | C1 | F.catus_Fca126_mat1.0 | "sequencing of the entire UGT1A6 exon 1 coding region revealed five deleterious genetic mutations ... [in cats] UGT1A6 is a pseudogene". UGT1A6 is a pseudogene in all cats - not to be used for diagnostic testing | 2000 | 10862526 | |||||||
| 290 | OMIA:000262-9913 | taurine cattle | Holstein (black and white) (Cattle) Holstein Friesian (Cattle) Red Holstein, Switzerland (Cattle) Wagyu (Cattle) | Deficiency of uridine monophosphate synthase | UMPS | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 1 | NC_037328.1:g.69151931C>T | NM_177508.1:c.1213C>T | NP_803474.1:p.(R405*) | rs5334474835 | 1993 | 8486364 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1157 | OMIA:001609-9615 | dog | German Longhaired Pointer (Dog) German Shorthaired Pointer (Dog) Vizsla (Dog) | Exfoliative cutaneous lupus erythematosus | UNC93B1 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 18 | NC_006600.3:g.49834825C>A | XM_540813.6:c.1438C>A | XP_540813.3:p.(P480T) | XM_540813.6:c.1438C>A; XP_540813.3:p.(Pro480Thr) (Leeb et al., 2020) | 2020 | 32028618 | |||
| 1053 | OMIA:002182-9823 | pig | Landrace (Pig) | Embryonic lethality | URB1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 13 | NC_010455.5:g.195977038del | XM_021069844.1:c.5995del | XP_020925503.1:p.(V1999fs) | published as 13:g.195977038delC; ENSSSCP00000036505:p.Val1961fs: "introduces 26 novel amino acids and a premature stop codon, producing a truncated protein of 1,986 amino acids, lacking the final 261 amino acids compared to the wild-type protein (2,247 AA)." | rs5334475182 | 2019 | 30875370 | ||
| 906 | OMIA:001176-9940 | sheep | Scottish Blackface (Sheep) | Porphyria cutanea tarda | UROD | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 1 | NC_040252.1:g.20327971T>C | NM_001012341.1:c.392T>C | NP_001012341.1:p.(L131P) | Oar_v3.1 position is g.19437840T>C; protein and cDNA positions are based on NP_001012341.1 and NM_001012341.1, respectively | rs429214636 | 2005 | 16026339 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 137 | OMIA:001175-9685 | domestic cat | Domestic Shorthair (Cat) | Porphyria, congenital erythropoietic | UROS | haplotype | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | D2 | NC_058378.1:g.[81231649C>T;81246195G>A] | XM_003994514.5:c.[140C>T;331G>A] | XP_003994563.1:p.[(S47F);(G111S)] | 2010 | 20485863 | Genomic position in Felis_catus_9.0 provided by Joshua Khamis, Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 1300 | OMIA:001216-9615 | dog | Australian Cattle Dog (Dog) Dalmatian (Dog) English Cocker Spaniel (Dog) German Shorthaired Pointer (Dog) Wirehaired Pointing Griffon (Dog) | Roan | USH2A | T^R | duplication | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 38 | Brancalion et al. (2021) "identified a duplicated DNA segment (11 398 bp) lying within the 67th intron of USH2A and spanning CFA38:11131841–11143239 (canfam3.1)". Kawakami et al. (2021) identified the same duplication: "an 11-kb tandem duplication (11,131,835–11,143,237)" | 2021 | 33539602 33755696 | ||||||
| 370 | OMIA:001431-9615 | dog | Pomeranian (Dog) | Vitamin D-deficiency rickets, type II | VDR | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 27 | g.6895070del | c.462del | p.(P155Lfs*40) | XM_038438367.1; XP_038294295.1; a single G deletion at the exon 4 / intron 4 junction; splicing is not affected, but the aberrant transcript contains a frameshift and premature stop codon; coordinates have been updated to recent reference sequence and differ from the publication | 2009 | 19909429 | |||
| 1843 | OMIA:001431-9685 | domestic cat | Domestic Shorthair (Cat) | Vitamin D-dependent rickets type 2 | VDR | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B4 | NC_058374.1:g.74665603G>A | XM_019834851.3:c.509C>T | XP_019690410.2:p.(P170L) | 2025 | 41083377 | ||||
| 1586 | OMIA:001431-9685 | domestic cat | Domestic Longhair (Cat) | Vitamin D-dependent rickets type 2 | VDR | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | B4 | NC_058374.1:g.74684169del | XM_019834851.3:c.106del | XP_019690410.2:p.(R36Efs*18) | published as c.106delC |
2023 | 37387221 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 15 | OMIA:000865-9031 | chicken | Restricted ovulator | VLDLR | substitution | missense | Naturally occurring variant | Not currently evaluated | Z | c.G>C | p.(C682S) | 1995 | 7568242 | |||||||
| 917 | OMIA:001947-9615 | dog | Eurasier (Dog) | Cerebellar hypoplasia, VLDLR-associated | VLDLR | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 1 | NC_006583.3:g.91266144del | NM_001286978.1:c.1713del | NP_001273907.1:p.(W572Gfs*10) | NM_001286978.1; NP_001273907.1; published as c.1713delC | 2015 | 25668033 | Genomic position in CanFam3.1 provided by Robert Kuhn | ||
| 1512 | OMIA:002602-9615 | dog | Working Kelpie (Dog) | Cerebellar abiotrophy | VMP1 | substitution | missense | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 9 | NC_049230.1:g.34218228C>A | ENSCAFP00805028489.1:p.(P160Q) | 2022 | 36292596 | |||||
| 995 | OMIA:002152-9615 | dog | Rottweiler (Dog) | Neuroaxonal dystrophy, VPS11-related | VPS11 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 5 | NC_006587.3:g.14777774T>C | XM_546492.6:c.2504A>G | XP_546492.2:p.(H835R) | XM_546492.6; XP_546492.2 | rs852867622 | 2018 | 29945969 | ||
| 478 | OMIA:001428-9615 | dog | Border Collie (Dog) Huntaway (Dog) New Zealand Heading Dog (Dog) | Trapped Neutrophil Syndrome | VPS13B | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 13 | g.1412654_1412657del | c.2893_2896del | p.(V595Ifs) | XM_539102.7; XP_539102.2; published as g.4411950_4411953del GTTT (HM036106.1). BLAST of published sequence (HM036106.1) identified genomic position in CanFam3.1 as g.1412654_1412657del. Additional breeds based on PMID:40965331 | 2011 | 21605373 | |||
| 969 | OMIA:001058-9823 | pig | Mixed Breed (Dog) | Von Willebrand disease III | VWF | duplication | frameshift | Naturally occurring variant | Not currently evaluated | 5 | p.(V814Lfs*3) | "a tandem duplication of exons 17 and 18, causing a frameshift and a premature termination codon (p.Val814LeufsTer3) . . . This duplication putatively originates from porcine SINE elements located within VWF introns 16 and 18 with high identity. | 2018 | 29208651 | ||||||
| 479 | OMIA:001058-9615 | dog | Scottish Terrier (Dog) | Von Willebrand disease III | VWF | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 27 | g.38848107del | c.255del | p.(V86Cfs) | NM_001002932.1; NP_001002932.1; "a single base deletion [C] in the codon for amino acid 85 of the prepro-vWF cDNA" | 2000 | 10668811 | |||
| 968 | OMIA:001058-9615 | dog | Shetland Sheepdog (Dog) | Von Willebrand disease III | VWF | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 27 | g.38868884del | c.738del | p.(F366Lfs) | NM_001002932.1; NP_001002932.1; Venta, P. J., G. J. Brewer, V. Yuzbasiyan-Gurkan, W. D. Schall, and J. Duffendeck, 1998 Inventors; The Regents of the University of Michigan, assignee. DNA encoding canine von Willebrand factor and methods of use. United States patent US6074832A. 1998 Aug 11. | 1998 | Reference not in PubMed; see OMIA 001058-9615 for reference details | |||
| 803 | OMIA:001339-9615 | dog | Chinese Crested (Dog) German Shorthaired Pointer (Dog) German Wirehaired Pointer (Dog) | Von Willebrand disease II | VWF | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 27 | NC_006609.3:g.38887211T>G | NM_001002932.1:c.1657T>G | NP_001002932.1:p.(W553G) | 2017 | 28696025 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 371 | OMIA:001058-9615 | dog | Nederlandse Kooikerhondje (Dog) | Von Willebrand disease III | VWF | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 27 | NC_006609.3:g.38892182G>A | NM_001002932.1:c.2186+1G>A | NM_001002932.1; a G>A base substitution at the first position of the donor splice site sequence of intron 16 | 1998 | 9716162 | ||||
| 84 | OMIA:001339-9615 | dog | Boykin Spaniel (Dog) German Shorthaired Pointer (Dog) German Spitz (Dog) German Wirehaired Pointer (Dog) | Von Willebrand disease II | VWF | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 27 | NC_006609.3:g.38924099A>G | NM_001002932.1:c.4937A>G | NP_001002932.1:p.(N1646S) | variant initially identified in German Shorthaired Pointer and German Wirehaired Pointer and later reported in additional breeds: PMID: 37582787 | rs852456570 | 2004 | 15133170 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 401 | OMIA:001057-9615 | dog | Barbet (Dog) Bernese Mountain Dog (Dog) Brazilian Terrier (Dog) Doberman Pinscher (Dog) Dutch Shepherd (Dog) Huntaway (Dog) Kromfohrlander (Dog) Manchester Terrier (Dog) | Von Willebrand disease I | VWF | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 27 | NC_006609.3:g.38951839G>A | NM_001002932.1:c.7437G>A | NP_001002932.1:p.(S2479S) | Incomplete penetrance - some dogs with the variant do not develop clinical signs of disease. Additional breeds based on PMID:40965331 | 2013 | 23911791 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. | ||
| 1813 | OMIA:001058-9615 | dog | Havanese (Dog) | Von Willebrand disease III | VWF | substitution | missense | Naturally occurring variant | Not currently evaluated | UU_Cfam_GSD_1.0 | 27 | NC_049248.1:g.7133670A>C | NM_001002932.1:c.7711T>G | NP_001002932.1:p.(C2571G) | 2025 | 40504041 | ||||
| 1814 | OMIA:002970-9913 | taurine cattle | Belgian Blue (Cattle) | Cleft palate, syndromic | WDR33 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.4772428C>T | NM_001206078.1: c.2617C>T | NP_001193007.1: p.(P873S) | 2025 | 40525707 | ||||
| 592 | OMIA:002423-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Multiple ocular defects | WFDC1 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 18 | g.10567100_10567101insC | c.321insC | insertion of a single base causes a frame shift mutation and a premature termination codon appeared at codon 126 | 2009 | 19374945 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |||
| 1033 | OMIA:001579-9823 | pig | Large White (Pig) Min, China (Pig) | Ear size | WIF1 | Naturally occurring variant | Not currently evaluated | Sscrofa11.1 | 5 | NC_010447.5:g.29463165G>C | NM_001315718.1:c.708C>G | NP_001302647.1:p.(F236L) | Genomic coordinates changed from g.29463165C>G, c.1167C>G to g.29463165G>C, NM_001315718.1:c.708C>G [09/06/2025] | rs338733115 | 2019 | 30815903 | ||||
| 312 | OMIA:001759-9685 | domestic cat | Burmese (Cat) | Hypokalaemic periodic paralysis | WNK4 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | E1 | NC_058381.1:g.41327499C>T | XM_019817924.3:c.2899C>T | XP_019673483.1:p.(Q967*) | 2012 | 23285264 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | |||
| 1618 | OMIA:002759-9913 | taurine cattle | Brown Swiss (Cattle) | Brachygnathia | WNT10B | duplication | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.30846510dup | XM_010805029.3:c.910dup | XP_010803331.1:p.R304Pfs*14 | XM_010805029.3; XP_010803331.1; published as g.30,846,510dupC; c.910dupC; variant is associated with increased risk of brachygnathia | rs525007739 | 2023 | 37641348 | ||
| 11 | OMIA:000679-9031 | chicken | New Hampshire (Chicken) | Muscular dystrophy | WWP1 | substitution | missense | Naturally occurring variant | Not currently evaluated | GRCg6a | 2 | g.123014353G>A | c.1322G>A | p.(R441Q) | 2008 | 18501710 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1358 | OMIA:002445-9615 | dog | Mixed Breed (Dog) | Xanthinuria, type I | XDH | substitution | splicing | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 17 | NC_006599.3:g.24941551C>T | XM_005630313.3:c.654G>A | XP_005630370.1:p.(R189_L218del) | ENSCAFT00000047701.2; Ensembl VEP reported variant as synonymous, splice region variant, cDNA sequencing revealed removal of all 93 bp of exon 8 (p.Arg189_Leu218del) . Genomic position based on supplementary table S3. (Tate et al., 2021) | 2021 | 34584846 | |||
| 1541 | OMIA:002445-9685 | domestic cat | Domestic Shorthair (Cat) | Xanthinuria, type 1 | XDH | substitution | missense | Naturally occurring variant | Not currently evaluated | F.catus_Fca126_mat1.0 | A3 | NC_058370.1:g.114863284C>T | NM_001009217.1:c.2042C>T | NP_001009217.1:p.(A681V) | Corrected genomic coordinates from g.114863284C>T to (Felis_catus_9.0) NC_018725.3:g.117584799C>T [09/05/2025] | 2023 | 36970934 | Updated to F.catus_Fca126_mat1.0 by Bella Bartner. | ||
| 1172 | OMIA:002256-9615 | dog | Belgian Shepherd Dog (Dog) | Cardiomyopathy and juvenile mortality | YARS2 | substitution | missense | Naturally occurring variant | Not currently evaluated | CanFam3.1 | 27 | NC_006609.3:g.16157324G>A | XM_543740.6:c.1054G>A | XP_543740.1:p.(E352K) | "XM_543740.6:c.1054G>A . . . XP_543740.1:p.(Glu352Lys)" (Gurtner et al. (2020) | 2020 | 32183361 | |||
| 1551 | OMIA:002688-9986 | rabbit | Microcephaly, primary | YIPF5 | substitution | missense | Base-editing | Not currently evaluated | p.(W218R) | 2023 | 37142085 | |||||||||
| 1376 | OMIA:002468-9823 | pig | Bama Xiang Zhu, China (Pig) | ZBED6 knock-out | ZBED6 | deletion, small (<=20) | frameshift | Genome-editing (CRISPR-Cas9) | Not currently evaluated | 9 | c.1320del | c.1320del causes a frameshift after codon 134 and a premature stop occurs at codon 224 (Wang et al., 2021) | 2021 | 34710100 | ||||||
| 921 | OMIA:001736-9913 | taurine cattle | Charolais (Cattle) | Polled and multisystemic syndrome | ZEB2 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 2 | A 3.7Mb deletion encompassing the genes ARHGAP15, GTDC1 and ZEB2 | 2012 | 23152852 | ||||||||
| 1246 | OMIA:001736-9913 | taurine cattle | Simmental (Cattle) | Polledness, abnormal skull shape, small body stature and subfertility | ZEB2 | Del11 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 2 | g.52263360_52263370del | 2020 | 33046754 | ||||||
| 1283 | OMIA:002307-9913 | taurine cattle | Limousin (Cattle) | Frontonasal dysplasia | ZIC2 | deletion, small (<=20) | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 12 | g.76742067del | c.1596del | p.(S453*) | rs3423095151 | 2021 | 33388042 |
* Variant pathogenicity for single-gene diseases as evaluated according to the Animal Variant Classification Guidelines (AVCG) by the Variant Pathogenicity Working Group of the International Society of Animal Genetics (ISAG) Animal Genetic Testing Standardization (AGTS) Standing Committee: P = pathogenic, LP = likely pathogenic, VUS = variant of unknown significance, LB = likely benign, B = benign. For more information (including details on the classification of each variant) see LINKS.
| Overall Statistics | |
|---|---|
| Total number of variants | 1836 |
| Variants with genomic location | 1478 (80.5% ) |
| Variants in a variant database, i.e. with rs ID | 463 (25.2%) |
| Variant Type | Count | Percent |
|---|---|---|
| complex rearrangement | 23 | 1.3% |
| deletion, gross (>20) | 139 | 7.6% |
| deletion, small (<=20) | 290 | 15.8% |
| delins, gross (>20) | 14 | 0.8% |
| delins, small (<=20) | 48 | 2.6% |
| duplication | 50 | 2.7% |
| haplotype | 33 | 1.8% |
| insertion, gross (>20) | 88 | 4.8% |
| insertion, small (<=20) | 80 | 4.4% |
| inversion | 9 | 0.5% |
| not known | 9 | 0.5% |
| reference sequence allele | 8 | 0.4% |
| repeat variation | 20 | 1.1% |
| substitution | 986 | 53.7% |
| unknown | 39 | 2.1% |
| Variant Effect | Count | Percent |
|---|---|---|
| deletion (in-frame) | 57 | 3.1% |
| delins (in-frame) | 10 | 0.5% |
| duplication (in-frame) | 3 | 0.2% |
| extension (stop-lost) | 3 | 0.2% |
| frameshift | 317 | 17.3% |
| insertion (in-frame) | 3 | 0.2% |
| missense | 637 | 34.7% |
| nonsense (stop-gain) | 227 | 12.4% |
| regulatory | 51 | 2.8% |
| splicing | 150 | 8.2% |
| start-lost | 4 | 0.2% |
| synonymous | 1 | 0.1% |
| unknown | 373 | 20.3% |
| Year First Reported | Count | Percent |
|---|---|---|
| 1986 | 1 | 0.1% |
| 1987 | 1 | 0.1% |
| 1988 | 0 | 0.0% |
| 1989 | 2 | 0.1% |
| 1990 | 4 | 0.2% |
| 1991 | 2 | 0.1% |
| 1992 | 5 | 0.3% |
| 1993 | 8 | 0.4% |
| 1994 | 11 | 0.6% |
| 1995 | 7 | 0.4% |
| 1996 | 16 | 0.9% |
| 1997 | 14 | 0.8% |
| 1998 | 25 | 1.4% |
| 1999 | 21 | 1.1% |
| 2000 | 27 | 1.5% |
| 2001 | 16 | 0.9% |
| 2002 | 33 | 1.8% |
| 2003 | 18 | 1.0% |
| 2004 | 20 | 1.1% |
| 2005 | 31 | 1.7% |
| 2006 | 38 | 2.1% |
| 2007 | 61 | 3.3% |
| 2008 | 35 | 1.9% |
| 2009 | 46 | 2.5% |
| 2010 | 49 | 2.7% |
| 2011 | 60 | 3.3% |
| 2012 | 73 | 4.0% |
| 2013 | 76 | 4.1% |
| 2014 | 59 | 3.2% |
| 2015 | 80 | 4.4% |
| 2016 | 87 | 4.7% |
| 2017 | 100 | 5.4% |
| 2018 | 84 | 4.6% |
| 2019 | 100 | 5.4% |
| 2020 | 121 | 6.6% |
| 2021 | 110 | 6.0% |
| 2022 | 79 | 4.3% |
| 2023 | 100 | 5.4% |
| 2024 | 108 | 5.9% |
| 2025 | 79 | 4.3% |
| 2026 | 29 | 1.6% |